ID: 933158951

View in Genome Browser
Species Human (GRCh38)
Location 2:79003078-79003100
Sequence CATGGTGACCAGCAGCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933158940_933158951 29 Left 933158940 2:79003026-79003048 CCCTGCTGCAGACACTGTGCATG No data
Right 933158951 2:79003078-79003100 CATGGTGACCAGCAGCCCAGAGG No data
933158941_933158951 28 Left 933158941 2:79003027-79003049 CCTGCTGCAGACACTGTGCATGA No data
Right 933158951 2:79003078-79003100 CATGGTGACCAGCAGCCCAGAGG No data
933158947_933158951 4 Left 933158947 2:79003051-79003073 CCAGGAGTGGACATGTCAGGGCC No data
Right 933158951 2:79003078-79003100 CATGGTGACCAGCAGCCCAGAGG No data
933158946_933158951 5 Left 933158946 2:79003050-79003072 CCCAGGAGTGGACATGTCAGGGC No data
Right 933158951 2:79003078-79003100 CATGGTGACCAGCAGCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933158951 Original CRISPR CATGGTGACCAGCAGCCCAG AGG Intergenic
No off target data available for this crispr