ID: 933167127

View in Genome Browser
Species Human (GRCh38)
Location 2:79088443-79088465
Sequence CTTCTGAAGTAGGTCTTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933167127_933167132 30 Left 933167127 2:79088443-79088465 CCTCTCAAGACCTACTTCAGAAG 0: 1
1: 0
2: 1
3: 10
4: 150
Right 933167132 2:79088496-79088518 ATAAAGATAATACCAGAGACTGG 0: 3
1: 26
2: 377
3: 712
4: 1104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933167127 Original CRISPR CTTCTGAAGTAGGTCTTGAG AGG (reversed) Intergenic
902342716 1:15794547-15794569 TTTCTGAAGTGGGTCTGTAGTGG - Intergenic
902820138 1:18938644-18938666 CTTGTGCAGAAGGTCTAGAGAGG - Intronic
903480065 1:23646546-23646568 CTTGTGAAGTAGGTTGTTAGAGG - Intergenic
912387221 1:109277522-109277544 CTGCTGAAGCAGGTTTAGAGTGG + Intergenic
912586395 1:110770874-110770896 CTTTTTAAGTAGCCCTTGAGTGG + Intergenic
913125734 1:115786853-115786875 CTTCTGAAGTATTTCTTTAAAGG + Intergenic
915641345 1:157229513-157229535 CTTCTCAAGGAGGTCGGGAGAGG + Intergenic
918067852 1:181113484-181113506 CTTCTGAAGTAGCCCGGGAGGGG + Intergenic
919323783 1:196079978-196080000 CTTCTGGAGTTGATCCTGAGAGG + Intergenic
924158758 1:241208472-241208494 CATCTGAGGTAGGTGTTGGGAGG - Intronic
1063856967 10:10265705-10265727 CTTTTCAAGTAGTTCTTAAGGGG + Intergenic
1063863777 10:10341896-10341918 CTGCAGAAGTAGGTTTAGAGGGG + Intergenic
1063986767 10:11512752-11512774 CATTTGACCTAGGTCTTGAGAGG - Intronic
1066100978 10:32118281-32118303 CTTCTTAGGTAGGTCTTCAAAGG + Intergenic
1067220919 10:44343791-44343813 CCTCTGCAGTAGGGCTTGGGAGG - Intergenic
1067777367 10:49173305-49173327 CTTCGGTAGTGGGTCCTGAGAGG + Intronic
1069632104 10:69903208-69903230 GTTCTGAAGGAGGTAGTGAGGGG + Intronic
1071721896 10:88155093-88155115 CTACTGTAATAGGTCTTGGGTGG + Intergenic
1074351087 10:112737748-112737770 CTCCAGAAGTATGTCCTGAGAGG - Intronic
1079442032 11:20524493-20524515 CTAATGCTGTAGGTCTTGAGTGG + Intergenic
1079774123 11:24502044-24502066 CTTCTCAAGTAGGTGTTATGGGG - Intronic
1084955728 11:72690365-72690387 CTGCAGAAGTGGGTCTTGGGAGG + Intronic
1086337867 11:85817047-85817069 CTTCTGCAGTAGGTGCAGAGGGG - Intergenic
1089044530 11:115488461-115488483 CTTGTGAAGGAGTTTTTGAGAGG - Intronic
1089838004 11:121388644-121388666 ATTCTGATGCAGGTCTGGAGTGG - Intergenic
1091396452 12:156595-156617 TTTCTCATTTAGGTCTTGAGGGG - Intronic
1091606065 12:1952575-1952597 CTTCTTCAGTAACTCTTGAGGGG + Exonic
1094586895 12:31785793-31785815 CTTTTGAAGAAGGACTTGTGTGG + Intergenic
1095971235 12:47903322-47903344 CTTCTCAAATAGGTCCAGAGAGG + Intronic
1096643610 12:53014902-53014924 CTTCTGAATCAGCTCTTGATTGG + Intronic
1099348522 12:81534766-81534788 CTTCTGAAAGAGTTCTTGTGTGG - Intronic
1102405122 12:112666697-112666719 CTTGTGAAGTAGGTTCTTAGAGG + Intronic
1102827076 12:115957159-115957181 CTTCTGCAGTATGTCTTACGAGG + Exonic
1104061884 12:125275592-125275614 ATTCTGAAGTGGGTTTTGAAAGG + Intronic
1104594092 12:130108333-130108355 CTGCTTCAGTAGGTCTGGAGAGG - Intergenic
1106118131 13:26834591-26834613 CTTCTGTACTTGGTCTTGATTGG - Intergenic
1107126937 13:36856300-36856322 CTTATGTAATAGGTTTTGAGAGG - Intronic
1107849513 13:44556827-44556849 CATCTGCATTAGGTCTTCAGAGG - Intronic
1111483559 13:88865351-88865373 CTACTGCAGTAGCTCTTGACTGG - Intergenic
1112338964 13:98537145-98537167 CTTCAGAGGTAGGTCTTGAGGGG - Intronic
1112789843 13:102991255-102991277 CTTCTGAAGGAGGATTTGAGAGG + Intergenic
1117588623 14:57241430-57241452 TTTCTGAAGTGGGTATTAAGGGG - Intronic
1118734654 14:68692577-68692599 ATCCTGAATGAGGTCTTGAGAGG + Intronic
1119336652 14:73838892-73838914 CTTGTTAAGTAGCTCTTTAGGGG - Intergenic
1119566217 14:75631360-75631382 CTGCTGCAGTAGGTCTGGGGTGG + Intronic
1122361064 14:101164443-101164465 CATTTGAAGTAGGGCTTGTGAGG + Intergenic
1124910073 15:33911128-33911150 GTGCTGGAGTTGGTCTTGAGAGG - Intronic
1128314217 15:66650132-66650154 CCTTTGAAGCAGGTCTTGAAAGG - Intronic
1132084848 15:98899757-98899779 CTGCTCGAGTAGGTCTTGGGTGG + Intronic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1140992934 16:80231862-80231884 CCTCTGATGGAGGTCTTCAGTGG - Intergenic
1143887200 17:10073579-10073601 CTGATGTAGGAGGTCTTGAGGGG - Intronic
1147746440 17:42697643-42697665 GTTCGGAAGTGGGTCTTGAGGGG - Exonic
1148645519 17:49217847-49217869 CTCCTGCAGTAGGGCGTGAGAGG - Exonic
1149679774 17:58497810-58497832 CTTATTCAGTAGGTCTTGGGTGG - Intronic
1153085184 18:1278224-1278246 CTTCAGAAGGAAGTCTTGAGAGG + Intergenic
1153633496 18:7094136-7094158 CTGATGCAGTAGGTCTGGAGTGG + Intronic
1156477000 18:37411822-37411844 CAGCTGAACTAGGCCTTGAGAGG - Intronic
1156700119 18:39815421-39815443 CTGCTGAAGTGGCTCATGAGGGG + Intergenic
1163455339 19:17403181-17403203 CCTCTGGAGCAGGTCTGGAGGGG - Exonic
1163784750 19:19269360-19269382 CTTCAGGGGTAGGTCTTGGGAGG - Intronic
1168524867 19:57080789-57080811 ATTCTGAAGAAGTTCTTTAGGGG + Intergenic
925787538 2:7447697-7447719 TTTCTGATTTAGGTCTAGAGAGG - Intergenic
926723882 2:15982731-15982753 CTACTAAAGTGGCTCTTGAGGGG + Intergenic
927082405 2:19643522-19643544 CTTATGAAGGACGTCTTCAGTGG - Intergenic
928890542 2:36198613-36198635 CTTCTCAAGATAGTCTTGAGTGG + Intergenic
929254899 2:39799670-39799692 TTTTTGCAGTAGGTCTTGTGTGG + Intergenic
929746360 2:44663542-44663564 CTTCTGAAAATGGACTTGAGTGG - Intronic
930148142 2:48028800-48028822 CTGCTTCAGTAGGTCTTGGGTGG + Intergenic
933167127 2:79088443-79088465 CTTCTGAAGTAGGTCTTGAGAGG - Intergenic
933170501 2:79120024-79120046 CCCTTGAGGTAGGTCTTGAGAGG + Intergenic
936845898 2:116832688-116832710 TTTCAGTAGTAGGTGTTGAGTGG + Intergenic
937168087 2:119839411-119839433 CTTCTGAAGTGAGTGATGAGAGG + Intronic
937759634 2:125585266-125585288 CTTCTGAAGTTGTCCTTCAGAGG - Intergenic
940614769 2:156036580-156036602 ATTCTGCAATAGCTCTTGAGTGG + Intergenic
940628328 2:156205407-156205429 CTTCTGAACTATGTCCTGTGTGG + Intergenic
941465786 2:165825167-165825189 CTTGAGAAGGAGGACTTGAGAGG + Intergenic
944185350 2:196942047-196942069 CTTCTTTAGTAGGCCTTGGGTGG + Intergenic
944335267 2:198526248-198526270 CTTCTGAAGTCAGGCTTCAGAGG - Intronic
945701115 2:213171891-213171913 CTTCTGTTGTATGTTTTGAGTGG - Intergenic
945743855 2:213696722-213696744 CTGTTGAAGTTGGTCTGGAGGGG + Intronic
945924072 2:215785971-215785993 CTTCTGAAGTAAGTCTTCTCAGG - Intergenic
1168892362 20:1303283-1303305 CATCTGAAGTGCGTCTTGAAGGG - Intronic
1169060877 20:2659684-2659706 CATCTTAAGTAGGTCATGGGAGG - Exonic
1172261618 20:33571154-33571176 CTTTTTAAGTGGGTCTGGAGGGG + Intronic
1173642089 20:44610391-44610413 CTTCTGAGCTAGGTGTTGTGGGG + Intronic
1173882320 20:46424934-46424956 CTGCTTCAGTAGGTCTGGAGGGG - Intronic
1174735276 20:52960175-52960197 CTGATAAAGTAGGACTTGAGTGG - Intergenic
1175559730 20:59911320-59911342 CTTTGGAAATAGGACTTGAGTGG - Intronic
1179490287 21:41736780-41736802 CTTCTGAAGTCCCTCTTGAGTGG - Intergenic
1182373689 22:29830502-29830524 CTTCTGAACTGGGTATTGAAGGG - Intronic
949606708 3:5661525-5661547 CTAATTAAGTAGGTCTTGAGTGG - Intergenic
950687801 3:14631238-14631260 GTTCTGAAGTAGTTCTTGATGGG - Intergenic
952831809 3:37571378-37571400 CTTCTTAGGTGGGTATTGAGTGG + Intronic
954658327 3:52211628-52211650 TTCCTGAAGTTGGGCTTGAGCGG + Intronic
955961270 3:64343527-64343549 CATCCCAAGTAGGTCTTGAAGGG + Intronic
956475686 3:69617717-69617739 CTGCTACAGTAGGTCTTGGGTGG - Intergenic
960348264 3:116561729-116561751 ATACTGAAGTAGGCCTGGAGAGG + Intronic
963010592 3:140766520-140766542 CTTTTGAAGTGGCTCTTGACAGG - Intergenic
966386522 3:179404828-179404850 CTTCTGAAGCAGATCTTGTATGG - Intronic
967884569 3:194324273-194324295 TTTCTGGAGCCGGTCTTGAGAGG - Intergenic
970473192 4:16396847-16396869 CTTCTGAACTTGGTCTCCAGAGG + Intergenic
972658340 4:41088652-41088674 CTTCTGAAGTAGGGATTGGATGG + Intronic
976206601 4:82628393-82628415 CTTCTGAAATAAGCCTTGTGAGG + Intergenic
976838517 4:89403945-89403967 CTTCTGAAAGAGGCCTGGAGAGG + Intergenic
978538423 4:109787973-109787995 CCTCTGAAGTGGGGCCTGAGTGG - Intronic
978713265 4:111810677-111810699 CTACTTCAGTAGGTCTTGGGTGG + Intergenic
979067411 4:116156020-116156042 CTAATGTAGTAGGTCTTGAGTGG - Intergenic
981335509 4:143564767-143564789 CTTATAAAGTATGTCTAGAGGGG - Intergenic
982072571 4:151708244-151708266 GTTCTGAAGTAGGTCGTGGCTGG + Intronic
982563181 4:156956384-156956406 CTATTTTAGTAGGTCTTGAGTGG - Intronic
986271754 5:6237223-6237245 TTTCTGGAGGAGGTCGTGAGTGG + Intergenic
992191821 5:74299846-74299868 CTCCTGAAGTAGGTCATAACAGG + Intergenic
994608082 5:101996303-101996325 CTAATAAAGTAAGTCTTGAGAGG - Intergenic
995537592 5:113152882-113152904 CTTCTGATGTAGGGCTAGGGTGG + Intronic
998812393 5:145979224-145979246 CTTCTGTAGTAGGTCTGGGGTGG - Intronic
1004265519 6:14145468-14145490 ATTCTGAACTAGCTCTTGGGAGG - Intergenic
1005052560 6:21698426-21698448 CTTCTGAAGTAGGAAGTGCGGGG + Intergenic
1010729403 6:79373329-79373351 CAGCTGCAGTAGGTCTGGAGTGG + Intergenic
1012626755 6:101414222-101414244 CTTCTGAATGAGGTCCTCAGTGG - Intronic
1012882911 6:104813131-104813153 TTTCTGATGCAAGTCTTGAGAGG - Intronic
1014598530 6:123377421-123377443 CTGATTCAGTAGGTCTTGAGTGG + Intronic
1017113402 6:150953480-150953502 CTCCTGGAGTATGTATTGAGGGG - Intronic
1018779349 6:167047663-167047685 CATCTGAATTAGGTTTTGAAAGG - Exonic
1021764864 7:23938909-23938931 TTTCTGGAGTAGGTTTTGTGGGG + Intergenic
1021897010 7:25246597-25246619 CTGCTTCAGTAGGTCTGGAGTGG + Intergenic
1023402902 7:39803251-39803273 TTTCTGAAGTGGGTCTGTAGTGG - Intergenic
1024646730 7:51377385-51377407 TTTCTGAAGTGGGTCTGTAGTGG + Intergenic
1024854240 7:53758795-53758817 TATCTGAAGTAGCTCTTTAGAGG + Intergenic
1025062324 7:55821163-55821185 TTTCACAAGTAGGTCTTGAGTGG - Intronic
1025215993 7:57057144-57057166 TTTATGAAGTAGGTCTACAGCGG - Intergenic
1025617958 7:63140619-63140641 TTTCACAAGTAGGTCTTGAGTGG - Intergenic
1025626731 7:63229545-63229567 TTTATGAAGTAGGTCTACAGCGG - Intergenic
1025655387 7:63513560-63513582 TTTATGAAGTAGGTCTACAGCGG + Intergenic
1026364164 7:69630777-69630799 CTGATTCAGTAGGTCTTGAGTGG - Intronic
1029482558 7:100822192-100822214 CTTAAGAAGTGGGTCCTGAGTGG + Intronic
1035851776 8:2926907-2926929 CTTCTGAACTTGGTTTTGATAGG - Intergenic
1036018507 8:4815035-4815057 CTTCTGAATTATGACTTGACTGG + Intronic
1036703979 8:11032774-11032796 CTTGTAAGGTAGGTCCTGAGAGG - Intronic
1036916810 8:12812011-12812033 CATCTGAGCTGGGTCTTGAGGGG - Intergenic
1038297814 8:26312210-26312232 CTTCTGAATAAGGAATTGAGGGG - Intronic
1041206665 8:55506355-55506377 CTTCTGGCTGAGGTCTTGAGTGG - Intronic
1042717805 8:71793849-71793871 CTTCTGATCTAGGTCTTAAAAGG - Intergenic
1043780630 8:84329926-84329948 CTTTTAAAGTAAGTCTTGAAGGG - Intronic
1044594482 8:93944462-93944484 CCTCTGAAGTTGATCTTCAGAGG - Intergenic
1044736709 8:95286250-95286272 CTGATTAAATAGGTCTTGAGTGG + Intergenic
1046249278 8:111609497-111609519 CTTCTGAGGGAGATCATGAGTGG - Intergenic
1046687610 8:117244699-117244721 CTCCTGAATTAGGTGTGGAGGGG - Intergenic
1047106871 8:121741890-121741912 CTTCTGAGGAAGTTCTTCAGAGG + Intergenic
1048015274 8:130491380-130491402 CTTCTGAAGAAAGCCTGGAGCGG - Intergenic
1049993211 9:1009626-1009648 GTTCTGAAGTAGGATTTAAGGGG + Intergenic
1050799644 9:9593869-9593891 TTACTGAAGTAAGTCATGAGGGG - Intronic
1051779591 9:20674879-20674901 CTTATTAAGTAGGTATTGGGGGG - Intronic
1056659788 9:88535295-88535317 CATCTGGGGCAGGTCTTGAGAGG + Exonic
1058295324 9:103299305-103299327 CTTCTGAAATATGTTTTAAGAGG - Intergenic
1058637035 9:107047325-107047347 CTGCTGAAACAGGTCTTCAGAGG - Intergenic
1058650131 9:107167826-107167848 ATTGTGAAGTAGCCCTTGAGGGG - Intergenic
1186802990 X:13112122-13112144 CTTCATAAGTATTTCTTGAGTGG + Intergenic
1188441064 X:30215725-30215747 CTTCTGCATTTGGTCCTGAGAGG + Intronic
1188779664 X:34265997-34266019 CTTCAGAAATAGGACTTGGGAGG - Intergenic
1195991510 X:110687145-110687167 ATGATGCAGTAGGTCTTGAGTGG + Intronic
1198929125 X:141834692-141834714 TTTCTTTAGTAGGTCTGGAGGGG - Intergenic