ID: 933083404

View in Genome Browser
Species Human (GRCh38)
Location 2:78023552-78023574
Sequence TAGCCACTGCTGCTGCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933083404_933083405 0 Left 933083404 2:78023552-78023574 CCTGGTGGCAGCAGCAGTGGCTA No data
Right 933083405 2:78023575-78023597 CAGCTGCAGCACTGTGCAGATGG No data
933083404_933083408 3 Left 933083404 2:78023552-78023574 CCTGGTGGCAGCAGCAGTGGCTA No data
Right 933083408 2:78023578-78023600 CTGCAGCACTGTGCAGATGGGGG No data
933083404_933083407 2 Left 933083404 2:78023552-78023574 CCTGGTGGCAGCAGCAGTGGCTA No data
Right 933083407 2:78023577-78023599 GCTGCAGCACTGTGCAGATGGGG No data
933083404_933083406 1 Left 933083404 2:78023552-78023574 CCTGGTGGCAGCAGCAGTGGCTA No data
Right 933083406 2:78023576-78023598 AGCTGCAGCACTGTGCAGATGGG No data
933083404_933083409 8 Left 933083404 2:78023552-78023574 CCTGGTGGCAGCAGCAGTGGCTA No data
Right 933083409 2:78023583-78023605 GCACTGTGCAGATGGGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933083404 Original CRISPR TAGCCACTGCTGCTGCCACC AGG (reversed) Intergenic
No off target data available for this crispr