ID: 933171615

View in Genome Browser
Species Human (GRCh38)
Location 2:79131751-79131773
Sequence TTGTATCATTTGTGAATTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933171607_933171615 19 Left 933171607 2:79131709-79131731 CCAACCAAGTGCCCCTAGGAACT No data
Right 933171615 2:79131751-79131773 TTGTATCATTTGTGAATTGATGG No data
933171606_933171615 20 Left 933171606 2:79131708-79131730 CCCAACCAAGTGCCCCTAGGAAC No data
Right 933171615 2:79131751-79131773 TTGTATCATTTGTGAATTGATGG No data
933171613_933171615 -10 Left 933171613 2:79131738-79131760 CCAATCGTGGTCCTTGTATCATT No data
Right 933171615 2:79131751-79131773 TTGTATCATTTGTGAATTGATGG No data
933171609_933171615 8 Left 933171609 2:79131720-79131742 CCCCTAGGAACTGCTCAGCCAAT No data
Right 933171615 2:79131751-79131773 TTGTATCATTTGTGAATTGATGG No data
933171610_933171615 7 Left 933171610 2:79131721-79131743 CCCTAGGAACTGCTCAGCCAATC No data
Right 933171615 2:79131751-79131773 TTGTATCATTTGTGAATTGATGG No data
933171608_933171615 15 Left 933171608 2:79131713-79131735 CCAAGTGCCCCTAGGAACTGCTC No data
Right 933171615 2:79131751-79131773 TTGTATCATTTGTGAATTGATGG No data
933171611_933171615 6 Left 933171611 2:79131722-79131744 CCTAGGAACTGCTCAGCCAATCG No data
Right 933171615 2:79131751-79131773 TTGTATCATTTGTGAATTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933171615 Original CRISPR TTGTATCATTTGTGAATTGA TGG Intergenic