ID: 933171616

View in Genome Browser
Species Human (GRCh38)
Location 2:79131763-79131785
Sequence TGAATTGATGGCCCATCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933171609_933171616 20 Left 933171609 2:79131720-79131742 CCCCTAGGAACTGCTCAGCCAAT No data
Right 933171616 2:79131763-79131785 TGAATTGATGGCCCATCCTCTGG No data
933171614_933171616 -9 Left 933171614 2:79131749-79131771 CCTTGTATCATTTGTGAATTGAT No data
Right 933171616 2:79131763-79131785 TGAATTGATGGCCCATCCTCTGG No data
933171610_933171616 19 Left 933171610 2:79131721-79131743 CCCTAGGAACTGCTCAGCCAATC No data
Right 933171616 2:79131763-79131785 TGAATTGATGGCCCATCCTCTGG No data
933171613_933171616 2 Left 933171613 2:79131738-79131760 CCAATCGTGGTCCTTGTATCATT No data
Right 933171616 2:79131763-79131785 TGAATTGATGGCCCATCCTCTGG No data
933171608_933171616 27 Left 933171608 2:79131713-79131735 CCAAGTGCCCCTAGGAACTGCTC No data
Right 933171616 2:79131763-79131785 TGAATTGATGGCCCATCCTCTGG No data
933171611_933171616 18 Left 933171611 2:79131722-79131744 CCTAGGAACTGCTCAGCCAATCG No data
Right 933171616 2:79131763-79131785 TGAATTGATGGCCCATCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933171616 Original CRISPR TGAATTGATGGCCCATCCTC TGG Intergenic