ID: 933104828

View in Genome Browser
Species Human (GRCh38)
Location 2:78311258-78311280
Sequence ATGCCCACCCTAATTGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933104828_933104834 17 Left 933104828 2:78311258-78311280 CCCTCACCAATTAGGGTGGGCAT No data
Right 933104834 2:78311298-78311320 GCCTGAATAGAATAAAAAGGTGG 0: 7
1: 31
2: 97
3: 178
4: 480
933104828_933104833 14 Left 933104828 2:78311258-78311280 CCCTCACCAATTAGGGTGGGCAT No data
Right 933104833 2:78311295-78311317 AGAGCCTGAATAGAATAAAAAGG 0: 4
1: 20
2: 142
3: 415
4: 905
933104828_933104836 24 Left 933104828 2:78311258-78311280 CCCTCACCAATTAGGGTGGGCAT No data
Right 933104836 2:78311305-78311327 TAGAATAAAAAGGTGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933104828 Original CRISPR ATGCCCACCCTAATTGGTGA GGG (reversed) Intergenic
No off target data available for this crispr