ID: 933178002

View in Genome Browser
Species Human (GRCh38)
Location 2:79197546-79197568
Sequence TTGAATATACAAATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 716
Summary {0: 1, 1: 20, 2: 58, 3: 127, 4: 510}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933178002 Original CRISPR TTGAATATACAAATGGACAA TGG (reversed) Intronic
902497409 1:16883177-16883199 TTCATTATACAGCTGGACAATGG + Intronic
902791881 1:18774782-18774804 TTCAAAATTCAAAAGGACAAAGG - Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903054723 1:20627747-20627769 TTGAATGTAAAAATGGAAAAAGG - Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905117604 1:35655854-35655876 ATGAATATACAAAGGGATATGGG + Intergenic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
906088205 1:43154593-43154615 TTGAATATAAATATGAATAATGG + Intronic
906549176 1:46647953-46647975 GAGGATAGACAAATGGACAAAGG - Intronic
906934900 1:50205822-50205844 TTTTATTTACAAATGAACAAAGG - Intergenic
907621356 1:55983820-55983842 TGGGATATACAAGAGGACAAGGG + Intergenic
908507342 1:64817936-64817958 TTCATTATACAAATGGAGAAGGG + Intronic
908694381 1:66821673-66821695 TTAAATAAAAAAATGGGCAATGG - Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909150948 1:72004137-72004159 ATAAATATATAATTGGACAAAGG - Intronic
909491249 1:76229054-76229076 CTGATTATATGAATGGACAATGG + Intronic
909840711 1:80319470-80319492 TTGAATATATAAATGCTCTAAGG - Intergenic
910127214 1:83856108-83856130 TTAAATATAAAATTGGACCAAGG + Intergenic
910372861 1:86536664-86536686 ATTAATATACTAATGGACAAAGG - Intergenic
910486075 1:87715763-87715785 TCCAGTATACAAATGGAAAATGG + Intergenic
910964233 1:92791998-92792020 TTGAATATACACATTCACAGAGG - Intronic
910983092 1:92977997-92978019 TTAAAGATACACATAGACAAAGG - Intergenic
911153903 1:94621133-94621155 TTAAATATATAAATGAATAAAGG - Intergenic
911509662 1:98795756-98795778 ATGGAAATAAAAATGGACAAAGG - Intergenic
911869875 1:103083481-103083503 TTGAAGATTCAAATGTACAATGG + Intronic
912247299 1:107973185-107973207 TTGCACACACAAATGGAAAAAGG + Intergenic
912591599 1:110826297-110826319 CTCAATTTACAAATGGGCAAGGG + Intergenic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
913390482 1:118305492-118305514 TAAAATTTACAAATGTACAAAGG - Intergenic
913657757 1:120977489-120977511 TTCATTATACAGCTGGACAATGG - Intergenic
913754360 1:122056105-122056127 TTGAACATTCCAATGGAAAAGGG + Intergenic
914647736 1:149669225-149669247 TTCATTATACAGCTGGACAATGG - Intergenic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
915640659 1:157222328-157222350 TTCAATTTTAAAATGGACAAAGG - Intergenic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917942917 1:179941144-179941166 ATGTATATACAAATAGACTATGG + Intergenic
918306183 1:183249190-183249212 TTGAATGTACATAGGAACAAGGG - Exonic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918742664 1:188154759-188154781 TTGAATTTAAAACTGGAGAAGGG - Intergenic
918748588 1:188240675-188240697 TCAAATATGAAAATGGACAAAGG + Intergenic
918868595 1:189936213-189936235 TTGAATATACATACTGATAATGG - Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919333110 1:196196580-196196602 GAGAATATACAAATGCACATAGG - Intergenic
919523391 1:198617373-198617395 TAGGATATCCAAATGGCCAATGG + Intergenic
919809921 1:201402539-201402561 TTGAATATAGAAAATGAGAAGGG + Intergenic
920069876 1:203295174-203295196 TTGAAACTACAAAGGCACAATGG + Intergenic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
920595605 1:207266676-207266698 TTCAATTTAAAAATGGGCAAAGG + Intergenic
921469010 1:215526214-215526236 ATGAATAAACTATTGGACAATGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923185850 1:231572547-231572569 TTGAATACATAAATTCACAAAGG - Intronic
923907715 1:238403872-238403894 TTGAATATATAAATTGGAAAGGG - Intergenic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
1062822430 10:544755-544777 TCCAATTTAAAAATGGACAAAGG - Intronic
1063033525 10:2261079-2261101 TTGAATATATAAACAAACAATGG - Intergenic
1063729829 10:8683954-8683976 TTGAAAATGCAAATGTACCAAGG + Intergenic
1064336491 10:14448102-14448124 GTGAATAAGCAAATGAACAAGGG + Intronic
1065978225 10:30863101-30863123 TTGTAAGTACAAATGCACAAGGG + Intronic
1066538586 10:36419348-36419370 TTGAATATACACATAGCCTATGG + Intergenic
1066645582 10:37604957-37604979 TTGAATATACACATAGCCTATGG + Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1066785529 10:39000033-39000055 GAGAATATACAAAGGGACATTGG - Intergenic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069234747 10:66056815-66056837 TTAAATGTATAAATGAACAATGG + Intronic
1070082067 10:73198824-73198846 TTCAATTGAAAAATGGACAAAGG + Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071007151 10:80895910-80895932 TTGAATATACAAATTTAAAAGGG - Intergenic
1071253809 10:83848477-83848499 TTGATTTTAAAAATGGGCAAAGG + Intergenic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1071615187 10:87069054-87069076 ATGAACATACATATGGAAAAAGG + Intronic
1072370292 10:94759268-94759290 TTGATTAAAAAAATGGGCAACGG + Intronic
1073978824 10:109131125-109131147 TTCAATTTAAAAATGGACATTGG - Intergenic
1074442624 10:113492133-113492155 TTGTCTCTACAAATGGAAAAAGG + Intergenic
1074674245 10:115830150-115830172 GTGGATATACAAGTGAACAAAGG + Intronic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1075202914 10:120421153-120421175 TTGAATACACTAATGAAGAAAGG - Intergenic
1075905373 10:126076681-126076703 TTCAATTTAAAAATGGGCAAAGG - Intronic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1076945675 10:133648024-133648046 TTTACTATAAAAATGAACAAAGG + Intergenic
1077345097 11:2044048-2044070 TGGGATATAGAAATGGATAAAGG - Intergenic
1077345238 11:2045380-2045402 TGGATTATAAAAATGGAGAATGG - Intergenic
1078589802 11:12630394-12630416 CTTAATAGAAAAATGGACAAAGG - Intergenic
1078947435 11:16085447-16085469 TTTAATGCTCAAATGGACAAAGG - Intronic
1078976107 11:16479226-16479248 TTCAATATAACAATGCACAAGGG + Intronic
1079291295 11:19190417-19190439 TTCAATATACAAATGATCAGTGG - Intronic
1079663840 11:23078261-23078283 TTGAAAGTAAAAATGGAGAAAGG + Intergenic
1080308428 11:30862077-30862099 TGGAATAAACAAATGGGCCATGG + Intronic
1080325865 11:31072266-31072288 TTCAATACAAAAATGGGCAAAGG - Intronic
1080509652 11:32956171-32956193 TTGATGATACCAATGTACAAAGG + Intronic
1080955412 11:37088374-37088396 TTTAATATACAAAGGAACAATGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081176963 11:39939768-39939790 TTGAATTTAAAAATGAGCAAAGG - Intergenic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1082126996 11:48444958-48444980 TTTAATATAGAAATGTAAAATGG - Intergenic
1082560578 11:54615939-54615961 TTTAATATAGAAATGTAAAATGG - Intergenic
1082749871 11:57004104-57004126 TGGAAGAAATAAATGGACAAAGG + Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1083090587 11:60195322-60195344 AGGAATATACTAATGGAGAAAGG - Intergenic
1083210203 11:61179481-61179503 AGGAGGATACAAATGGACAACGG - Intergenic
1083837370 11:65280156-65280178 TTGAATGTAAACATTGACAAAGG - Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087287364 11:96279440-96279462 TTCAGTATACAGATGAACAAAGG + Intronic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1087934405 11:104015800-104015822 ATGAAAATAGAAATGGAAAATGG - Intronic
1090361280 11:126174695-126174717 TTGAATATATAAATGAAAGATGG - Intergenic
1090567605 11:128012382-128012404 TTGAATGTACATATACACAATGG + Intergenic
1090992596 11:131832822-131832844 TTAAATATATATATAGACAAGGG + Intronic
1202828026 11_KI270721v1_random:98920-98942 TGGGATATAGAAATGGATAAAGG - Intergenic
1091752054 12:3028931-3028953 TTTATTATAAAAATGGGCAATGG - Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093855517 12:24097203-24097225 TCCAATTTAAAAATGGACAAAGG - Intergenic
1093956595 12:25227498-25227520 TTCAATTTAAAAATGGGCAAAGG + Intronic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095150858 12:38795362-38795384 TTGAATATACACATGGAAGTGGG - Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1095854263 12:46843245-46843267 TTGCATATAGAAAGAGACAATGG - Intergenic
1097471400 12:59997578-59997600 TTGAAGCTACATAGGGACAAAGG + Intergenic
1097478783 12:60094164-60094186 TAGATTATACAGATTGACAAAGG + Intergenic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098267905 12:68741353-68741375 TTGCTTATACACATGGAAAATGG - Intronic
1098484380 12:71003893-71003915 TTGAATGTACAAAGGCAAAATGG + Intergenic
1099045805 12:77717898-77717920 TTCAATTTAAAAATGGGCAAAGG - Intergenic
1099322487 12:81167776-81167798 TTGAAGATACATATGTACTAAGG - Intronic
1099889709 12:88576153-88576175 TAGAAAATAGAAATGGAAAATGG - Intronic
1100107844 12:91198857-91198879 GAAAATATACAAATGGCCAATGG - Intergenic
1100423906 12:94464149-94464171 TCCAATTTAAAAATGGACAAAGG + Intergenic
1100755013 12:97741654-97741676 TTAAATATATAAATTAACAAAGG - Intergenic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1105106996 13:16551072-16551094 TTGAATCTGCAAGTGGACATTGG + Intergenic
1106048070 13:26164096-26164118 TTGAATATACAGGTTGACAGTGG + Intronic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106282144 13:28284299-28284321 TTGAAAATAAAAATGGGCAAAGG - Intronic
1106309025 13:28536649-28536671 TAGTGTATACAAGTGGACAAAGG + Intergenic
1106359943 13:29021800-29021822 TTGAATAAACAAAGACACAAGGG + Intronic
1106863054 13:33932163-33932185 TAGAATAGACAGATGAACAATGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107068355 13:36242363-36242385 TGGGATATCCAAATGGCCAAAGG - Intronic
1107387208 13:39924978-39925000 AAGAATATACAAATATACAAGGG - Intergenic
1107678868 13:42826746-42826768 TTGAATATAGAAATTAACATGGG - Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108020123 13:46119860-46119882 TTGTATGTACAAATAGAGAATGG + Intergenic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108463904 13:50695273-50695295 GAAAATACACAAATGGACAATGG + Intronic
1108556046 13:51593711-51593733 TTCAATGGAGAAATGGACAAAGG - Intronic
1109498783 13:63211343-63211365 TTGAAAATACATATGGAAAATGG + Intergenic
1109549372 13:63873181-63873203 TTGATAATACAAAAGGAAAATGG - Intergenic
1109644335 13:65233841-65233863 TTCAATTTAAAAGTGGACAATGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109825165 13:67709646-67709668 CTGAATATGAAAATGGACAGTGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110564160 13:76941118-76941140 ATAAAAATACAAATGGAGAAGGG + Intergenic
1111157430 13:84346799-84346821 TTGAATGGATAAATGTACAATGG - Intergenic
1111325207 13:86685299-86685321 TTGAATAAACAAATAAATAAAGG + Intergenic
1111565585 13:90010624-90010646 TTGAATAAACAAACGGAATAGGG + Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112472701 13:99703251-99703273 TTAAATTTAAAAAGGGACAATGG - Intronic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1112936414 13:104805275-104805297 ATGAATATAGAAATGGAAATTGG - Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114307288 14:21435511-21435533 TTTATTATAGAAATGGGCAAGGG - Intronic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115173668 14:30537308-30537330 TTCAATTTAAAAATAGACAAGGG - Intergenic
1115403822 14:32993607-32993629 TTGAATATAAAAATACAAAATGG - Intronic
1115752669 14:36506989-36507011 TGGAATAAAGAAATGGAAAATGG + Intronic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116477224 14:45354535-45354557 TTGTATAAATGAATGGACAAAGG + Intergenic
1116648259 14:47557847-47557869 TTGAATGTACAAATTAATAAAGG - Intronic
1117838671 14:59834140-59834162 ATGAATATCCAAATGCAAAAAGG + Intronic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1119089527 14:71768052-71768074 TCCAATAGAAAAATGGACAAAGG + Intergenic
1119497236 14:75090344-75090366 GAGAAAATACAAATGGGCAAAGG + Intronic
1119946027 14:78695370-78695392 TTGAATCTACAAAAAGAGAAAGG - Intronic
1120499171 14:85272696-85272718 TTGAATAAATAAATGAACAATGG + Intergenic
1121751338 14:96359900-96359922 TTTAATATACAAATGGGCACTGG + Intronic
1122012619 14:98763674-98763696 ATGGATATAAAAATTGACAAAGG + Intergenic
1123812243 15:23939251-23939273 TGGAAAAGACAAATGTACAAAGG - Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124640749 15:31394704-31394726 GTGAATATACTAAAGGCCAATGG - Intronic
1125006787 15:34825471-34825493 TTGAATATACAAATAAAAAATGG + Intergenic
1125073365 15:35582959-35582981 TTAGATAGACAAATGAACAAAGG + Intergenic
1125174054 15:36799629-36799651 TTGAATAAACAAAATGCCAAAGG - Intronic
1126510557 15:49467423-49467445 TTCAAAATACAAATGTACCAGGG - Intronic
1127187891 15:56498942-56498964 TTAAATATGCAAATGTATAAAGG - Intergenic
1127407258 15:58663622-58663644 TTGAATCTACAAATCAATAAAGG + Intronic
1127751898 15:62054049-62054071 TTGAAAAATCAAATTGACAAAGG + Intronic
1128365122 15:66994246-66994268 TTGAAAACATAAATGGGCAAAGG + Intergenic
1128918476 15:71589220-71589242 TTGAATATATTAAAGGACATAGG + Intronic
1129243854 15:74268139-74268161 TGAAATATTCAAATGGAAAAGGG + Intronic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1130402872 15:83573752-83573774 ATGAATAAATAAATGAACAAAGG - Intronic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1131230758 15:90657416-90657438 TCCAATATATAAATGGTCAATGG + Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1134607716 16:15584139-15584161 TTTAATATCCTAATGGACACTGG - Intronic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1135995279 16:27243419-27243441 TTGAACATACAAACAGCCAATGG + Intronic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1137354351 16:47745321-47745343 TTGAATAAACTAATGGCCATAGG + Intergenic
1137505358 16:49049577-49049599 TTAAACATACAAACTGACAAAGG - Intergenic
1138326495 16:56175676-56175698 CTCAATTTAAAAATGGACAAAGG - Intergenic
1138399126 16:56731065-56731087 TTGCAAACACAAATGCACAAAGG - Intronic
1139083000 16:63548387-63548409 TTGAATATCCAAATGGAATCTGG + Intergenic
1139831707 16:69804029-69804051 TTCAATATAAAAATGAGCAAAGG - Intronic
1140215797 16:73007021-73007043 TGGAATCTACAAATGCAGAACGG + Intronic
1140403455 16:74691064-74691086 TTAAATATATATGTGGACAAAGG + Intronic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1140637934 16:76938596-76938618 AGGAACACACAAATGGACAATGG + Intergenic
1141106053 16:81234692-81234714 TTGAAAATACAAATGGAGTCCGG - Intergenic
1141209712 16:81965832-81965854 TTGAAAATAAAAATGAAAAAAGG - Intergenic
1141260534 16:82449520-82449542 TTGAATAAACAAATGAATGAAGG + Intergenic
1142678483 17:1530966-1530988 TTGAAAGTCCAAATGGAGAACGG + Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1144221375 17:13102826-13102848 CTGAATGTACCCATGGACAATGG - Intergenic
1145446063 17:23175636-23175658 TAGAATCTACAAGTGGACATTGG + Intergenic
1146670430 17:34733738-34733760 TTGAAAGAACAAATGAACAAAGG - Intergenic
1147032544 17:37651510-37651532 TGGAAGAGACAAAGGGACAAGGG + Intergenic
1148378518 17:47173529-47173551 TTGATTATACCAATAAACAATGG + Intronic
1149037483 17:52151430-52151452 TTGTAGATACAAGTGGAGAAGGG - Intronic
1150070629 17:62147181-62147203 TTGTATTTACAAATTTACAATGG + Intergenic
1150214284 17:63457986-63458008 TAGAATAAATAAATGGACTAGGG + Intergenic
1150232373 17:63563175-63563197 TGCAATAGAAAAATGGACAAAGG + Intronic
1153686408 18:7550511-7550533 CTGAATCTACAAATGAACAGTGG - Intergenic
1154988257 18:21575798-21575820 TTTAATGTTCAAAAGGACAAAGG + Intronic
1155068345 18:22288509-22288531 ATGGAAATACAAATGGCCAAGGG - Intergenic
1155582119 18:27321230-27321252 ATGAATACAGTAATGGACAATGG - Intergenic
1155582123 18:27321279-27321301 TTAAATACAGAAATGGACAATGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1156068006 18:33168520-33168542 TTGTATAAACAAATTAACAAAGG - Intronic
1156946517 18:42839749-42839771 ATGAACATACGAATGGACAGTGG + Intronic
1157015255 18:43704406-43704428 TTGAATATACGAACAGACAATGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157530633 18:48417802-48417824 TAGAACAGACAAATGCACAAAGG + Intergenic
1158151524 18:54378209-54378231 TTGATGATACGAATGGAGAACGG + Exonic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158618947 18:59013556-59013578 TTGAATAAACATATGTACTATGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159817158 18:73089222-73089244 TTGAATATAGATATAGACATAGG - Intergenic
1160439857 18:78881348-78881370 TTGAATATAGAGAAGTACAAAGG - Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161639418 19:5411607-5411629 GACAATATACAAATGGCCAATGG + Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1167954953 19:53057168-53057190 TTGAAGAGACAATTGGACACAGG + Intergenic
1167970202 19:53184509-53184531 TTGAGGAGACAACTGGACAAAGG + Intronic
1168561021 19:57383383-57383405 TTGACTATAGAAATCAACAATGG - Intronic
1168566975 19:57433442-57433464 TTTGCTATACAAATGGACAACGG - Intronic
925175959 2:1784071-1784093 ATGAAAATACAAGCGGACAATGG + Intergenic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
926372615 2:12195316-12195338 TTTAAAATACAAATTGAAAATGG + Intergenic
927071978 2:19540220-19540242 TTGAATTAACAAATGTAAAATGG - Intergenic
927140664 2:20128830-20128852 TTGAATATAAAATTGGACAGGGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927723369 2:25402061-25402083 TTGAAGAGAAAAATGGACAAAGG - Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929678634 2:43965685-43965707 TTCAATTAACAAATGGGCAAAGG + Intronic
930008684 2:46917445-46917467 TTGAATGAATAAATGAACAAAGG - Intronic
930083836 2:47478095-47478117 TTCAATAGAAAAATGGGCAAGGG - Intronic
930617941 2:53613575-53613597 TAAAACATACAAATGGCCAATGG - Intronic
931596036 2:63944717-63944739 TTTAATGTACAAATGGAACATGG - Intronic
931957377 2:67442549-67442571 TTTGATAGAAAAATGGACAAGGG + Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
933522865 2:83394800-83394822 TTGAACATACAAAAGGGCAATGG + Intergenic
933551807 2:83787308-83787330 TTCAATATACAGCTGGACAATGG + Intergenic
933819995 2:86102446-86102468 TTCAATTTTAAAATGGACAAAGG - Intronic
933909422 2:86926362-86926384 TGAAATATACAAATGGTAAAAGG + Intronic
933995513 2:87665763-87665785 ATGAATAGACATATTGACAATGG - Intergenic
934023304 2:87977017-87977039 TGAAATATACAAATGGTAAAAGG - Intergenic
934631309 2:95926674-95926696 TTGAATATACAACTGAACTCAGG + Intronic
934891276 2:98071932-98071954 TTAAATGTGCAAATGGACACAGG - Intergenic
935151887 2:100444947-100444969 TTCAATAAACAAGTGGACACCGG - Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935330148 2:101971219-101971241 GTGGATATACAAAAAGACAATGG - Intergenic
935590188 2:104841072-104841094 GTAAATATACATATGCACAAGGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936298342 2:111285152-111285174 ATGAATAGACATATTGACAATGG + Intergenic
937139228 2:119584633-119584655 ATGAATAGAGAAATGGGCAAAGG + Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938771411 2:134504394-134504416 ATGAATATACACATGGATGATGG + Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939133981 2:138272857-138272879 TTGTATAAACAAATGGAAAAAGG - Intergenic
939142051 2:138366060-138366082 TTAAATACACAAATGAAAAAAGG + Intergenic
939212040 2:139188086-139188108 TCCAATTTAAAAATGGACAAAGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
939369777 2:141284104-141284126 TTGAAAATAAAAATGCACAGTGG + Intronic
939514060 2:143144218-143144240 ATGAATATACACATGCATAAAGG + Intronic
940127959 2:150348254-150348276 CTGTATATACAAATGACCAAAGG + Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
940304463 2:152211038-152211060 TCCAATTTAAAAATGGACAAAGG - Intergenic
940977613 2:159963557-159963579 TCCAATTTAAAAATGGACAAAGG + Intronic
941144055 2:161821059-161821081 GAGAATATCCAAATGGCCAAAGG - Intronic
941172281 2:162154000-162154022 TCAAATAGACAAATAGACAATGG - Intergenic
941425220 2:165335938-165335960 TTGAATAGACATATTGAAAAAGG + Intronic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
941949813 2:171143111-171143133 ATGAATGCACGAATGGACAAAGG + Intronic
942575339 2:177357185-177357207 TTGAAAATACTCTTGGACAAAGG + Intronic
942862624 2:180634736-180634758 GTCAATAGAAAAATGGACAAAGG + Intergenic
943231476 2:185258345-185258367 TTAAATATAAGAAGGGACAATGG - Intergenic
943528375 2:189047468-189047490 TTTAATATACAAATGCCCAATGG + Intronic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
943768301 2:191687309-191687331 ATGAATATGCATATGAACAAAGG - Intronic
943978779 2:194519191-194519213 TTGAATAGATAAATGCACAGAGG - Intergenic
944188014 2:196971035-196971057 TTGAATATGCCTATGGACAAGGG - Intronic
944266839 2:197736737-197736759 TTGAATTTACAAATCAAAAAAGG - Intronic
944330504 2:198460617-198460639 TAGAATATAAATATAGACAAAGG - Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
946754515 2:222930732-222930754 TTGAAGATGAAAATGGACAAAGG + Exonic
1168784852 20:529409-529431 TGGCATATACAGCTGGACAAAGG - Intronic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169702112 20:8458304-8458326 TGAAATATACAAACGGACAATGG - Intronic
1170190094 20:13637066-13637088 TTCAATTTAAAAATGGGCAAAGG + Intronic
1170406498 20:16043432-16043454 ATCAGTATACAAATAGACAATGG - Intronic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171576669 20:26333186-26333208 TTGAATTTACAAGTGGATATTGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172058740 20:32174359-32174381 TTAACTATACAAATGGAAATAGG - Intergenic
1172725468 20:37037324-37037346 ATGAATATACAAATGTAAAGCGG + Intronic
1173171052 20:40724193-40724215 TTGAACAAACAGATGGACATGGG - Intergenic
1173791382 20:45829905-45829927 TTGAATAAACAAAAGAACAAAGG - Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1173965672 20:47110717-47110739 TTGAATAAACAAATAAACAAAGG + Intronic
1174940912 20:54926118-54926140 TAGAATATACAGATAGGCAATGG - Intergenic
1175291789 20:57880894-57880916 ATGAATAAACAAATGGCCAGGGG - Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175638015 20:60601763-60601785 GAGAATATACAAGTGGACTACGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176985243 21:15428362-15428384 TTCAATTTTCAAATGGACAAAGG - Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177446791 21:21208234-21208256 TGGAATGTAACAATGGACAATGG + Intronic
1177593075 21:23198515-23198537 TTGAATAAATAAATGAACATTGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179033763 21:37742383-37742405 TTGAATACAGAAATGGACAGTGG - Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1181983165 22:26780896-26780918 TTGAATATAATAATGAAAAAAGG - Intergenic
1182008596 22:26981836-26981858 TTGATTATGCCAATGGACACTGG + Intergenic
1182017808 22:27055541-27055563 TTAAATAAACAAATGGATGAAGG - Intergenic
1182643468 22:31788102-31788124 TTAAAAAAACAAATGGGCAAAGG + Intronic
1183582420 22:38733847-38733869 TTGAATGTACAGATGGGCAGAGG + Intronic
949740439 3:7227209-7227231 ATGAAAACACAAATGGTCAATGG - Intronic
950526920 3:13529589-13529611 TTGAATAAATAAATGGATAAAGG - Intergenic
950844875 3:16005664-16005686 TTGAATATATAATTTGAAAAAGG + Intergenic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
951364778 3:21768179-21768201 TTGATTATGAAAAAGGACAAAGG + Intronic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
951858356 3:27223421-27223443 TTGGATGTGCAGATGGACAATGG - Intronic
951977026 3:28522468-28522490 ATGGATTTATAAATGGACAAAGG + Intronic
952230209 3:31421519-31421541 TTGAATATGCAAATATGCAAAGG - Intergenic
952685181 3:36139408-36139430 TTGAATATAGAAAGGGAAAATGG + Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953275046 3:41486807-41486829 TTGTGTATACAAATGGTCAATGG - Intronic
953332747 3:42067832-42067854 TTGAAAATTCACATGGAAAAAGG - Intronic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
953576518 3:44117066-44117088 TAGAATCTACAAATGCACAAAGG - Intergenic
953715380 3:45312938-45312960 ATGAATATATGAATGGATAATGG + Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
956934428 3:74083903-74083925 TTTAACATACATATGGACACAGG + Intergenic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
957791808 3:84951367-84951389 TTGGATAAAGAAATGGATAAAGG + Intergenic
958001241 3:87751694-87751716 ATGGATAGAAAAATGGACAATGG + Intergenic
958666691 3:97148748-97148770 TTAAATATAAAAATTGAAAATGG - Intronic
958776667 3:98492373-98492395 TTGATTTTACAAGTGGACAAAGG + Intergenic
958900985 3:99886575-99886597 TAGAACAAACAAATGAACAAAGG + Intronic
959111924 3:102132896-102132918 TTTAGTATAAAAATGGAAAATGG + Intronic
959178872 3:102953510-102953532 GACAATATACAAATGGACAATGG + Intergenic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
959750951 3:109834362-109834384 TTGAGTATGCAACTTGACAATGG - Intergenic
960126880 3:114008751-114008773 TCAAATAGAAAAATGGACAAAGG + Intronic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
962570378 3:136707355-136707377 TCCAATTTACAAATGGGCAAAGG + Intronic
963287819 3:143453170-143453192 TTGAATACACAAATTAACATAGG + Intronic
963354013 3:144187621-144187643 TTGAATTTAGTAAAGGACAAAGG - Intergenic
963396946 3:144747110-144747132 CTTATTGTACAAATGGACAATGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964975036 3:162607612-162607634 TTGAATACACAGATGCACAGAGG - Intergenic
965911373 3:173781609-173781631 TTGAATAGAGACATGGACACTGG + Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966290268 3:178347866-178347888 TGTAATATACAAATGGACACTGG + Intergenic
966483270 3:180436535-180436557 TTGTAGATAGAAATGGAAAATGG + Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
968198869 3:196734786-196734808 TTGAATATATGAATTGGCAAAGG + Intronic
969837104 4:9850884-9850906 ATGAATGCACAAATGGACACTGG + Intronic
969964674 4:10982062-10982084 TTGAATAAATAGATGAACAAAGG - Intergenic
970065519 4:12089499-12089521 ATTAATATGCAAATGGAAAAGGG - Intergenic
970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG + Intronic
970505488 4:16725319-16725341 TTGAATATGCCAATAGACAATGG + Intronic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971916580 4:32877644-32877666 TTCGATATAGAAATGGAGAATGG + Intergenic
973222587 4:47745833-47745855 TTGTACATAAAAATGGAAAAAGG + Intronic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
973933392 4:55816883-55816905 TTGGATATGGAAATGGAGAAAGG - Intergenic
974148255 4:57972721-57972743 TTGAATATACACATGGGCTGTGG + Intergenic
974497835 4:62656273-62656295 TTGAATAAAGAAATTGGCAAAGG - Intergenic
974583818 4:63843415-63843437 TTAAATACAGAAATGGAGAAAGG + Intergenic
975529471 4:75385845-75385867 AGGCATATACAAATGGGCAATGG + Intergenic
975621481 4:76301087-76301109 TCCAATATAAAAATGGACGAGGG - Intronic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
976866794 4:89738159-89738181 TTGAATATACTAATGCACAAAGG + Intronic
977113339 4:92988785-92988807 TGGAATAAACAAACTGACAAAGG + Intronic
977177384 4:93834082-93834104 TTGAACTTTCAAATGGGCAAAGG - Intergenic
977829228 4:101570771-101570793 TTGAATATATCAACAGACAATGG + Intronic
977967214 4:103167462-103167484 TTGTATATACATATGAAAAATGG + Intronic
978038100 4:104021791-104021813 TTGAATATATAAACAGACAATGG + Intergenic
978604299 4:110462678-110462700 TGGAATATGCAAGTGGACACAGG + Intronic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979563388 4:122125614-122125636 ACAAATATACAAATGGACATAGG - Intergenic
980681704 4:136170951-136170973 TTAAAGATACTAATGCACAATGG - Intergenic
980684524 4:136209337-136209359 TTGAATAAACTAATGAATAATGG + Intergenic
980734360 4:136866167-136866189 TTGAATATAAAAATGAAGAAAGG - Intergenic
981104860 4:140868835-140868857 TTCAATAGAAAAATGGACAAAGG + Intronic
981250162 4:142591468-142591490 TTGAATAAATAAATGGAGAAAGG + Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
982289981 4:153770306-153770328 CTCAATTTAAAAATGGACAAAGG - Intergenic
983458728 4:167999760-167999782 TTGATTATACACAGGGACCAGGG - Intergenic
983630733 4:169846653-169846675 TTAAATAAACAAATGAACTAAGG - Intergenic
983766582 4:171491530-171491552 CTGAATATATAAATGGATGATGG + Intergenic
985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG + Intronic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
986461354 5:7975691-7975713 TTGAATACACCAAGGGACAATGG + Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986863327 5:11953346-11953368 CTCCACATACAAATGGACAAAGG - Intergenic
986904385 5:12476220-12476242 TTGAATATAGAAGTAGACAATGG - Intergenic
987105911 5:14639090-14639112 TTGAAAAAAAAAATGGGCAAAGG - Intergenic
987497563 5:18667851-18667873 TTGAATATCCAAGTGAAGAAAGG + Intergenic
987528682 5:19086161-19086183 GTCAATATACACATGGAAAATGG - Intergenic
987588440 5:19890458-19890480 TTGAATATATAAATGTCCAATGG + Intronic
987888423 5:23842644-23842666 TCCAATTTAAAAATGGACAAAGG + Intergenic
987964477 5:24853948-24853970 TTGAATGGACAAATGGACCAGGG - Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
989013707 5:36903946-36903968 TTGAATATAGAAATATAGAAAGG + Intronic
989227314 5:39044430-39044452 TAAAATATAAGAATGGACAAGGG + Intronic
989459626 5:41682578-41682600 ATGAATAAACAAATGATCAATGG + Intergenic
990327540 5:54693189-54693211 TTCAATAGAAAAATGGGCAATGG + Intergenic
990536293 5:56726359-56726381 TTGAGTAGACAAATGTACAATGG - Intergenic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
990756840 5:59081598-59081620 TTGTATAACCATATGGACAAAGG - Intronic
991212956 5:64128586-64128608 TTGAATATCAAAATGTAGAATGG + Intergenic
991658382 5:68926207-68926229 TAGAAAACACAATTGGACAAAGG + Intergenic
992106989 5:73457586-73457608 ATCAGTAAACAAATGGACAAAGG + Intergenic
992226527 5:74624358-74624380 TTGAATATACCCATGGATAATGG - Intergenic
992623818 5:78618814-78618836 TTGAACATACACATTGAAAAAGG + Intronic
992882196 5:81121449-81121471 ATGACAATAAAAATGGACAAAGG - Intronic
992979676 5:82155931-82155953 TTGAATATAATAATTGATAAAGG + Intronic
993299559 5:86190793-86190815 TTGCATCTACAAATAGGCAAAGG + Intergenic
993456709 5:88135659-88135681 TATAATATACAAATGTATAATGG + Intergenic
994946744 5:106403610-106403632 TTGAATATAAAAAGCGAAAATGG - Intergenic
995266404 5:110166737-110166759 TAGAATATTTCAATGGACAATGG - Intergenic
995554921 5:113317780-113317802 ATGAAGATGCAAATGGAAAAAGG + Intronic
995961480 5:117845742-117845764 TTCAAAATACAAATGTACAGTGG + Intergenic
995963287 5:117872137-117872159 TTGCTTATACAAATGAACAATGG + Intergenic
996117826 5:119637580-119637602 TTTAAAAAAAAAATGGACAAGGG - Intergenic
996307702 5:122068816-122068838 ATGAATAAATAAATGGAGAATGG + Intronic
996647199 5:125830256-125830278 ATGAAAATAGAAAGGGACAAGGG - Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997914686 5:137912763-137912785 TCCAATTTAAAAATGGACAAAGG - Intronic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999264870 5:150260095-150260117 TTAAATAAACCAATGGACAGAGG - Intronic
999854450 5:155578973-155578995 ATGAATAAACAAATGGTGAATGG + Intergenic
999901295 5:156089451-156089473 TTCACTATACAAAATGACAACGG - Intronic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000036220 5:157450271-157450293 TTTAATATGCTAATGTACAATGG + Intronic
1000459858 5:161501028-161501050 TTAAAAATACACATGGACACAGG - Intronic
1000469193 5:161618986-161619008 TCCAATATAAACATGGACAAAGG + Intronic
1000479795 5:161758020-161758042 TTAAATACACCAAAGGACAATGG - Intergenic
1000544835 5:162586006-162586028 TTTAATATACACATGCACAAAGG - Intergenic
1000759995 5:165210993-165211015 TTAAATATACGAATTGAAAATGG + Intergenic
1002390034 5:178903479-178903501 CTCAATATAAAAATGGGCAAAGG - Intronic
1003002146 6:2346305-2346327 CTGAATAGACCAGTGGACAATGG + Intergenic
1003010769 6:2425347-2425369 CTGATTTTAAAAATGGACAAAGG - Intergenic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG + Intergenic
1004109876 6:12706977-12706999 TTGAATAGACACATTGCCAAAGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004740844 6:18459217-18459239 TTCATTAGACAAATGGAGAAGGG - Intronic
1004741154 6:18462573-18462595 TTCATTAGACAAATGGAGAAAGG - Intronic
1004794947 6:19071004-19071026 ATTAATATATAAATGGAGAAAGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1005801866 6:29433671-29433693 TTGAATATATACACAGACAAGGG + Intronic
1006765598 6:36502408-36502430 TAAAAAATACTAATGGACAAAGG - Intronic
1007103931 6:39270415-39270437 TTGAATATTCAGAGGGAGAAAGG + Intergenic
1008168657 6:48173863-48173885 GTGAATATACAAATTTCCAAAGG + Intergenic
1008368991 6:50712515-50712537 TGCTTTATACAAATGGACAAAGG - Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1008952954 6:57180893-57180915 TTGAGTATACAAATCAACAAGGG + Intronic
1010412331 6:75574663-75574685 TAGAATATAGACATGGGCAAAGG + Intergenic
1011001889 6:82599488-82599510 TTGAATAAACATAAGCACAAAGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012408736 6:98931426-98931448 TTCAATATAGAAATGTAAAATGG + Intronic
1012453479 6:99378905-99378927 ATGAATACATAAATGGACAGAGG + Intronic
1012564303 6:100627734-100627756 TTCAATATAAAAATTGAAAATGG - Intronic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013897563 6:115108509-115108531 TTCAATATATAAATGGGCCAAGG + Intergenic
1013986845 6:116204315-116204337 TTGAATGTAGAAATGTAAAAGGG + Intronic
1014758933 6:125333701-125333723 TCCAATTTACAAATGGGCAAAGG - Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1015132407 6:129828302-129828324 AAGAACATACAAATGGTCAAAGG - Intergenic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1015875780 6:137820881-137820903 TTCAGAATAGAAATGGACAAAGG + Intergenic
1016554473 6:145320295-145320317 TTCAATAGAAAAATGGACAGTGG - Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016942640 6:149495876-149495898 TAGAATATATAAATGGAGACTGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017395416 6:153993264-153993286 TTGAATGTACAAAAGGAGGAAGG - Intergenic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1019870730 7:3758365-3758387 TTGAATATATAAATGGGAGATGG - Intronic
1020463885 7:8454484-8454506 TCAAATTTACAAATGAACAAAGG - Intronic
1020605228 7:10328477-10328499 TTGAATGTCAAAAAGGACAAGGG + Intergenic
1020809768 7:12837248-12837270 TTGATGATAGAAATGCACAATGG + Intergenic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1020985526 7:15129289-15129311 CTGGATATACAACTGAACAATGG - Intergenic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1021463023 7:20910474-20910496 ATGAATAGAATAATGGACAAAGG + Intergenic
1021775111 7:24046486-24046508 TTCAATGGAAAAATGGACAAAGG + Intergenic
1021792659 7:24221590-24221612 AAGGATATACAAATAGACAATGG + Intergenic
1022295256 7:29044713-29044735 TTGAAAAGACAAATCGAGAAAGG - Intronic
1023581356 7:41687290-41687312 TTTAATCTACAAATTGACATAGG + Exonic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024781198 7:52851201-52851223 TTGAATCTATAAATGGAAAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025021093 7:55480782-55480804 TTGAACACACAAATGGACATAGG - Intronic
1025310303 7:57928463-57928485 TAGAATCTACAAGTGGACATTGG + Intergenic
1026681305 7:72468881-72468903 CTGAATTTAAAAATGGGCAAAGG - Intergenic
1026981267 7:74528128-74528150 GTGAATATACAAATGGCTAAAGG - Intronic
1027331552 7:77100878-77100900 TTGAAGATTCAAAGGAACAAAGG + Intergenic
1028260209 7:88655142-88655164 TTGAAAATCCCAGTGGACAATGG + Intergenic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028365831 7:90030515-90030537 TTAAATATAAAAATAGGCAAAGG + Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1028817530 7:95164312-95164334 TTGTAAATATTAATGGACAATGG - Intronic
1029384597 7:100235109-100235131 TCAAATATGCAAATGGAAAAGGG + Intronic
1029784219 7:102770462-102770484 TTGAAGATTCAAAGGAACAAAGG - Intronic
1029876104 7:103753673-103753695 TTGAAAATACAAATTAATAATGG + Intronic
1030873834 7:114789278-114789300 TTGAATAGAAAAATGGGCAAAGG - Intergenic
1031046706 7:116897358-116897380 TTGAATACAGAAGTGTACAAGGG - Intronic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1031241383 7:119246347-119246369 TTGACAATACAAATGAACATAGG - Intergenic
1031429173 7:121645291-121645313 TTGATTATAAACAAGGACAAGGG - Intergenic
1031469489 7:122152102-122152124 TTAAAAAAAAAAATGGACAAAGG - Intergenic
1031799842 7:126228772-126228794 TTTCAAATTCAAATGGACAAAGG - Intergenic
1032112625 7:129089665-129089687 ATGAAAATACAAACAGACAATGG + Intergenic
1032241849 7:130167490-130167512 TTTATTAGAAAAATGGACAAAGG - Intronic
1032607544 7:133372056-133372078 CTGAACTTAAAAATGGACAAAGG - Intronic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1033923954 7:146433460-146433482 TTGAAAATACACATTGACAAAGG + Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1036000857 8:4602045-4602067 ATGAATATAGAAATAGATAAAGG + Intronic
1036293505 8:7516904-7516926 TTAAATATAAAGATGGATAAAGG + Intergenic
1036329054 8:7804091-7804113 TTAAATATAAAGATGGATAAAGG - Intergenic
1036727101 8:11230167-11230189 ATGAATAAACAAATGAACACAGG + Intergenic
1037086969 8:14864264-14864286 TTGTTTATACAAATGAACACAGG - Intronic
1037367769 8:18141151-18141173 TTGAATATAAAAATGTTCTAGGG - Intergenic
1038064457 8:23949206-23949228 TGGAATATAAAAATGGTCAGTGG + Intergenic
1038378819 8:27072572-27072594 TCCAATATAAAAATTGACAAAGG + Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039528533 8:38237725-38237747 TTCAATATAAAATTTGACAAAGG - Intronic
1039730559 8:40271740-40271762 TTGAATATCCATATCCACAATGG - Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040056344 8:43060920-43060942 TTTAATCAAAAAATGGACAAAGG + Intronic
1040888131 8:52287684-52287706 TTGCATATACAAAGGGAGACAGG + Intronic
1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041206388 8:55502553-55502575 TTCAATTTAGAAATGGGCAAAGG - Intronic
1041301180 8:56413410-56413432 TTGAATATAGAAATGCAAATTGG + Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041480944 8:58318882-58318904 TTCAATAAATAAATGAACAAAGG + Intergenic
1041577481 8:59416022-59416044 TTGAATATATAAATGAAGCAGGG - Intergenic
1041947057 8:63457278-63457300 ATGAAAATATAAATGTACAAAGG - Intergenic
1042095186 8:65207638-65207660 TAAGATATACAAATGGCCAACGG - Intergenic
1042233712 8:66586396-66586418 GAAAACATACAAATGGACAATGG + Intronic
1042293300 8:67192374-67192396 TTCAATTTGAAAATGGACAAAGG - Intronic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044060794 8:87632260-87632282 TTGAATATACATAGAGAGAAAGG + Intergenic
1044203500 8:89464088-89464110 GACAATATACAAATGGACAATGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044850562 8:96423290-96423312 CTGGATATACGAATGGGCAAAGG - Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045640924 8:104249435-104249457 TTTAATATACAAATGCACTAAGG - Intronic
1045783366 8:105894579-105894601 TTGAATAAATAAATGTAGAAGGG + Intergenic
1045882054 8:107052518-107052540 TTCAAAATACAAAGGGAAAAAGG + Intergenic
1046792807 8:118340038-118340060 TTGAATAAATGAATGAACAAAGG - Intronic
1046869211 8:119186333-119186355 TTAAATAGATAAATGGGCAAAGG - Intronic
1047301762 8:123619484-123619506 TTCAGTATACAAATGGACAATGG - Intergenic
1047649103 8:126900502-126900524 TTGGACATACAAAGGGACCAAGG - Intergenic
1047686506 8:127310107-127310129 TCCAATATATAAATGGGCAAAGG + Intergenic
1048696521 8:137034630-137034652 TTGAAAATAGAAATGCACACAGG + Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048941301 8:139403070-139403092 CTGAATATATGAATGGACAGTGG + Intergenic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1050837052 9:10095858-10095880 TTGAATATATTAAAGCACAAGGG + Intronic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051856361 9:21571314-21571336 TTGAATATAAAAATATACCATGG + Intergenic
1052477371 9:28977258-28977280 TATTATATACAAATGGAGAACGG + Intergenic
1052557428 9:30034935-30034957 TTTAATATATGAATTGACAAAGG - Intergenic
1053183456 9:35993961-35993983 TTGAATTTGTAAATGGCCAAGGG - Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1054973622 9:71117449-71117471 TTGAATATTAAAATGGAAGAAGG - Intronic
1055320281 9:75076909-75076931 TTAAATATAAAACTGGAAAAAGG + Intronic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1055806581 9:80101984-80102006 TTGGATATAGAAATGTAAAATGG - Intergenic
1056172665 9:84002455-84002477 TAGAACAGACAAATAGACAAAGG - Exonic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1056856824 9:90138714-90138736 TTGTAAATAGAAATGGTCAAGGG + Intergenic
1057020189 9:91691350-91691372 ATAAATATACAAATGGATTATGG - Intronic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1057830123 9:98399870-98399892 TTCAAAATAAAAATGGTCAAAGG + Intronic
1058481584 9:105401231-105401253 TTAAATATACAAATAAGCAAAGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1060423809 9:123488176-123488198 TGGAGTAAACACATGGACAATGG + Intronic
1060566807 9:124599904-124599926 TTGAATAAACATATGGGAAATGG - Intronic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1061841182 9:133359402-133359424 TCCAATATACAAGGGGACAACGG + Intronic
1203356972 Un_KI270442v1:161684-161706 TTGAATCTGCAAGTGGACATTGG - Intergenic
1203397245 Un_KI270519v1:34473-34495 TTGAATCTGCAATTGGACATTGG - Intergenic
1203413429 Un_KI270589v1:20384-20406 TTGAATCTGCAATTGGACATTGG - Intergenic
1203413481 Un_KI270589v1:21405-21427 TTGAATCTGCAAATTGACATTGG - Intergenic
1203413527 Un_KI270589v1:22257-22279 TTGAATCTGCAATTGGACATTGG - Intergenic
1203413618 Un_KI270589v1:23898-23920 TTGAATCTGCAATTGGACATTGG - Intergenic
1203413703 Un_KI270589v1:25429-25451 TTGAATCTGCAATTGGACATTGG - Intergenic
1203413889 Un_KI270589v1:29742-29764 TTGAATCTGCAATTGGACATTGG - Intergenic
1203413995 Un_KI270589v1:31617-31639 TTGAATCTGCAATTGGACACTGG - Intergenic
1203414034 Un_KI270589v1:32297-32319 TTGAATCTGCAATTGGACATTGG - Intergenic
1203414099 Un_KI270589v1:33320-33342 TGGAATCTACAAATTGACATTGG - Intergenic
1203416419 Un_KI270591v1:2560-2582 TTGAATTTGCAATTGGACATTGG - Intergenic
1203416477 Un_KI270591v1:3582-3604 TTGAATCTGCAATTGGACATTGG - Intergenic
1203684180 Un_KI270757v1:26558-26580 TGGAATCTACAAATTGACATTGG + Intergenic
1203684245 Un_KI270757v1:27581-27603 TTGAATCTGCAATTGGACATTGG + Intergenic
1203684284 Un_KI270757v1:28261-28283 TTGAATCTGCAATTGGACACTGG + Intergenic
1203684390 Un_KI270757v1:30136-30158 TTGAATCTGCAATTGGACATTGG + Intergenic
1203684607 Un_KI270757v1:33783-33805 TTGAATCTGCAATTGGACATTGG + Intergenic
1203684693 Un_KI270757v1:35314-35336 TTGAATCTGCAATTGGACATTGG + Intergenic
1203684784 Un_KI270757v1:36955-36977 TTGAATCTGCAATTGGACATTGG + Intergenic
1203684831 Un_KI270757v1:37807-37829 TTGAATCTGCAAATTGACATTGG + Intergenic
1203684885 Un_KI270757v1:38828-38850 TTGAATCTGCAATTGGACATTGG + Intergenic
1186812005 X:13199594-13199616 TCTCATATACAAATGGACAATGG + Intergenic
1187420913 X:19132988-19133010 TTGAGTGTACAGATGGGCAAAGG - Intergenic
1187492980 X:19769991-19770013 CTGAATCTAAAAATGGGCAAAGG + Intronic
1187550465 X:20297877-20297899 CTCAATATAAAAATGGGCAAAGG + Intergenic
1187841031 X:23488258-23488280 GCAGATATACAAATGGACAATGG + Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188791292 X:34411270-34411292 TCCAGTATAAAAATGGACAAAGG + Intergenic
1188905892 X:35791358-35791380 TTGAATATACAAATTTTCTATGG - Intergenic
1189538854 X:41965268-41965290 TTAAATTTAAAAATGGGCAAAGG + Intergenic
1189760486 X:44316797-44316819 TTGAATTTAAAAATGGGCAAAGG + Intronic
1189859486 X:45258350-45258372 TTGAATATAAGAACGCACAATGG + Intergenic
1189913402 X:45834022-45834044 TTGAATATGCAGATGGTCCATGG + Intergenic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1190469771 X:50766718-50766740 TTGAATATATAAATGTAAAAAGG + Intronic
1190483504 X:50901015-50901037 ATGAACAAACAAATGCACAAAGG + Intergenic
1190500267 X:51068918-51068940 TTGAATTGAAAAATGGGCAAGGG + Intergenic
1190724912 X:53182668-53182690 TTCAATTTAAAAATGGGCAAAGG - Intergenic
1190748289 X:53339857-53339879 CTGAACGTACAAATTGACAATGG + Intergenic
1191024812 X:55902463-55902485 CTCAATATAAAAATGGGCAAAGG - Intergenic
1192276249 X:69634176-69634198 TGCAATTTAGAAATGGACAAAGG - Intronic
1192289243 X:69774760-69774782 TTAAATATACAAATGTAATAGGG + Intronic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193057068 X:77164153-77164175 TTAAATAAAGAAATGGACAAAGG + Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194681074 X:96853563-96853585 TTGAATACATTAATGGAAAATGG - Intronic
1195503147 X:105626554-105626576 TTAAATATAAACATGGTCAATGG + Intronic
1197129026 X:122982393-122982415 TTCAAAAGTCAAATGGACAATGG + Intergenic
1197971147 X:132116412-132116434 TTTCATGTACAAATGGAAAATGG - Intronic
1198263454 X:134987526-134987548 TTTAATATAGAAATGAGCAAAGG + Intergenic
1199204143 X:145128089-145128111 TCGAATATACAAACAGACAACGG + Intergenic
1199438324 X:147839905-147839927 TTGCATTTACAAATGTACAATGG - Intergenic
1199701811 X:150384436-150384458 TCCAATATAAAAATGGGCAAAGG - Intronic
1199747213 X:150780081-150780103 TTCAATCTAAAAATGGGCAAAGG + Intronic
1200023274 X:153230028-153230050 TTGAAAATACAAAAGGAAGAAGG - Intergenic
1201049806 Y:9921310-9921332 TTTAATATTCAAATGAATAAAGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic