ID: 933105058

View in Genome Browser
Species Human (GRCh38)
Location 2:78314080-78314102
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933105058_933105060 30 Left 933105058 2:78314080-78314102 CCTCTATCTTACACCACACAGAA No data
Right 933105060 2:78314133-78314155 GACATAACCATAAAACCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933105058 Original CRISPR TTCTGTGTGGTGTAAGATAG AGG (reversed) Intergenic
No off target data available for this crispr