ID: 933111047

View in Genome Browser
Species Human (GRCh38)
Location 2:78400718-78400740
Sequence ATTGCATAAGATAGAGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933111044_933111047 -6 Left 933111044 2:78400701-78400723 CCTACCCTATTGACACTATTGCA No data
Right 933111047 2:78400718-78400740 ATTGCATAAGATAGAGAAAGAGG No data
933111045_933111047 -10 Left 933111045 2:78400705-78400727 CCCTATTGACACTATTGCATAAG No data
Right 933111047 2:78400718-78400740 ATTGCATAAGATAGAGAAAGAGG No data
933111043_933111047 -1 Left 933111043 2:78400696-78400718 CCAATCCTACCCTATTGACACTA No data
Right 933111047 2:78400718-78400740 ATTGCATAAGATAGAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933111047 Original CRISPR ATTGCATAAGATAGAGAAAG AGG Intergenic
No off target data available for this crispr