ID: 933171610 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:79131721-79131743 |
| Sequence | GATTGGCTGAGCAGTTCCTA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 933171610_933171615 | 7 | Left | 933171610 | 2:79131721-79131743 | CCCTAGGAACTGCTCAGCCAATC | No data | ||
| Right | 933171615 | 2:79131751-79131773 | TTGTATCATTTGTGAATTGATGG | No data | ||||
| 933171610_933171616 | 19 | Left | 933171610 | 2:79131721-79131743 | CCCTAGGAACTGCTCAGCCAATC | No data | ||
| Right | 933171616 | 2:79131763-79131785 | TGAATTGATGGCCCATCCTCTGG | No data | ||||
| 933171610_933171617 | 24 | Left | 933171610 | 2:79131721-79131743 | CCCTAGGAACTGCTCAGCCAATC | No data | ||
| Right | 933171617 | 2:79131768-79131790 | TGATGGCCCATCCTCTGGATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 933171610 | Original CRISPR | GATTGGCTGAGCAGTTCCTA GGG (reversed) | Intergenic | ||