ID: 933120112

View in Genome Browser
Species Human (GRCh38)
Location 2:78525924-78525946
Sequence ACATAGAGACTATCCTAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933120112_933120114 4 Left 933120112 2:78525924-78525946 CCCATCTAGGATAGTCTCTATGT No data
Right 933120114 2:78525951-78525973 TAAATCAAAGTCAATTCATTAGG No data
933120112_933120115 5 Left 933120112 2:78525924-78525946 CCCATCTAGGATAGTCTCTATGT No data
Right 933120115 2:78525952-78525974 AAATCAAAGTCAATTCATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933120112 Original CRISPR ACATAGAGACTATCCTAGAT GGG (reversed) Intergenic
No off target data available for this crispr