ID: 933171609

View in Genome Browser
Species Human (GRCh38)
Location 2:79131720-79131742
Sequence ATTGGCTGAGCAGTTCCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933171609_933171616 20 Left 933171609 2:79131720-79131742 CCCCTAGGAACTGCTCAGCCAAT No data
Right 933171616 2:79131763-79131785 TGAATTGATGGCCCATCCTCTGG No data
933171609_933171617 25 Left 933171609 2:79131720-79131742 CCCCTAGGAACTGCTCAGCCAAT No data
Right 933171617 2:79131768-79131790 TGATGGCCCATCCTCTGGATTGG No data
933171609_933171615 8 Left 933171609 2:79131720-79131742 CCCCTAGGAACTGCTCAGCCAAT No data
Right 933171615 2:79131751-79131773 TTGTATCATTTGTGAATTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933171609 Original CRISPR ATTGGCTGAGCAGTTCCTAG GGG (reversed) Intergenic
No off target data available for this crispr