ID: 933131221

View in Genome Browser
Species Human (GRCh38)
Location 2:78676391-78676413
Sequence AACATCCACCTCCTTAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933131219_933131221 10 Left 933131219 2:78676358-78676380 CCTGGTAAGTTACTTTGTGTGCT No data
Right 933131221 2:78676391-78676413 AACATCCACCTCCTTAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933131221 Original CRISPR AACATCCACCTCCTTAATGG AGG Intergenic
No off target data available for this crispr