ID: 933099263

View in Genome Browser
Species Human (GRCh38)
Location 2:78230990-78231012
Sequence CCCTTTTATGTCATCTGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933099263_933099269 17 Left 933099263 2:78230990-78231012 CCCTAGCAGATGACATAAAAGGG No data
Right 933099269 2:78231030-78231052 ACAAGGAAGTAGTGACTTCTTGG No data
933099263_933099267 0 Left 933099263 2:78230990-78231012 CCCTAGCAGATGACATAAAAGGG No data
Right 933099267 2:78231013-78231035 GAGAGTTTGTCCATGAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933099263 Original CRISPR CCCTTTTATGTCATCTGCTA GGG (reversed) Intergenic
No off target data available for this crispr