ID: 933111049

View in Genome Browser
Species Human (GRCh38)
Location 2:78400730-78400752
Sequence AGAGAAAGAGGAAATCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933111045_933111049 2 Left 933111045 2:78400705-78400727 CCCTATTGACACTATTGCATAAG No data
Right 933111049 2:78400730-78400752 AGAGAAAGAGGAAATCAGCAGGG No data
933111044_933111049 6 Left 933111044 2:78400701-78400723 CCTACCCTATTGACACTATTGCA No data
Right 933111049 2:78400730-78400752 AGAGAAAGAGGAAATCAGCAGGG No data
933111043_933111049 11 Left 933111043 2:78400696-78400718 CCAATCCTACCCTATTGACACTA No data
Right 933111049 2:78400730-78400752 AGAGAAAGAGGAAATCAGCAGGG No data
933111046_933111049 1 Left 933111046 2:78400706-78400728 CCTATTGACACTATTGCATAAGA No data
Right 933111049 2:78400730-78400752 AGAGAAAGAGGAAATCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933111049 Original CRISPR AGAGAAAGAGGAAATCAGCA GGG Intergenic
No off target data available for this crispr