ID: 933175988

View in Genome Browser
Species Human (GRCh38)
Location 2:79173640-79173662
Sequence TTGGATCTTGACTATGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933175988_933175998 16 Left 933175988 2:79173640-79173662 CCATGTCCATAGTCAAGATCCAA No data
Right 933175998 2:79173679-79173701 CCATTTCAGGTTCATGACTGGGG No data
933175988_933175990 -8 Left 933175988 2:79173640-79173662 CCATGTCCATAGTCAAGATCCAA No data
Right 933175990 2:79173655-79173677 AGATCCAATATACATACCCTAGG No data
933175988_933175996 15 Left 933175988 2:79173640-79173662 CCATGTCCATAGTCAAGATCCAA No data
Right 933175996 2:79173678-79173700 TCCATTTCAGGTTCATGACTGGG No data
933175988_933175995 14 Left 933175988 2:79173640-79173662 CCATGTCCATAGTCAAGATCCAA No data
Right 933175995 2:79173677-79173699 GTCCATTTCAGGTTCATGACTGG No data
933175988_933175992 3 Left 933175988 2:79173640-79173662 CCATGTCCATAGTCAAGATCCAA No data
Right 933175992 2:79173666-79173688 ACATACCCTAGGTCCATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933175988 Original CRISPR TTGGATCTTGACTATGGACA TGG (reversed) Intergenic
No off target data available for this crispr