ID: 933171616 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:79131763-79131785 |
Sequence | TGAATTGATGGCCCATCCTC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 6 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
933171609_933171616 | 20 | Left | 933171609 | 2:79131720-79131742 | CCCCTAGGAACTGCTCAGCCAAT | No data | ||
Right | 933171616 | 2:79131763-79131785 | TGAATTGATGGCCCATCCTCTGG | No data | ||||
933171614_933171616 | -9 | Left | 933171614 | 2:79131749-79131771 | CCTTGTATCATTTGTGAATTGAT | No data | ||
Right | 933171616 | 2:79131763-79131785 | TGAATTGATGGCCCATCCTCTGG | No data | ||||
933171610_933171616 | 19 | Left | 933171610 | 2:79131721-79131743 | CCCTAGGAACTGCTCAGCCAATC | No data | ||
Right | 933171616 | 2:79131763-79131785 | TGAATTGATGGCCCATCCTCTGG | No data | ||||
933171613_933171616 | 2 | Left | 933171613 | 2:79131738-79131760 | CCAATCGTGGTCCTTGTATCATT | No data | ||
Right | 933171616 | 2:79131763-79131785 | TGAATTGATGGCCCATCCTCTGG | No data | ||||
933171608_933171616 | 27 | Left | 933171608 | 2:79131713-79131735 | CCAAGTGCCCCTAGGAACTGCTC | No data | ||
Right | 933171616 | 2:79131763-79131785 | TGAATTGATGGCCCATCCTCTGG | No data | ||||
933171611_933171616 | 18 | Left | 933171611 | 2:79131722-79131744 | CCTAGGAACTGCTCAGCCAATCG | No data | ||
Right | 933171616 | 2:79131763-79131785 | TGAATTGATGGCCCATCCTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
933171616 | Original CRISPR | TGAATTGATGGCCCATCCTC TGG | Intergenic | ||