ID: 933172010

View in Genome Browser
Species Human (GRCh38)
Location 2:79135178-79135200
Sequence AGCACAGATGTGCCTTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933172009_933172010 29 Left 933172009 2:79135126-79135148 CCTGACAATTCTCAAATTATCAC No data
Right 933172010 2:79135178-79135200 AGCACAGATGTGCCTTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933172010 Original CRISPR AGCACAGATGTGCCTTCCTC AGG Intergenic
No off target data available for this crispr