ID: 933131697

View in Genome Browser
Species Human (GRCh38)
Location 2:78681050-78681072
Sequence TGGGATACACACCCCCACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933131691_933131697 9 Left 933131691 2:78681018-78681040 CCCCAGAATGTGAGAAGGGGAGA No data
Right 933131697 2:78681050-78681072 TGGGATACACACCCCCACCAGGG No data
933131693_933131697 7 Left 933131693 2:78681020-78681042 CCAGAATGTGAGAAGGGGAGATA No data
Right 933131697 2:78681050-78681072 TGGGATACACACCCCCACCAGGG No data
933131692_933131697 8 Left 933131692 2:78681019-78681041 CCCAGAATGTGAGAAGGGGAGAT No data
Right 933131697 2:78681050-78681072 TGGGATACACACCCCCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933131697 Original CRISPR TGGGATACACACCCCCACCA GGG Intergenic
No off target data available for this crispr