ID: 933111043

View in Genome Browser
Species Human (GRCh38)
Location 2:78400696-78400718
Sequence TAGTGTCAATAGGGTAGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933111043_933111050 19 Left 933111043 2:78400696-78400718 CCAATCCTACCCTATTGACACTA No data
Right 933111050 2:78400738-78400760 AGGAAATCAGCAGGGCACAGTGG No data
933111043_933111048 10 Left 933111043 2:78400696-78400718 CCAATCCTACCCTATTGACACTA No data
Right 933111048 2:78400729-78400751 TAGAGAAAGAGGAAATCAGCAGG No data
933111043_933111049 11 Left 933111043 2:78400696-78400718 CCAATCCTACCCTATTGACACTA No data
Right 933111049 2:78400730-78400752 AGAGAAAGAGGAAATCAGCAGGG No data
933111043_933111047 -1 Left 933111043 2:78400696-78400718 CCAATCCTACCCTATTGACACTA No data
Right 933111047 2:78400718-78400740 ATTGCATAAGATAGAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933111043 Original CRISPR TAGTGTCAATAGGGTAGGAT TGG (reversed) Intergenic
No off target data available for this crispr