ID: 933123312

View in Genome Browser
Species Human (GRCh38)
Location 2:78570906-78570928
Sequence ATGCATTTGAATAAACAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933123312_933123314 0 Left 933123312 2:78570906-78570928 CCTTGCTGTTTATTCAAATGCAT No data
Right 933123314 2:78570929-78570951 AGTAAATGGCTTAGCCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933123312 Original CRISPR ATGCATTTGAATAAACAGCA AGG (reversed) Intergenic
No off target data available for this crispr