ID: 933178833

View in Genome Browser
Species Human (GRCh38)
Location 2:79207310-79207332
Sequence CTGGACTACCTAGGTGAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933178833_933178840 19 Left 933178833 2:79207310-79207332 CCGGTTTCACCTAGGTAGTCCAG 0: 1
1: 0
2: 2
3: 6
4: 100
Right 933178840 2:79207352-79207374 TAACCTAAAGCTACCCCTTAAGG 0: 1
1: 0
2: 0
3: 7
4: 103
933178833_933178842 25 Left 933178833 2:79207310-79207332 CCGGTTTCACCTAGGTAGTCCAG 0: 1
1: 0
2: 2
3: 6
4: 100
Right 933178842 2:79207358-79207380 AAAGCTACCCCTTAAGGTAAAGG 0: 1
1: 0
2: 0
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933178833 Original CRISPR CTGGACTACCTAGGTGAAAC CGG (reversed) Intronic
902091619 1:13908215-13908237 CTGGACTGCCCATGAGAAACAGG + Intergenic
908041618 1:60119726-60119748 CTGGACTACATAGTTCAAAAGGG + Intergenic
913081395 1:115390547-115390569 CTGGACTACCCAGGGGAAACTGG + Intergenic
919541677 1:198854345-198854367 CCTGACAACCTATGTGAAACTGG + Intergenic
922337127 1:224627021-224627043 CTGGACTTTCTAAGTGAAGCAGG + Intronic
924298008 1:242608231-242608253 ATGGACTGCCTATGTGAAAGGGG - Intergenic
924439554 1:244074813-244074835 CTGGGCTACTTAGGGGTAACAGG - Intergenic
1063414620 10:5863358-5863380 CTGGACTTCCTGGGTCAAATGGG + Intronic
1067356001 10:45527498-45527520 CTAGAAAACCTAGATGAAACAGG + Intronic
1068499943 10:57832381-57832403 CTGGACTTCCTAGGTCAAGTGGG + Intergenic
1072489729 10:95892755-95892777 CTGGACTGCTTAGGGCAAACCGG - Intronic
1074688784 10:115984030-115984052 CTGGACTATTTAGGTAAAAGAGG + Intergenic
1075935127 10:126333756-126333778 CTGGAATATGTAGGTGAAACAGG - Intronic
1076607769 10:131700622-131700644 CAGGACTGCCTGGGTGCAACTGG - Intergenic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1079277049 11:19050480-19050502 TTGGACAACATAGATGAAACTGG + Intergenic
1081047834 11:38297831-38297853 CTGCACCACCTGGGTGAAGCAGG + Intergenic
1082920434 11:58486597-58486619 CTGGACTACTAAAATGAAACTGG + Intergenic
1085867266 11:80308972-80308994 CTGTGCTAACTATGTGAAACTGG + Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1091479585 12:813886-813908 CTGAACAACCAAAGTGAAACTGG - Intronic
1095355916 12:41275012-41275034 CTGGACTACATAGATGCATCAGG - Intronic
1097414279 12:59295372-59295394 CTGGACTTCCTGGGTCAAATGGG + Intergenic
1105725404 13:23158780-23158802 CTGGACTTCCTGGGTGAAGTGGG + Intergenic
1109392553 13:61711044-61711066 CTGGACTACCAGGGAGAAATTGG + Intergenic
1113461960 13:110488394-110488416 CTGGTCTACCTGGGTGCCACTGG - Intronic
1114575337 14:23707677-23707699 CTGGACTTCCTGGGTCAAGCGGG - Intergenic
1118385088 14:65249557-65249579 CCTGACTACCTAGGGGAAATTGG - Intergenic
1118547169 14:66904578-66904600 CTGGACTTCCTGGGTCAACCAGG - Intronic
1123129051 14:105971184-105971206 CTGGAGTACCAATGTGTAACAGG + Intergenic
1126508359 15:49435399-49435421 CTTGATTACATAGTTGAAACAGG - Intronic
1130982965 15:88825452-88825474 ATGTACTATCTAGGTGAATCTGG - Intronic
1135061410 16:19274246-19274268 CTGGACTACCAAGGGGAAACTGG - Intergenic
1135626233 16:23997216-23997238 CTGGACTACTAAGGGGAAATTGG + Intronic
1139102759 16:63788212-63788234 CTGAACTGCCTATGAGAAACTGG + Intergenic
1139206562 16:65034790-65034812 CTGGACTGCCTACGTGGAATTGG + Intronic
1144270888 17:13614622-13614644 CTGGAATACCTAGTGGAGACAGG + Intergenic
1153584028 18:6602897-6602919 CTACACTACCTAGGTTAAACTGG - Intergenic
1157024822 18:43830171-43830193 GTGGACTGCCTAGCTGCAACGGG - Intergenic
1158237047 18:55328539-55328561 CTGCACTTCCTAGATGAAGCTGG + Intronic
1159663442 18:71127953-71127975 TGGGACTACTTAGGTGAAAATGG - Intergenic
1160362971 18:78299454-78299476 CTGCACTACCTATGTTAAATGGG - Intergenic
1160584772 18:79906765-79906787 CTGGAGTCCCTAAGTGCAACTGG + Intronic
1163845612 19:19636788-19636810 CTGGAGTCCCTAGGTGGCACAGG + Exonic
1164029508 19:21389658-21389680 CTGGACTTCCTGGGTCAAATGGG + Intergenic
927037721 2:19197441-19197463 TTTGACAACCTAGGTGAAATTGG + Intergenic
929873764 2:45779157-45779179 CTGGACTACCTAGGTAGTATGGG + Intronic
933178833 2:79207310-79207332 CTGGACTACCTAGGTGAAACCGG - Intronic
937604847 2:123786998-123787020 CTGGAATACCTAGAGGAAATGGG - Intergenic
939806476 2:146780178-146780200 CTGGACTATCAAGATGAAATCGG + Intergenic
943468826 2:188266317-188266339 CAGGACTACCTGGGAGAAGCTGG - Intergenic
947353331 2:229269403-229269425 CAGGATTCCCTAAGTGAAACAGG + Intronic
1175263575 20:57689478-57689500 CTGGACTCCCCAGGAGGAACGGG - Intronic
1176701543 21:10057564-10057586 CTGGACTTCCTAGGTGGAGTGGG - Intergenic
1177743644 21:25184382-25184404 TTAGACTACCCAGCTGAAACAGG + Intergenic
1182861814 22:33566895-33566917 CTGGACTTCCTGGGTCAAATGGG - Intronic
949101047 3:145640-145662 CTGGGCAACCTAGCTGAATCAGG - Intergenic
953667859 3:44938923-44938945 CTGAGCTACCTTGGTCAAACTGG + Intronic
956841341 3:73142902-73142924 CAGGACTACCAAGGTGAAGCTGG - Intergenic
957755253 3:84476908-84476930 CTGGACCACCTAGGGTAAATTGG + Intergenic
959085129 3:101844332-101844354 CAGGACTTTTTAGGTGAAACTGG + Intronic
960549945 3:118964167-118964189 TTGGATTACCTTGGGGAAACTGG + Intronic
962214941 3:133513092-133513114 CTGGACTACCAAGGAGAAATTGG + Intergenic
964560546 3:157990670-157990692 CTGGGGTACTCAGGTGAAACCGG + Intergenic
965631057 3:170733256-170733278 CTGGACTACCTCAGAGAAAGTGG - Intronic
967588521 3:191244250-191244272 CTAAACTTCCTATGTGAAACAGG - Intronic
967998642 3:195186015-195186037 CTGGACTTCTTAGGTGAGAGGGG - Intronic
969043834 4:4322185-4322207 CTGGAATATCAAGGTGAGACTGG + Intergenic
976786669 4:88828920-88828942 ATTGACAACCTAGGAGAAACTGG - Intronic
977408553 4:96632220-96632242 CTGGACTTCCTGGGTGGAATGGG + Intergenic
978946906 4:114510527-114510549 CTGGACTAACTTGGAGAAAGAGG + Intergenic
980373708 4:131913811-131913833 CTGGACTTCCTAGGTGGAGTGGG - Intergenic
986525359 5:8668289-8668311 CAGGACTACCTTGGGGAAACTGG + Intergenic
989149182 5:38281689-38281711 CTTTACTAGCTAGGTGAAATGGG + Intronic
992109633 5:73480976-73480998 CCTGACTACCAAGGGGAAACTGG - Intergenic
999176340 5:149634315-149634337 CTGCACTAGCTAGTTCAAACAGG + Exonic
1003316414 6:5016321-5016343 CTGGACAACCTAGATAAAATGGG - Intergenic
1012866319 6:104622587-104622609 CTGGGCTGCCTAGGTGACATGGG + Intergenic
1013328527 6:109073111-109073133 CTGCACTAGCTAGGTGAACAGGG + Intronic
1013790534 6:113831635-113831657 CTGGACTTCCTGGGTGGAATGGG + Intergenic
1016776963 6:147915221-147915243 CTGAAGTACCTAGGAGAAATGGG + Intergenic
1020580751 7:9997222-9997244 CTGGATAACCTAGGAGAAATGGG + Intergenic
1023817160 7:43959890-43959912 CTGGCCTATCAAGCTGAAACAGG + Intergenic
1024436984 7:49368467-49368489 CTGGATAACCTATGTGAAATGGG - Intergenic
1027835007 7:83230201-83230223 TTGGAATACATAAGTGAAACTGG + Intergenic
1028360472 7:89961177-89961199 CTTGACTACCAAGGGGAAATTGG - Intergenic
1030192517 7:106823789-106823811 CCAGACTACCAAGGGGAAACTGG - Intergenic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1034820635 7:154213337-154213359 CTGGACTACCTCTAGGAAACTGG - Intronic
1035366181 7:158350368-158350390 CTGCACTTCCTGGGTGAAGCAGG - Intronic
1035959793 8:4124674-4124696 CTGGACTTCCTAGGTCAATAGGG + Intronic
1036099108 8:5757854-5757876 CTGGACTTCCTAGGTGGAATGGG - Intergenic
1039276555 8:35938859-35938881 CTGGACTTCCTGGGTGAAGTGGG + Intergenic
1041135189 8:54750513-54750535 CTGGACTTCCTAGGTCAAGTGGG + Intergenic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1044067998 8:87722244-87722266 CTGGACTTCCTGGGTCAAATGGG - Intergenic
1049153825 8:141055148-141055170 CTGGGCTACCTTGGTGGAAGGGG - Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1053181355 9:35973342-35973364 CTGGAAAACCTAGATGAAATGGG - Intergenic
1053767391 9:41421155-41421177 CTGGACTTCCTAGGTGGAGTGGG + Intergenic
1054319488 9:63640621-63640643 CTGGACTTCCTAGGTGGAGTGGG - Intergenic
1057457896 9:95231031-95231053 CTGGACTTCCTAGGTCAAGTGGG - Intronic
1061527759 9:131181387-131181409 CTGGATTACATAGCTCAAACTGG + Intronic
1202786562 9_KI270719v1_random:27648-27670 CTGGACTTCCTAGGTGGAGTGGG - Intergenic
1188168868 X:26896058-26896080 CTGGAAAACCTAGAGGAAACGGG + Intergenic
1189369127 X:40413918-40413940 CTGGACCACCTAGGAGTAAATGG - Intergenic
1198472741 X:136964121-136964143 CTGCAGTAACTAGGTGAGACAGG - Intergenic
1199123951 X:144091743-144091765 CTGGACTTCCTGGGTCAAATAGG - Intergenic
1201312417 Y:12608702-12608724 CTGGACTTCCTAGGTCAAGTGGG - Intergenic