ID: 933133162

View in Genome Browser
Species Human (GRCh38)
Location 2:78698648-78698670
Sequence GAAAATATGCCCCTTTAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933133158_933133162 29 Left 933133158 2:78698596-78698618 CCTCAGATATTTTTTTTCTTGTA No data
Right 933133162 2:78698648-78698670 GAAAATATGCCCCTTTAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933133162 Original CRISPR GAAAATATGCCCCTTTAAAT AGG Intergenic
No off target data available for this crispr