ID: 933166448

View in Genome Browser
Species Human (GRCh38)
Location 2:79082079-79082101
Sequence TGTGAGCCAGAAGACAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933166448_933166453 14 Left 933166448 2:79082079-79082101 CCCCCACTGTCTTCTGGCTCACA No data
Right 933166453 2:79082116-79082138 AGATCCTCTGTTAGTCTGATTGG 0: 56
1: 3649
2: 4400
3: 2466
4: 2127
933166448_933166456 28 Left 933166448 2:79082079-79082101 CCCCCACTGTCTTCTGGCTCACA No data
Right 933166456 2:79082130-79082152 TCTGATTGGTGTCCCTTTGTGGG No data
933166448_933166455 27 Left 933166448 2:79082079-79082101 CCCCCACTGTCTTCTGGCTCACA No data
Right 933166455 2:79082129-79082151 GTCTGATTGGTGTCCCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933166448 Original CRISPR TGTGAGCCAGAAGACAGTGG GGG (reversed) Intergenic
No off target data available for this crispr