ID: 933171726

View in Genome Browser
Species Human (GRCh38)
Location 2:79132695-79132717
Sequence GAGGCAACAGTCTCTAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933171723_933171726 -6 Left 933171723 2:79132678-79132700 CCTGTTGCTGGCAGGAGGAGGCA No data
Right 933171726 2:79132695-79132717 GAGGCAACAGTCTCTAGGCTGGG No data
933171716_933171726 5 Left 933171716 2:79132667-79132689 CCTGTTTGCCCCCTGTTGCTGGC No data
Right 933171726 2:79132695-79132717 GAGGCAACAGTCTCTAGGCTGGG No data
933171722_933171726 -5 Left 933171722 2:79132677-79132699 CCCTGTTGCTGGCAGGAGGAGGC No data
Right 933171726 2:79132695-79132717 GAGGCAACAGTCTCTAGGCTGGG No data
933171719_933171726 -3 Left 933171719 2:79132675-79132697 CCCCCTGTTGCTGGCAGGAGGAG No data
Right 933171726 2:79132695-79132717 GAGGCAACAGTCTCTAGGCTGGG No data
933171714_933171726 15 Left 933171714 2:79132657-79132679 CCACATGGGGCCTGTTTGCCCCC No data
Right 933171726 2:79132695-79132717 GAGGCAACAGTCTCTAGGCTGGG No data
933171720_933171726 -4 Left 933171720 2:79132676-79132698 CCCCTGTTGCTGGCAGGAGGAGG No data
Right 933171726 2:79132695-79132717 GAGGCAACAGTCTCTAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933171726 Original CRISPR GAGGCAACAGTCTCTAGGCT GGG Intergenic
No off target data available for this crispr