ID: 933145919

View in Genome Browser
Species Human (GRCh38)
Location 2:78852321-78852343
Sequence CTGGAGGCCTAGGATTGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933145910_933145919 28 Left 933145910 2:78852270-78852292 CCCTTCCTGGGGGCTGCAAAGCT No data
Right 933145919 2:78852321-78852343 CTGGAGGCCTAGGATTGTTTGGG No data
933145911_933145919 27 Left 933145911 2:78852271-78852293 CCTTCCTGGGGGCTGCAAAGCTT No data
Right 933145919 2:78852321-78852343 CTGGAGGCCTAGGATTGTTTGGG No data
933145912_933145919 23 Left 933145912 2:78852275-78852297 CCTGGGGGCTGCAAAGCTTTACA No data
Right 933145919 2:78852321-78852343 CTGGAGGCCTAGGATTGTTTGGG No data
933145916_933145919 -8 Left 933145916 2:78852306-78852328 CCTATTAGTGGAAGTCTGGAGGC No data
Right 933145919 2:78852321-78852343 CTGGAGGCCTAGGATTGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933145919 Original CRISPR CTGGAGGCCTAGGATTGTTT GGG Intergenic
No off target data available for this crispr