ID: 933171617

View in Genome Browser
Species Human (GRCh38)
Location 2:79131768-79131790
Sequence TGATGGCCCATCCTCTGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933171609_933171617 25 Left 933171609 2:79131720-79131742 CCCCTAGGAACTGCTCAGCCAAT No data
Right 933171617 2:79131768-79131790 TGATGGCCCATCCTCTGGATTGG No data
933171614_933171617 -4 Left 933171614 2:79131749-79131771 CCTTGTATCATTTGTGAATTGAT No data
Right 933171617 2:79131768-79131790 TGATGGCCCATCCTCTGGATTGG No data
933171611_933171617 23 Left 933171611 2:79131722-79131744 CCTAGGAACTGCTCAGCCAATCG No data
Right 933171617 2:79131768-79131790 TGATGGCCCATCCTCTGGATTGG No data
933171613_933171617 7 Left 933171613 2:79131738-79131760 CCAATCGTGGTCCTTGTATCATT No data
Right 933171617 2:79131768-79131790 TGATGGCCCATCCTCTGGATTGG No data
933171610_933171617 24 Left 933171610 2:79131721-79131743 CCCTAGGAACTGCTCAGCCAATC No data
Right 933171617 2:79131768-79131790 TGATGGCCCATCCTCTGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933171617 Original CRISPR TGATGGCCCATCCTCTGGAT TGG Intergenic