ID: 933171613

View in Genome Browser
Species Human (GRCh38)
Location 2:79131738-79131760
Sequence AATGATACAAGGACCACGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933171613_933171617 7 Left 933171613 2:79131738-79131760 CCAATCGTGGTCCTTGTATCATT No data
Right 933171617 2:79131768-79131790 TGATGGCCCATCCTCTGGATTGG No data
933171613_933171621 28 Left 933171613 2:79131738-79131760 CCAATCGTGGTCCTTGTATCATT No data
Right 933171621 2:79131789-79131811 GGAGAAGAGTGCACAATGCATGG No data
933171613_933171615 -10 Left 933171613 2:79131738-79131760 CCAATCGTGGTCCTTGTATCATT No data
Right 933171615 2:79131751-79131773 TTGTATCATTTGTGAATTGATGG No data
933171613_933171616 2 Left 933171613 2:79131738-79131760 CCAATCGTGGTCCTTGTATCATT No data
Right 933171616 2:79131763-79131785 TGAATTGATGGCCCATCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933171613 Original CRISPR AATGATACAAGGACCACGAT TGG (reversed) Intergenic