ID: 933168175

View in Genome Browser
Species Human (GRCh38)
Location 2:79097182-79097204
Sequence GAAAATGCCCAAATCCAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933168175_933168183 26 Left 933168175 2:79097182-79097204 CCTACCTGGATTTGGGCATTTTC No data
Right 933168183 2:79097231-79097253 TTGAAACATGTGCCAGGTGGAGG No data
933168175_933168184 29 Left 933168175 2:79097182-79097204 CCTACCTGGATTTGGGCATTTTC No data
Right 933168184 2:79097234-79097256 AAACATGTGCCAGGTGGAGGTGG No data
933168175_933168182 23 Left 933168175 2:79097182-79097204 CCTACCTGGATTTGGGCATTTTC No data
Right 933168182 2:79097228-79097250 CACTTGAAACATGTGCCAGGTGG No data
933168175_933168181 20 Left 933168175 2:79097182-79097204 CCTACCTGGATTTGGGCATTTTC No data
Right 933168181 2:79097225-79097247 CTGCACTTGAAACATGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933168175 Original CRISPR GAAAATGCCCAAATCCAGGT AGG (reversed) Intergenic
No off target data available for this crispr