ID: 933077739

View in Genome Browser
Species Human (GRCh38)
Location 2:77950907-77950929
Sequence GTGCCCTTCTAGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933077738_933077739 -7 Left 933077738 2:77950891-77950913 CCTAATGAATGATGCTGTGCCCT No data
Right 933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG No data
933077737_933077739 7 Left 933077737 2:77950877-77950899 CCATGGAAAAAGAACCTAATGAA No data
Right 933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG No data
933077736_933077739 23 Left 933077736 2:77950861-77950883 CCTCTTCTACTTTAAACCATGGA No data
Right 933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933077739 Original CRISPR GTGCCCTTCTAGAAGAGTGA AGG Intergenic
No off target data available for this crispr