ID: 933171610

View in Genome Browser
Species Human (GRCh38)
Location 2:79131721-79131743
Sequence GATTGGCTGAGCAGTTCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933171610_933171615 7 Left 933171610 2:79131721-79131743 CCCTAGGAACTGCTCAGCCAATC No data
Right 933171615 2:79131751-79131773 TTGTATCATTTGTGAATTGATGG No data
933171610_933171616 19 Left 933171610 2:79131721-79131743 CCCTAGGAACTGCTCAGCCAATC No data
Right 933171616 2:79131763-79131785 TGAATTGATGGCCCATCCTCTGG No data
933171610_933171617 24 Left 933171610 2:79131721-79131743 CCCTAGGAACTGCTCAGCCAATC No data
Right 933171617 2:79131768-79131790 TGATGGCCCATCCTCTGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933171610 Original CRISPR GATTGGCTGAGCAGTTCCTA GGG (reversed) Intergenic