ID: 933111044

View in Genome Browser
Species Human (GRCh38)
Location 2:78400701-78400723
Sequence TGCAATAGTGTCAATAGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933111044_933111047 -6 Left 933111044 2:78400701-78400723 CCTACCCTATTGACACTATTGCA No data
Right 933111047 2:78400718-78400740 ATTGCATAAGATAGAGAAAGAGG No data
933111044_933111048 5 Left 933111044 2:78400701-78400723 CCTACCCTATTGACACTATTGCA No data
Right 933111048 2:78400729-78400751 TAGAGAAAGAGGAAATCAGCAGG No data
933111044_933111050 14 Left 933111044 2:78400701-78400723 CCTACCCTATTGACACTATTGCA No data
Right 933111050 2:78400738-78400760 AGGAAATCAGCAGGGCACAGTGG No data
933111044_933111049 6 Left 933111044 2:78400701-78400723 CCTACCCTATTGACACTATTGCA No data
Right 933111049 2:78400730-78400752 AGAGAAAGAGGAAATCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933111044 Original CRISPR TGCAATAGTGTCAATAGGGT AGG (reversed) Intergenic
No off target data available for this crispr