ID: 933177829

View in Genome Browser
Species Human (GRCh38)
Location 2:79195782-79195804
Sequence AATCCTCCTCACACAAAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933177829 Original CRISPR AATCCTCCTCACACAAAGCA AGG Intronic
900754667 1:4425391-4425413 AAACCTCCACACACAGAGCGAGG - Intergenic
902627806 1:17687044-17687066 AATCCTCATCATTCACAGCAAGG - Intronic
907995916 1:59632565-59632587 AATCCCCCTCAAGCAAAGAAAGG + Intronic
912700329 1:111873473-111873495 AATCCTTCTCACCCCAAGTAGGG - Intronic
913016463 1:114741474-114741496 CATGCTCTTAACACAAAGCAAGG + Intronic
918954130 1:191182929-191182951 AATCCTGCTTCCACAAAGCCAGG + Intergenic
920938070 1:210454599-210454621 AATACTCCACACACATAGCCAGG - Intronic
1063141849 10:3262872-3262894 AATCCTCCTCACAGCTAGGAAGG + Intergenic
1065259829 10:23913169-23913191 AATTCTGCTCAGTCAAAGCAAGG - Intronic
1069937671 10:71929512-71929534 AATGATCCTCACATAAAACATGG - Intergenic
1070231838 10:74575902-74575924 AATCCTACTCACTCAAAACTAGG - Intronic
1070374806 10:75819185-75819207 AATCCTCCTCCCACAGACAAAGG - Intronic
1074293408 10:112158930-112158952 AGCACACCTCACACAAAGCATGG + Intronic
1076819157 10:132930244-132930266 CCTCCTCCCCACACAGAGCATGG + Intronic
1076819173 10:132930302-132930324 CCTCCTCCCCACACAGAGCATGG + Intronic
1076819531 10:132931543-132931565 AATACTTCTCACACAGAGCCTGG + Intronic
1076819678 10:132932084-132932106 CATCCTCCCCACACAGAGCCTGG + Intronic
1081332587 11:41822954-41822976 AACCCTCCTCAGAGAAAGCCAGG + Intergenic
1081446817 11:43138803-43138825 AATCCTCTCCCCACAAAGTAGGG + Intergenic
1085284854 11:75352774-75352796 AAGGCACCTCAGACAAAGCAGGG - Intergenic
1087136223 11:94723056-94723078 CAAACTCCTCACATAAAGCAGGG - Intronic
1088435786 11:109811860-109811882 AATCCCTCTCAAAAAAAGCAGGG + Intergenic
1088470472 11:110183922-110183944 AGCCCTCCCAACACAAAGCACGG - Intronic
1091267804 11:134284056-134284078 AAGACTCATCACACAAGGCAGGG + Intronic
1091629127 12:2145976-2145998 AATGCCCCTCACAAAAAGCCTGG - Intronic
1097351634 12:58555570-58555592 AATCTTCTGCACACAAATCACGG - Intronic
1101787198 12:107894416-107894438 AATGCTACTAACACAAAGAAAGG - Intergenic
1101840906 12:108326930-108326952 AATCCTCACCACACAACTCATGG + Intronic
1102592110 12:113964529-113964551 AATCCTCATCGCACAAAGCAAGG + Intronic
1102592205 12:113965445-113965467 AATCCTCATCCCACAAAGCGAGG + Intronic
1104871242 12:131998229-131998251 GATCCTCCTAACACAGAGCAAGG - Intronic
1105445906 13:20456928-20456950 ACTCCTACTGTCACAAAGCAGGG - Intronic
1108539252 13:51422410-51422432 AACTCTCCTCAGACCAAGCATGG + Intronic
1109797276 13:67332506-67332528 AATCATGCTCACACAAACAATGG + Intergenic
1111114948 13:83763583-83763605 AATATTCCTGACACAAAGAAAGG - Intergenic
1112108691 13:96270558-96270580 AATCCTCATAACACTAAGCTTGG - Intronic
1114673694 14:24428129-24428151 CATCCTCCACACTCAATGCAAGG + Intronic
1114719589 14:24866713-24866735 AATAATCCTCAAACAAACCATGG + Intronic
1115064232 14:29236915-29236937 AATCCCCCTCACTCAAAGCAAGG - Intergenic
1115636470 14:35294842-35294864 AATCCTCCAAAGACAAAGCATGG + Intronic
1116047863 14:39766208-39766230 AGTCCTCCCCTCATAAAGCAAGG + Intergenic
1116365022 14:44049284-44049306 AATCCAGCTCACATTAAGCAAGG + Intergenic
1117926934 14:60791000-60791022 TATCCTCCTGACAGACAGCAAGG - Intronic
1120693514 14:87619351-87619373 AATGCACGTAACACAAAGCAAGG - Intergenic
1121714043 14:96060059-96060081 AATCCCCTTCCCACAAAGCCAGG + Intronic
1125510562 15:40290403-40290425 TGTCCTCCTCAGACAAAACACGG - Intronic
1127630763 15:60825643-60825665 CTTCCCCTTCACACAAAGCATGG + Intronic
1128512358 15:68321305-68321327 CATCCTCCTCACAGGCAGCATGG - Intronic
1130108684 15:80947892-80947914 AATCTTCCTAACTCAAAGCTGGG + Intronic
1131842496 15:96452268-96452290 GATGCTTCTCACACAAATCATGG + Intergenic
1131847365 15:96502083-96502105 ATTCCTCCCCAAACAGAGCACGG - Intergenic
1132379897 15:101359042-101359064 CGTCCTCCCCACACACAGCAGGG + Intronic
1133440635 16:5818181-5818203 AAACCTCCTAACACACAGCCTGG - Intergenic
1141591354 16:85071198-85071220 CATCCCTCTCACACACAGCAGGG + Intronic
1142009132 16:87704892-87704914 ATTCATCCTCACACAGAGCATGG + Intronic
1142565337 17:836430-836452 AATGCTGCTCACAGAAAGGATGG - Intronic
1143267133 17:5647287-5647309 AATCTTCCTCCCAATAAGCATGG - Intergenic
1148669147 17:49397382-49397404 TACCCTCCTCACCCAAAGGAAGG + Intronic
1150401510 17:64860481-64860503 AAACAGCCTCACACACAGCAGGG - Exonic
1151643088 17:75410794-75410816 AATCCTCCTGCCACATAGCTGGG + Intergenic
1153993099 18:10417372-10417394 ATTCTTCCTCCCACACAGCAAGG + Intergenic
1161553524 19:4927876-4927898 AATCCTGCTCGCACCAGGCACGG + Intronic
1166614832 19:44234026-44234048 AAACTTCCTCCCAGAAAGCAGGG - Intronic
1167153440 19:47723226-47723248 CAGCCTCCACACACACAGCAGGG + Intronic
1167969107 19:53175344-53175366 AATCCTCATCAAGCAATGCAGGG + Intronic
925412294 2:3646918-3646940 AACCCTCCCCACACACAGCCTGG - Intergenic
927875454 2:26652534-26652556 CATCTTCCACACACCAAGCAGGG + Intergenic
930400726 2:50881672-50881694 AAACCTCCTCACTCAAATCAGGG - Intronic
931051290 2:58417804-58417826 CAACCTCATCACACAAGGCAAGG + Intergenic
931896904 2:66742545-66742567 AAGCCTCGTCACTCAAAGTAAGG - Intergenic
931998831 2:67864962-67864984 AATGCTGGTCACACAAAGAATGG - Intergenic
933177829 2:79195782-79195804 AATCCTCCTCACACAAAGCAAGG + Intronic
933635762 2:84707725-84707747 ACCCCTCCTTACAGAAAGCAGGG - Intronic
934739517 2:96709658-96709680 AATGCTCCTCATGCAATGCAGGG + Intronic
936302137 2:111312086-111312108 AATCCTAGTCAGAGAAAGCAGGG + Intergenic
936558426 2:113515767-113515789 AATCCTCTCCCCACAAAGTAGGG - Intergenic
936719415 2:115232642-115232664 CATTATCCTCACACAAGGCAAGG + Intronic
936911924 2:117602334-117602356 AATTCTCCTCACAGACAGCAAGG + Intergenic
937272441 2:120661626-120661648 ATTCCTCCTCTCACAACTCAAGG - Intergenic
938317681 2:130341350-130341372 AATCATCCTGAGACAAAGAATGG - Intronic
945206489 2:207338111-207338133 GCTCCTCCTAACACACAGCAGGG + Intergenic
945480615 2:210340677-210340699 AACCCTCCTCACTCAAAAAATGG - Intergenic
948836800 2:240629798-240629820 AAAACTCCTCAAAGAAAGCATGG - Intronic
1168734545 20:119285-119307 ATTTCTCCTCAGACAATGCATGG + Intergenic
1169023485 20:2348139-2348161 TATCTTCCTCACACACACCAGGG - Intergenic
1170185581 20:13586360-13586382 AATACTACTGACACAAAACATGG + Intronic
1170272656 20:14545470-14545492 AAATCTCCTCAAACAATGCAAGG - Intronic
1174277290 20:49413276-49413298 AATCTTCCTCCCACCCAGCAAGG - Intronic
1175189405 20:57201032-57201054 AAGCCTCATTACTCAAAGCACGG + Intronic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1180861591 22:19085873-19085895 AACTCTCCTCATACAAAGGAAGG + Intronic
1185133824 22:49057099-49057121 CATCATCCTCACACACAGCAGGG - Intergenic
950599241 3:14017320-14017342 AGTCCTGTTCACACATAGCATGG - Intronic
951620320 3:24594394-24594416 AATCCTTGTTACTCAAAGCATGG - Intergenic
952684122 3:36130235-36130257 GATCTTCCTCAAACAAAGAAAGG - Intergenic
953446842 3:42975692-42975714 AATCTACCACTCACAAAGCATGG - Intronic
954540905 3:51392356-51392378 GGTCCTCCTCACACACAGCTGGG - Exonic
954992494 3:54853621-54853643 GAAGCTCATCACACAAAGCAAGG + Intronic
958900545 3:99881061-99881083 GTTCCTCATCAAACAAAGCAAGG + Intronic
961203594 3:125063282-125063304 CATCCTCCCCACAGCAAGCAGGG + Intergenic
965404036 3:168249063-168249085 AATCCTCCTCACTCAAAACGGGG - Intergenic
968121808 3:196131129-196131151 AATGTGCCCCACACAAAGCAGGG - Intergenic
971598645 4:28565342-28565364 AATAATCCAGACACAAAGCATGG + Intergenic
971678063 4:29660129-29660151 AATCTTCCTCAAATGAAGCATGG + Intergenic
976777473 4:88721896-88721918 ATTCCTTCTCTCACAGAGCAGGG - Intergenic
990042291 5:51389471-51389493 CAGCCTCAGCACACAAAGCAGGG - Intronic
993163748 5:84323597-84323619 AATCCTCTACTCAAAAAGCAGGG + Intronic
997843457 5:137263691-137263713 AAATCTCCTCACAGAAAGGATGG - Intronic
998409724 5:141900464-141900486 AAGGTTCCTCACACAAAGCTTGG + Intergenic
1001175459 5:169464410-169464432 AAACTTACTCACTCAAAGCATGG - Intergenic
1005053081 6:21703124-21703146 ATTGCTCCTAAGACAAAGCAGGG - Intergenic
1006143144 6:31943114-31943136 CATCCTCCCCACACCAAGGAGGG - Intronic
1007109711 6:39305952-39305974 AATCTTTCTCACACAGTGCAAGG - Intronic
1008866363 6:56215609-56215631 TATCCTCCTCTCTAAAAGCAAGG + Intronic
1009574962 6:65441855-65441877 AATCCTGCTCAGACATATCAAGG + Intronic
1011929465 6:92692085-92692107 ATTCCTTCTCACACTAAGCTGGG + Intergenic
1013632167 6:111996225-111996247 AAGCCTCCTCACAGAAGCCACGG + Intergenic
1013688686 6:112615049-112615071 AATTTTCCCAACACAAAGCAAGG + Intergenic
1013764413 6:113558200-113558222 AGTCCTCCTCACCCAAGGGAAGG + Intergenic
1013817060 6:114111475-114111497 TATCTTCCTCACACAGAGCATGG + Intronic
1014048809 6:116927293-116927315 TATCCTCATCACACCGAGCATGG + Exonic
1016463462 6:144302691-144302713 AAACATCCCCACACAAACCAGGG + Intronic
1022246945 7:28569726-28569748 AATCCATCTCTCACAATGCATGG - Intronic
1022469720 7:30674803-30674825 AATCCTGCTCACACCAAGAATGG - Intronic
1025158018 7:56627673-56627695 AATCCCCCACACATAATGCATGG + Intergenic
1028033152 7:85944245-85944267 AATCTTTCTGACACAAAGAAAGG - Intergenic
1029439285 7:100578310-100578332 CATCCTCCTGCCAGAAAGCAGGG + Intronic
1031085235 7:117296079-117296101 CAGCCTCCTCACACTGAGCATGG - Intronic
1033674975 7:143531938-143531960 ATTACTCCTAACACAAAGGATGG + Intergenic
1033696861 7:143797502-143797524 ATTACTCCTAACACAAAGGATGG - Intergenic
1040438347 8:47415616-47415638 TATCCTCCTCACACAGTGGAAGG - Intronic
1042102107 8:65284776-65284798 TATCTTCCTTACACAAAGAAGGG - Intergenic
1042694675 8:71543744-71543766 AATCCTCATCTCTTAAAGCAAGG - Intronic
1045019461 8:98029097-98029119 ATTCCTCCTCACAGAAAGGCTGG + Intronic
1045749173 8:105460701-105460723 TATACTGCTCAGACAAAGCAAGG - Intronic
1048398275 8:134036168-134036190 CATCCTCCTCTTACAAACCAAGG - Intergenic
1049894439 9:100500-100522 AATCCTCTCCCCACAAAGTAGGG + Intergenic
1050404358 9:5292501-5292523 AATCCACCTCAGATGAAGCAAGG - Intergenic
1052695589 9:31873152-31873174 AATCCTCTTCATTCTAAGCAAGG + Intergenic
1052727369 9:32245254-32245276 AATAATCCTCACAAAAACCAAGG - Intergenic
1053735649 9:41100492-41100514 AATCCTCTCCCCACAAAGTAGGG + Intergenic
1055360485 9:75484854-75484876 AATCCTTCTCAGAAAAAGGAGGG - Intergenic
1056060851 9:82884131-82884153 CATGTTGCTCACACAAAGCATGG + Intergenic
1058252874 9:102723569-102723591 AATGTTCCTAACACAAAGAAAGG + Intergenic
1062104628 9:134746926-134746948 AATTTTCATGACACAAAGCACGG - Intronic
1062596837 9:137303387-137303409 AAGCCTCCTCAGACAAGGCCTGG - Intergenic
1203426957 Un_GL000195v1:49949-49971 AAGCCTACTCACACCAATCATGG + Intergenic
1186329443 X:8516588-8516610 AATATTCCTAACACAAAGAAAGG + Intergenic
1187643984 X:21326719-21326741 AATCATCTTCACAAAAAGGAAGG + Intergenic
1189634405 X:42990202-42990224 ATTCCTCCTCACACTAGACAAGG - Intergenic
1190232060 X:48589975-48589997 AATCCTCGGAACACAGAGCACGG + Intergenic
1192353220 X:70374288-70374310 AAAGCTCCTCACACATAGTAGGG - Intronic
1195483437 X:105374503-105374525 AATACTACTCAAACAAATCAGGG - Intronic
1196687688 X:118526287-118526309 AGTCCTCCTCATACCGAGCATGG + Intronic
1199595271 X:149502019-149502041 AATCCTCCCAACAGCAAGCAAGG - Intronic
1200898795 Y:8406306-8406328 AATCCTCCCCACATAATCCAGGG + Intergenic