ID: 933111045

View in Genome Browser
Species Human (GRCh38)
Location 2:78400705-78400727
Sequence CTTATGCAATAGTGTCAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933111045_933111049 2 Left 933111045 2:78400705-78400727 CCCTATTGACACTATTGCATAAG No data
Right 933111049 2:78400730-78400752 AGAGAAAGAGGAAATCAGCAGGG No data
933111045_933111048 1 Left 933111045 2:78400705-78400727 CCCTATTGACACTATTGCATAAG No data
Right 933111048 2:78400729-78400751 TAGAGAAAGAGGAAATCAGCAGG No data
933111045_933111047 -10 Left 933111045 2:78400705-78400727 CCCTATTGACACTATTGCATAAG No data
Right 933111047 2:78400718-78400740 ATTGCATAAGATAGAGAAAGAGG No data
933111045_933111050 10 Left 933111045 2:78400705-78400727 CCCTATTGACACTATTGCATAAG No data
Right 933111050 2:78400738-78400760 AGGAAATCAGCAGGGCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933111045 Original CRISPR CTTATGCAATAGTGTCAATA GGG (reversed) Intergenic
No off target data available for this crispr