ID: 933178873

View in Genome Browser
Species Human (GRCh38)
Location 2:79207671-79207693
Sequence GAAGTGGCTCCCTGCAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 345}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933178868_933178873 15 Left 933178868 2:79207633-79207655 CCATGAAGAACAAGTGGTGGTTC 0: 1
1: 0
2: 0
3: 7
4: 140
Right 933178873 2:79207671-79207693 GAAGTGGCTCCCTGCAGAGCTGG 0: 1
1: 0
2: 2
3: 26
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933178873 Original CRISPR GAAGTGGCTCCCTGCAGAGC TGG Intronic
900599282 1:3496220-3496242 GCAGTGAGTCACTGCAGAGCAGG - Intronic
900704629 1:4072566-4072588 CACGAGGCTCCCTTCAGAGCAGG + Intergenic
900894804 1:5475625-5475647 GAAGAGGTTCCCTGGAGTGCTGG - Intergenic
901232110 1:7647096-7647118 GAGCTGGGTCCCTGGAGAGCAGG - Intronic
901332115 1:8418096-8418118 GTGCTGGCTCCCTGCAGGGCAGG + Intronic
901405149 1:9040237-9040259 GAAGGCGCCCTCTGCAGAGCCGG + Intronic
901462466 1:9399899-9399921 GCAGTGGCTTCCAGCAGGGCTGG - Intergenic
901631136 1:10648773-10648795 GCACGTGCTCCCTGCAGAGCAGG - Intronic
902139589 1:14341663-14341685 GGAGGGCCTCCCTGCAGAGGTGG - Intergenic
902260280 1:15219841-15219863 CAAATGGCTCCATGCACAGCTGG - Exonic
902859171 1:19232397-19232419 GAGCTGGCTCCCTACATAGCTGG + Intronic
903027302 1:20438511-20438533 GCAGTGGCTTCCAGCAGAGCAGG - Intergenic
903363181 1:22789942-22789964 GAAGTGGCTCCTGGGTGAGCAGG + Intronic
903698965 1:25232224-25232246 GAACTGGCTTCAGGCAGAGCCGG + Intronic
904346664 1:29876856-29876878 GAAGTGGCTCTCAGCAGAAGGGG - Intergenic
904645663 1:31964185-31964207 GGAGTAGCTCCCTGCAGGACTGG - Intergenic
904857737 1:33511685-33511707 GAAGTTGCTCCCCTCAGGGCTGG - Intergenic
905506483 1:38484013-38484035 GAAGTGGTACCCAGCTGAGCTGG - Intergenic
906669036 1:47641609-47641631 GGAGGGGCTCCCAGCAGAGTGGG + Intergenic
907333421 1:53685838-53685860 GCAGCGGCTCCCAGCAGATCTGG - Intronic
907567538 1:55449956-55449978 ACAGTGGCTCCCAGCACAGCAGG + Intergenic
907853917 1:58282833-58282855 GAAGCGGCTGCCGACAGAGCTGG - Intronic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
909973586 1:82020258-82020280 GAATTGGTTCTCTGAAGAGCAGG + Intergenic
912041463 1:105396673-105396695 AAAGTGGCTCTCTGCAGAATGGG + Intergenic
913277875 1:117156911-117156933 GGAGTGTCTCCCTGCAGTTCAGG + Exonic
915004228 1:152622114-152622136 GTAGCAGCTTCCTGCAGAGCTGG - Intergenic
915603709 1:156938091-156938113 GAAGTGGCTGCTTGCATATCAGG + Intronic
916323288 1:163530134-163530156 ACAGTGGCTCCCTGTAGAGCTGG + Intergenic
920678459 1:208055069-208055091 GAAGGAGCTCCCTGCAGAACGGG + Intronic
922062367 1:222104704-222104726 CAAGTGGCTCCCTGTGCAGCAGG + Intergenic
922180659 1:223230568-223230590 GATGGCCCTCCCTGCAGAGCAGG + Intronic
923545077 1:234918054-234918076 CAGGTCGCTGCCTGCAGAGCAGG + Intergenic
1066265763 10:33774396-33774418 GAAGTGGCCCTCTGCAGATGGGG - Intergenic
1066272538 10:33837560-33837582 GAAGTGGCTCTCAGCAGAAGGGG - Intergenic
1067250372 10:44581477-44581499 GGAGTGTCTCCCTGCAGCTCTGG + Intergenic
1067807781 10:49405152-49405174 CCAGTGCCTCCCTGCAGTGCTGG + Intergenic
1067832340 10:49617340-49617362 GCTGTGGCTTCCTTCAGAGCAGG + Intronic
1068883214 10:62072178-62072200 GAGGTGGAGCACTGCAGAGCTGG + Intronic
1069638592 10:69940758-69940780 GCAGTGGCTGGCTGCTGAGCAGG - Intronic
1069848377 10:71389048-71389070 GAAGTGGCACCCGGCATAGTAGG - Intergenic
1070249705 10:74763385-74763407 CAAGTGGTTCCAAGCAGAGCAGG - Intergenic
1071149768 10:82620385-82620407 GAAATGGCTCTCGGCAGAGAGGG + Intronic
1071717796 10:88114612-88114634 GAAGTGGCCTCCTCCAGTGCAGG + Intergenic
1071952842 10:90724415-90724437 GAAGGGGATCCCTGCAGACTGGG + Intergenic
1072765718 10:98093728-98093750 GAAGGAGATCCCAGCAGAGCCGG - Intergenic
1073268090 10:102240602-102240624 GAAGTGGGTCTCTCCGGAGCGGG - Intronic
1074060120 10:109957626-109957648 GAAGTTGCTCATTACAGAGCAGG + Intergenic
1075074648 10:119342765-119342787 GAAGTGGCTCTTGGCAGCGCAGG + Intronic
1076370997 10:129953632-129953654 GCAGGGGCTCCATGCAGCGCTGG - Intronic
1076446203 10:130516012-130516034 GAAGCGGCTCCCCTGAGAGCAGG + Intergenic
1076502662 10:130949522-130949544 CAAGAGGCTCCCAGCACAGCCGG - Intergenic
1076697467 10:132253882-132253904 GAGGCGGGTCCCTGCAGGGCGGG - Intronic
1076711408 10:132337322-132337344 GAACTGACTTCCTGAAGAGCCGG - Intronic
1076879201 10:133231598-133231620 GGAGTGGCGCCCTGCAGTGCTGG + Intergenic
1077049477 11:560428-560450 GAGGTGGAGCCCTGCGGAGCTGG - Intronic
1078953298 11:16160350-16160372 TAAGTGGCTCTCTGCAGCTCAGG + Intronic
1079067450 11:17308200-17308222 GAAATGGCTCATTCCAGAGCTGG - Intronic
1081296347 11:41394399-41394421 GATGCGCCTCCCTGCAGAGAGGG + Intronic
1081490456 11:43564265-43564287 GAGGCTACTCCCTGCAGAGCAGG - Intronic
1081737583 11:45414790-45414812 GAAGTGGGTACCTGGGGAGCTGG - Intergenic
1083524742 11:63352210-63352232 AAAGTGGCTGACTGCAGACCAGG - Intronic
1083636463 11:64123489-64123511 CAAGTGGCTATCTGCATAGCAGG + Intronic
1085627315 11:78083353-78083375 GAAGTGGCTGCCGGGTGAGCTGG - Intergenic
1086350730 11:85941357-85941379 GAGGTGGCACCCTGCAGAAGGGG - Intergenic
1087625691 11:100593438-100593460 GAAATGGCTCCATGCACAGATGG - Intergenic
1088446615 11:109937056-109937078 GCTGTGGCTTCCTTCAGAGCAGG + Intergenic
1089213718 11:116822985-116823007 CAAGTGGCTCACAGGAGAGCTGG - Intronic
1092279064 12:7086085-7086107 GAGTTGTCTACCTGCAGAGCAGG + Intronic
1092731765 12:11541488-11541510 AAAGTGGCTGCCTGCAAACCAGG - Intergenic
1094794408 12:33954276-33954298 GAAGTGGATACCTGCAAAGACGG + Intergenic
1095581546 12:43806171-43806193 GAAGGGGCTTCCGGGAGAGCCGG - Intronic
1096581173 12:52586270-52586292 GCAGTGGCTTCCTGCTGAGATGG + Intronic
1096967846 12:55642847-55642869 GAAGTGGCTTCCAGCAGAGGAGG - Intergenic
1097746599 12:63310475-63310497 GGAGTGGCTCTCAGCAGAGAGGG + Intergenic
1098270007 12:68761003-68761025 GCAGTTGCTCCATGCAGATCAGG + Intronic
1100113500 12:91273872-91273894 GAAGTGGCTCCCAGGAAAGATGG + Intergenic
1100594561 12:96060833-96060855 AAAGTGGCTCTCTGCAGAAAGGG + Intergenic
1102904231 12:116662142-116662164 GCGGTGGCTTCCTGAAGAGCTGG + Intergenic
1102910557 12:116710604-116710626 GAAGTTGGTCCCAGCAGAGAAGG + Exonic
1103419332 12:120767575-120767597 GAAGTGGCTGCCAGTGGAGCTGG + Exonic
1103960331 12:124605446-124605468 GAGGTGACTCCCTGCAGTTCTGG + Intergenic
1104351552 12:128048350-128048372 GAATTGGGTATCTGCAGAGCTGG - Intergenic
1104833695 12:131772880-131772902 GAAGTGGCTCTCAGCAGAAAGGG + Intronic
1104969265 12:132523853-132523875 CACGTGGCTTCCTGCAGAGGTGG + Intronic
1106627377 13:31434453-31434475 GAAGTGGCTCTCAGCAGAAAGGG + Intergenic
1107037055 13:35912609-35912631 GAAGTTGCTCTCAGCAGAGAGGG - Intronic
1107261535 13:38497360-38497382 GAACTGGATGCCAGCAGAGCTGG + Intergenic
1107294394 13:38894337-38894359 GAAGTGGCTCTCAGCAGATGGGG - Intergenic
1109152426 13:58860898-58860920 GAAGTAGCTCTCAGCAGATCAGG + Intergenic
1109883035 13:68506982-68507004 AAAGTGGCTCTCGGCAGAGAGGG - Intergenic
1110582885 13:77152738-77152760 GAAGTGGCTCTCAGCAGAAGGGG - Intronic
1111607857 13:90563942-90563964 GAAGTGGCTCTCAGCAGGGAGGG - Intergenic
1111726248 13:92013269-92013291 GAAATGGCTCTCAGCAGAGAGGG + Intronic
1112011509 13:95297560-95297582 GAAGTGGCTGCCTGGAGACAGGG - Intronic
1113696629 13:112350591-112350613 GCAGTGGCTCACTGCTGTGCTGG - Intergenic
1113882431 13:113635218-113635240 CAAGGTGCTCACTGCAGAGCTGG + Intronic
1116526357 14:45910605-45910627 GAAGTGGCTCTCAGCAGAAGGGG - Intergenic
1116900974 14:50362105-50362127 TAGGTGCCTCCCTGCAGGGCAGG + Intronic
1117584296 14:57184432-57184454 GAAATTACTCCCTGCAGAGGTGG + Intergenic
1119913321 14:78371389-78371411 GAAGTGGCTCTCAGCAGAAGGGG - Intronic
1120856591 14:89217794-89217816 GAAGTGGGTCACTGCAAAGCTGG - Intronic
1122786819 14:104167804-104167826 GAGGGGGCTGGCTGCAGAGCAGG - Intronic
1122939836 14:104976315-104976337 GAGATGGCTCCCTGCTGGGCTGG + Intronic
1124089528 15:26585141-26585163 GAAGCTGCTCCCTGGAGAGGTGG - Intronic
1124089768 15:26587605-26587627 GAAGCTGCTCCCTGGAGAGGTGG - Intronic
1129332955 15:74837132-74837154 GAAGTGGCCCACTGCAGCCCTGG - Exonic
1129886771 15:79043680-79043702 GAAGTGGCTACCTGGGGAGATGG + Intronic
1131408258 15:92184310-92184332 GCAGTGGCTCCCTGCACCGCAGG - Intergenic
1132389082 15:101425727-101425749 GAAGGTGCTCCCTCCAGATCTGG - Intronic
1132930914 16:2458910-2458932 GAACTGACTCCATGCAGAGTTGG - Intergenic
1133301990 16:4788045-4788067 GAAGTGGCTCCCGTCCCAGCAGG + Intronic
1133475223 16:6114846-6114868 GATATGGCTCCTTGCAGAGGAGG + Intronic
1133695652 16:8260080-8260102 GAAGTGGCTCTCAGCAGAAAGGG - Intergenic
1134346648 16:13397912-13397934 GAAGTAGCTCTCAGCAGAGCGGG + Intergenic
1135904595 16:26499561-26499583 GATATCGCTCCTTGCAGAGCAGG - Intergenic
1136408586 16:30063986-30064008 GGCCTGGCTCCCTGCAGGGCAGG + Exonic
1136409836 16:30069818-30069840 GAAGGTGATCCCTGTAGAGCAGG - Exonic
1137801514 16:51266315-51266337 GAAGTGGCCCCCAGGAGAGGAGG + Intergenic
1138887526 16:61097595-61097617 AAAGTGTCTCCCAGCAGAACAGG + Intergenic
1138936940 16:61738077-61738099 GAAGTGGCTCTCTCAAGAGAGGG + Intronic
1139279842 16:65760919-65760941 GTCATGGCTCCATGCAGAGCAGG + Intergenic
1139433110 16:66921742-66921764 GAAGAGCCTCCCTCCAGGGCAGG + Exonic
1139477323 16:67209167-67209189 GGAGTTGCTCCCTCTAGAGCTGG + Intronic
1140040893 16:71407049-71407071 GAAGAAGCTCTCTGCAGAGGTGG - Intergenic
1140450010 16:75063277-75063299 GAAGGCACTCCCTGCAGATCAGG - Intronic
1141110796 16:81269220-81269242 GCAGTGGCTCCCTTCAGACGTGG - Intronic
1141577837 16:84976088-84976110 GCCGTGGCCTCCTGCAGAGCTGG - Intronic
1141602766 16:85136523-85136545 GAGGTGCCTCCCGGCAGAGATGG - Intergenic
1142197396 16:88745141-88745163 GCAGTGGGTCCCTGCGGAGGTGG - Intronic
1142212965 16:88817080-88817102 GATGTGGGTCCCAGCAGGGCAGG - Intronic
1142280067 16:89143371-89143393 GCAGTGGCTCCATGCTGCGCTGG + Intronic
1142646371 17:1316191-1316213 TCAGCGGCTCCCTGCACAGCGGG + Intergenic
1143785695 17:9253972-9253994 GATTTGGCTCCCTGCAGTGAGGG + Intronic
1143856672 17:9856249-9856271 GAAGTGACTTCCTACAGGGCTGG - Intronic
1144632162 17:16879774-16879796 GTAGGGGCTCCCTGCAGTGAAGG + Intergenic
1148733187 17:49850324-49850346 GGACTGCCTCCCTGCAGAGTTGG - Intergenic
1149316307 17:55442216-55442238 AAAGCTGCTCCTTGCAGAGCAGG + Intergenic
1149563872 17:57628191-57628213 GAGGAGGCTCCCTGGGGAGCTGG + Intronic
1149975437 17:61261187-61261209 GAAGTACCTCCCTGGGGAGCGGG + Intronic
1150932086 17:69596019-69596041 GAAATGGCTCTCAGCAGAGAGGG - Intergenic
1152601876 17:81266758-81266780 GCAGTGCCTTCCTGCTGAGCAGG + Intronic
1152617238 17:81343559-81343581 GAAGGGCCACCCCGCAGAGCGGG - Intergenic
1152768055 17:82151572-82151594 GAACAGGCTCCGTGCAGAGCTGG - Intronic
1152984434 18:308813-308835 GAAGTGGCTCCTTGGTCAGCTGG - Intergenic
1153343755 18:4004388-4004410 GAAGGGACTCCCCGGAGAGCAGG - Intronic
1155017865 18:21863449-21863471 GAAATGGCTCTCAGCAGAGAGGG + Intronic
1155590199 18:27419103-27419125 GAAGGAGCTCCTAGCAGAGCTGG + Intergenic
1156506494 18:37599058-37599080 GGAGTGGCTTTCTGAAGAGCTGG - Intergenic
1156760538 18:40583687-40583709 GAAGTAGCTCTCTGCAGATGGGG + Intergenic
1157533971 18:48444918-48444940 GAGGAGGCTCCCTGCAGGGGAGG - Intergenic
1158510510 18:58086353-58086375 GTAGTGGTTCCCTGCAGGGTGGG + Intronic
1159945497 18:74441711-74441733 GAGGGAGTTCCCTGCAGAGCTGG - Intronic
1160221423 18:76980593-76980615 GAAATGGCACCCCGGAGAGCTGG + Intronic
1160234265 18:77073586-77073608 ATAGTGTCTCCCTGCGGAGCAGG - Intronic
1161035119 19:2080137-2080159 GAAGGTGCACCCAGCAGAGCAGG - Intronic
1161137363 19:2627470-2627492 GCCCTGGCTCCCTTCAGAGCTGG + Intronic
1161410694 19:4115570-4115592 GAAGAGGCTGCCTGCAGTACGGG + Intronic
1162370367 19:10275137-10275159 GGAGGGGCTCCTTGCAGGGCAGG + Intronic
1162739552 19:12766230-12766252 GGAGCGTCTCCCTGCAGACCCGG + Exonic
1163833380 19:19558641-19558663 CAAATTGCTCTCTGCAGAGCAGG + Intergenic
1165150847 19:33759314-33759336 GAGGTGCCTTCCTGCAGAGCTGG + Intronic
1165706583 19:37980567-37980589 AGCGTGGCTCCCTCCAGAGCAGG + Intronic
1167655108 19:50758688-50758710 GCAGTGGCTCCTTGGAGAGTGGG + Intergenic
1168554026 19:57323148-57323170 GAAGTGGCTTTCTGCATAGGAGG + Intronic
925008939 2:467788-467810 GAAGGAGCTCCCGGCAGACCAGG + Intergenic
925258051 2:2506760-2506782 GAACTGGCTCCCATCAGAGATGG + Intergenic
925384423 2:3452261-3452283 CAGCTGGCTCCCTGCAGAGAGGG + Intronic
925449576 2:3957160-3957182 GGGGAGGCTCCCTGGAGAGCTGG - Intergenic
926706697 2:15842623-15842645 GGTGTGGGTCCCTGCAGAGTGGG - Intergenic
927976624 2:27343335-27343357 GAGGAGGCTCCCTCCAGAGCAGG - Exonic
928875856 2:36038500-36038522 GAAGTGGCTAACTCTAGAGCAGG - Intergenic
928996975 2:37303218-37303240 GAAATGGCTCTCAGCAGAGTGGG - Intronic
930111161 2:47680040-47680062 AAAGTGACTGCCTACAGAGCTGG + Intergenic
930526207 2:52533504-52533526 GAAGTGGCTCATTCCAGGGCTGG + Intergenic
931479095 2:62621927-62621949 TAAGCTGCTCTCTGCAGAGCCGG + Intergenic
932126328 2:69148349-69148371 GAGGTGACACTCTGCAGAGCAGG - Intronic
932598818 2:73110746-73110768 GAAGCTGCTCCCTGCAGGCCTGG + Intronic
932824518 2:74927237-74927259 GAAGAGGAGCCCTGCGGAGCTGG - Intergenic
933178873 2:79207671-79207693 GAAGTGGCTCCCTGCAGAGCTGG + Intronic
933317943 2:80737403-80737425 TCAGTGGCTCTCTTCAGAGCTGG - Intergenic
933979892 2:87540813-87540835 GATGTGGCTCCCCACAGACCAGG + Intergenic
934557813 2:95296731-95296753 GCAGTGGCTCCCTGCTGTCCTGG + Intergenic
935447095 2:103168210-103168232 CAAGTGGCTCCTGGCAGGGCGGG - Intergenic
935641725 2:105297297-105297319 AAAGTGACTCCAGGCAGAGCAGG - Intronic
936018433 2:108976887-108976909 GAAGTGGCTGACTCCAGAGCTGG - Intronic
936313928 2:111409978-111410000 GATGTGGCTCCCCACAGACCAGG - Intergenic
937695737 2:124806482-124806504 GGAGTGGGTCTCTGTAGAGCTGG + Intronic
938211528 2:129469538-129469560 TGAGTGCCTCCCTGCACAGCTGG - Intergenic
938662571 2:133502883-133502905 GAGGTGGCTCCCTGCAGAGGAGG + Intronic
938946180 2:136213966-136213988 GCAGTGGCTGCCTGGAGTGCTGG + Intergenic
939060793 2:137419455-137419477 GAAATAGCTCTCTGCAGAGATGG + Intronic
939229629 2:139409653-139409675 GAAGAGGCCCCGTGCTGAGCAGG + Intergenic
940599897 2:155845481-155845503 GAAGTAGCTCTCAGCAGAGAGGG - Intergenic
940622896 2:156135115-156135137 CAAGTGGCTCCCAGGAGAGAAGG - Intergenic
942482913 2:176407936-176407958 CAAGTGACTCCCTGCTGAACAGG - Intergenic
944327731 2:198426558-198426580 GAACAGGCTACCTGCAGAGTGGG - Intronic
946024462 2:216663745-216663767 GCAGTAGGTCCCTGGAGAGCTGG - Intronic
946551907 2:220810911-220810933 CAACTGGCTTCCTCCAGAGCAGG + Intergenic
948272776 2:236687035-236687057 AAACTGGCTCCCAGCAGAGCTGG + Intergenic
948836538 2:240628757-240628779 GCAGTGGCTTCCTGCTGGGCTGG - Intronic
948901412 2:240958545-240958567 GGGATGGCTCCCTCCAGAGCTGG - Intronic
948940109 2:241191206-241191228 CAAGCGGCCGCCTGCAGAGCTGG + Exonic
1168758135 20:329957-329979 GAAGTGGCTCTCTGCAGCTGCGG - Exonic
1169362252 20:4960987-4961009 AAAGTGGCTGCCTCCAGAGATGG + Intronic
1171145687 20:22780139-22780161 GGAGTGTCTCCCTGCAGCCCAGG + Intergenic
1171459821 20:25292204-25292226 GAAGGGGAGCCCTGCAGAGGCGG + Intronic
1172931316 20:38588286-38588308 TGAGCGGCTCCCTGCAGGGCTGG - Exonic
1173827287 20:46056104-46056126 GTGGTGACTCCCAGCAGAGCTGG + Intronic
1173873427 20:46355561-46355583 GATGAGGGTCCCAGCAGAGCTGG - Intronic
1174122150 20:48273990-48274012 ACAGTATCTCCCTGCAGAGCTGG - Intergenic
1174388688 20:50203293-50203315 GAAGTGGCTGATTCCAGAGCTGG - Intergenic
1174558473 20:51413040-51413062 GAGCTGGCTGCCTGGAGAGCAGG - Intronic
1175874450 20:62222760-62222782 GACTTGCCTCCCTGCAGTGCTGG + Intergenic
1175974509 20:62703756-62703778 GACATGGCTCCGTGGAGAGCTGG - Intergenic
1176143568 20:63555500-63555522 GAAGAGGCTGCCTGGAGGGCTGG - Exonic
1177386949 21:20421081-20421103 TAATTGACTCCCTGCAGGGCTGG + Intergenic
1178974629 21:37210241-37210263 GGTGCTGCTCCCTGCAGAGCAGG + Intergenic
1179129784 21:38624533-38624555 GGGGTGTCTCCCAGCAGAGCTGG - Intronic
1179826272 21:43968206-43968228 GCAGGGGGTCCCTGCAGGGCTGG + Intronic
1179990849 21:44947641-44947663 GATGTGGCTTCCTGGCGAGCTGG - Intronic
1180839601 22:18953121-18953143 GAGGTGGCTCCCAGCAGATAGGG + Intergenic
1181003869 22:20000324-20000346 GAGCTGGCTCCCAGCAGAGGAGG - Intronic
1181062303 22:20287358-20287380 GAGGTGGCTCCCAGCAGATAGGG - Intergenic
1181637200 22:24180018-24180040 GAAGTTGCTCCCTACAGCACTGG - Intergenic
1182003070 22:26936775-26936797 GATTTGGCTCCCTGCACATCTGG + Intergenic
1182947046 22:34333646-34333668 GAGGTGGCCCCCTGCAGAAGGGG + Intergenic
1183270682 22:36860878-36860900 GAAGTGGATTCCTGCAAACCTGG + Intergenic
1183302697 22:37066056-37066078 GAACTGCCCCCCTGCAAAGCAGG - Exonic
1183661631 22:39224885-39224907 GAGGTGCCTCCCCTCAGAGCTGG + Exonic
1183738279 22:39655886-39655908 GCAGTGGCTCCCTGCATCCCTGG + Intronic
1184922312 22:47614203-47614225 GAATTAGCTCCCTGCAGGCCTGG - Intergenic
1185006984 22:48285098-48285120 GGTGTTGCTCCCTGCAGAGCAGG - Intergenic
1185238321 22:49727303-49727325 CAAGAGGCTCCTGGCAGAGCTGG - Intergenic
949227403 3:1711156-1711178 AAAGTGGCTCTCAGCAGAGAGGG + Intergenic
949675432 3:6447902-6447924 AAAGTGGCTCTCAGCAGAGAGGG + Intergenic
950267181 3:11582836-11582858 GAAGTTGCTTCCTACAGTGCAGG - Intronic
950479377 3:13235237-13235259 ACAGTGGCTCCCTGGAGAGCTGG - Intergenic
951651374 3:24955156-24955178 GAAGTGGCTCTCAGCAGAAGGGG + Intergenic
951692460 3:25410861-25410883 CAAGTGGCTCTCTGCAGAGCAGG - Intronic
952697801 3:36290298-36290320 GAAATGGCTACCTCTAGAGCTGG - Intergenic
952853863 3:37751689-37751711 GAAGTGGTTTCCTGAAGACCTGG + Intronic
953357048 3:42264898-42264920 GAAGTGGCTCCTGGGAGAGAGGG + Exonic
955888469 3:63625478-63625500 GAAAGGGCTTCCTGCAGTGCAGG + Intergenic
956863674 3:73348942-73348964 GCAGTGGCTCCCTGGTGGGCTGG + Intergenic
961466386 3:127084490-127084512 GATGGGGCTTCCTGCAGAGCCGG + Intergenic
961565688 3:127761775-127761797 GGAGTCCCTCCCTGAAGAGCTGG - Intronic
961617363 3:128193365-128193387 GGTGTTGCTCTCTGCAGAGCAGG + Intronic
962119616 3:132548091-132548113 GAAATGGCTCTCAGCAGAGAGGG - Intergenic
962474361 3:135742380-135742402 GAAATGGCTCTCAGCAGAGAGGG - Intergenic
962812600 3:138972260-138972282 GAGGTGGCTCCCAGCAGGGCAGG + Intergenic
964300223 3:155278514-155278536 GAAGTGGCTGCCGGGAGAGTTGG + Intergenic
964920540 3:161890752-161890774 AAAGTGGCTCTCAGCAGAGAGGG + Intergenic
965039700 3:163490567-163490589 GAAATGGCTCTCAGCAGAGAGGG + Intergenic
965604602 3:170485787-170485809 GGCGAGGCTCCCTGCACAGCGGG - Intronic
966958428 3:184908769-184908791 GAAATGGCTTTCTGCAGAGAGGG + Intronic
966977369 3:185096855-185096877 GAAGCGGCCCTCTGCAGTGCAGG - Intronic
971427325 4:26529493-26529515 GAAGTGGCTCTCAGCAGAAGGGG + Intergenic
971959822 4:33471341-33471363 GAAATGGCTCTCAGCAGAGAGGG + Intergenic
972418435 4:38865061-38865083 AAAATGGCTACCTGCAGAGATGG + Intergenic
972698601 4:41472294-41472316 GAACTGGCTTTCTGCAGAGTTGG - Intronic
977042021 4:92028033-92028055 GGAGTGGCTCCCGGGCGAGCTGG - Intergenic
977220477 4:94332217-94332239 GAAATGGCTCTCAGCAGAGAGGG - Intronic
977306299 4:95327790-95327812 GAAGTGGCTCTCAGCAGAAGGGG - Intronic
978522789 4:109634185-109634207 GAAGTGTCTCCATGCAGGCCAGG + Intronic
979441431 4:120754755-120754777 GAAGTGGCTCCAGGCACAGCAGG + Intronic
979883851 4:125998617-125998639 GCAGTGGCTCACTGCAGCGGAGG + Intergenic
980035431 4:127878032-127878054 GAAATGGCTCCTTTCAGTGCTGG + Intergenic
981043748 4:140247189-140247211 GAAGTGCCTCCCTTAAGACCTGG + Intergenic
982316340 4:154035881-154035903 TGAGTGGGTCCCTGCAGGGCAGG - Intergenic
983286947 4:165751915-165751937 GAAGAGGGGCTCTGCAGAGCTGG + Intergenic
983697866 4:170554616-170554638 AAAGTGGCTCTCAGCAGAGAGGG + Intergenic
984271900 4:177557734-177557756 GAAGTAGCTCTCTGCAGATGGGG - Intergenic
984885676 4:184447137-184447159 GAAATGGCTGACTCCAGAGCTGG + Intronic
985543688 5:498813-498835 GGTGTGTCTCCCTGCTGAGCTGG + Intronic
985994945 5:3592607-3592629 GAAGTTGCTCCTGGCGGAGCTGG - Intergenic
990683864 5:58278016-58278038 AAAGTGGCTCTCAGCAGAGAGGG - Intergenic
992205930 5:74430272-74430294 GAAGTGGCTCTCAGTAGAGAGGG - Intergenic
994884990 5:105549058-105549080 GAAGTAGCTCTCTGCAGATGGGG + Intergenic
995206637 5:109487982-109488004 CAGCTGCCTCCCTGCAGAGCAGG - Intergenic
996286900 5:121804586-121804608 GAACTGGCAACCTACAGAGCGGG - Intergenic
996910994 5:128656469-128656491 GAATTGGCTCACTGCTCAGCAGG + Intronic
997647211 5:135489433-135489455 GAAGTGGCTCCCAGGGGAACAGG - Intergenic
998376138 5:141692191-141692213 GAAGAGGCTGCCGCCAGAGCGGG + Intergenic
1002574085 5:180161710-180161732 GAGGGGGCTCCCGGCAGAGATGG - Intronic
1002916264 6:1530251-1530273 TAAGTGGATGACTGCAGAGCTGG + Intergenic
1002961835 6:1922803-1922825 GAAATGGCTCTCAGCAGAGACGG - Intronic
1003167367 6:3692514-3692536 GAAGTGGCTGATTCCAGAGCTGG + Intergenic
1003171435 6:3724630-3724652 GAGGTGGCTCCCAGGAGGGCGGG - Intronic
1003497675 6:6678639-6678661 GAAGTGACTCCCGGAAGACCTGG - Intergenic
1005126692 6:22454326-22454348 GAAGAAACTCCCTGCAGTGCAGG + Intergenic
1006208935 6:32376063-32376085 GAAGTGGCTCTCAGCAGATGGGG - Intergenic
1007300957 6:40867542-40867564 GAAGTGGCTGCCGGGAGAGCTGG + Intergenic
1007704816 6:43784136-43784158 GAAGAGGCTCCCTGCTGAGGAGG - Intronic
1010732366 6:79404600-79404622 AAAGTGGCTCTCAGCAGAGAGGG - Intergenic
1011180868 6:84618934-84618956 CCAGTGACTCCCTGCAGAGAAGG + Intergenic
1013692935 6:112667373-112667395 GCAGTGGCACCCAGAAGAGCAGG - Intergenic
1013698094 6:112728720-112728742 TAAATTGCTTCCTGCAGAGCTGG + Intergenic
1014107409 6:117582680-117582702 AAAGTGGCTCTCAGCAGAGAGGG - Intronic
1014165773 6:118222919-118222941 GAAGTGGCTGATTGCAGATCTGG - Intronic
1014492754 6:122082450-122082472 GAAGTAGCTCTCTGCTGAGGGGG + Intergenic
1015250919 6:131126845-131126867 TAAGTGGCTGCCTGCATATCAGG + Intergenic
1017884976 6:158591379-158591401 GACGTGGCTCCCGAGAGAGCCGG - Intronic
1018654770 6:166024750-166024772 GAAATGGCTCTCAGCAGAGAGGG + Intergenic
1018831082 6:167444098-167444120 GAAGTGGCTCTCAGCAGAAGGGG + Intergenic
1018854808 6:167667681-167667703 GGAGTGGCTCACGGCAGACCTGG - Intergenic
1019359275 7:596396-596418 GAAGAGGGTCCCCGCAGGGCGGG + Intronic
1022957893 7:35398402-35398424 GAAGGGGCCACCTGCAGAGGTGG - Intergenic
1023144099 7:37132188-37132210 GCACTGGCTCCCTGGAGACCTGG - Intronic
1023745439 7:43318778-43318800 AAAAGGGCTCTCTGCAGAGCTGG + Intronic
1024063225 7:45714087-45714109 CAAGTGGCTCCCTGCTCTGCTGG - Exonic
1026201607 7:68219351-68219373 AAAGTGGCTCCATGCAGCGAAGG + Intergenic
1026339610 7:69424138-69424160 GAAGTGGCTGCCTGGGGTGCTGG + Intergenic
1027932287 7:84552797-84552819 GAAGTAGCTCTCAGCAGATCCGG - Intergenic
1028920535 7:96305908-96305930 AAAGGGGCTCTCTGCACAGCTGG + Intronic
1029223107 7:99005818-99005840 GGAGTGGGCCCCTGGAGAGCTGG + Intronic
1029235357 7:99111830-99111852 CTAGTGGCTCCCTGAAGAACTGG + Intronic
1030101798 7:105953219-105953241 GAAGTAGCTCTCTGCAGATGGGG - Intronic
1030616629 7:111744188-111744210 CAAGTGGCTCTCTGCAGTGGAGG + Intronic
1031668121 7:124510726-124510748 GGAGCTGCTCCATGCAGAGCAGG + Intergenic
1032434609 7:131889759-131889781 GAGGTAGCTCCCTGCAGCGTGGG + Intergenic
1032444423 7:131969572-131969594 GAAGAGGCGACCTGCACAGCCGG + Intergenic
1033242439 7:139691196-139691218 TATGTGGCTAGCTGCAGAGCTGG + Intronic
1034415017 7:150959726-150959748 GAAGCAGCTCCCTGCAGAGTGGG + Exonic
1034427282 7:151020697-151020719 GCAGTGGCTTCCTGCAATGCGGG + Intronic
1034467078 7:151236142-151236164 GTGATGGCTCCTTGCAGAGCAGG + Intronic
1035394458 7:158526138-158526160 GATGTGGCTCCCCCCAGAGCGGG - Intronic
1035546180 8:483838-483860 GCAGGGGCTGCATGCAGAGCTGG + Intergenic
1035739541 8:1915764-1915786 GAAGTGGTTCCATGCAAAGAGGG + Intronic
1036097608 8:5741314-5741336 CAAGGGGCTCCATGCAGTGCTGG + Intergenic
1036560105 8:9894430-9894452 AAAGTGGCTCCAGGCAAAGCTGG - Intergenic
1037331544 8:17748317-17748339 AAAGTGGCTCTCAGCAGAGAGGG - Intronic
1038448998 8:27626883-27626905 GGGATGGCTCCTTGCAGAGCAGG - Intergenic
1038490939 8:27970618-27970640 GGTGCTGCTCCCTGCAGAGCAGG - Intronic
1042691026 8:71499005-71499027 GAATTGGCTCCTGCCAGAGCTGG - Intronic
1042923699 8:73944948-73944970 TAAGCTGCTCCTTGCAGAGCAGG - Intronic
1043688701 8:83123226-83123248 GAAGTGGAGCCCTGCAGGGAAGG + Intergenic
1044730832 8:95227312-95227334 CAAGTGGCTGCCTGCACTGCTGG + Intergenic
1046552083 8:115730608-115730630 GAAGGGGCTGCCTGCTGAGATGG - Intronic
1046990808 8:120451034-120451056 GAAGTGGTTCTTTGCAGTGCAGG + Exonic
1047100176 8:121667597-121667619 TAAGTGCCTCCGTGCAGGGCAGG - Intergenic
1047765487 8:127986663-127986685 GAAGTGACCCCCTGCTGAGCAGG + Intergenic
1047768348 8:128008805-128008827 GAAGGGGCTCCCTGCAGGTTGGG + Intergenic
1048384136 8:133895440-133895462 CATGTGGCTCCCAGCAGGGCTGG + Intergenic
1048641690 8:136370227-136370249 GAAATGGCTCTCAGCAGAGAGGG + Intergenic
1049206716 8:141367010-141367032 GAAATGGCTCCCTGTCCAGCAGG + Intronic
1049342134 8:142118843-142118865 GCTGCAGCTCCCTGCAGAGCCGG - Intergenic
1049469875 8:142770563-142770585 GAAGGGACACCCTGGAGAGCGGG + Intronic
1049513107 8:143039616-143039638 GAGGGGGCTGCCTGCAGGGCGGG + Intronic
1049513300 8:143040564-143040586 GATGTGGCTCCCGGCATGGCAGG + Intronic
1051440984 9:17082575-17082597 GAAGCTGCACGCTGCAGAGCAGG - Intergenic
1052047629 9:23812891-23812913 GAAGTGGCTGCCAGGAGAGCAGG + Intronic
1056429832 9:86516378-86516400 GAAATGGCTCTCAGCAGAGAGGG - Intergenic
1056758581 9:89398410-89398432 GAAGTGGCTCTCAGCGGAGATGG - Intronic
1058311929 9:103514827-103514849 GAAGTGGCTCACAGCAGATGGGG + Intergenic
1058730663 9:107846897-107846919 GAGGTGGCCACCTGAAGAGCAGG + Intergenic
1058838067 9:108877164-108877186 GAAGTGGGGCCCTGTAGAGCTGG - Intronic
1059205757 9:112463547-112463569 AAAATTGCTCCTTGCAGAGCAGG + Intronic
1060489042 9:124068476-124068498 GCAGTGCCTCCCAGTAGAGCAGG + Intergenic
1060811210 9:126612515-126612537 GAAGTGGCCCCCTGCGCCGCGGG - Intergenic
1061012555 9:127964077-127964099 GAAGAGCCTCCCTGGAAAGCCGG + Intronic
1061014108 9:127972105-127972127 GAAGAGGCCCTCTGCACAGCCGG - Intronic
1061224555 9:129273213-129273235 GGAACTGCTCCCTGCAGAGCAGG - Intergenic
1061872131 9:133526781-133526803 GAAGTGCCTCCCTGCAGGGGAGG - Intronic
1062102882 9:134737699-134737721 GGAGCGGCTCCCTGCAGGACGGG - Intronic
1062137480 9:134937360-134937382 GCCTTGGGTCCCTGCAGAGCTGG + Intergenic
1062321355 9:135991995-135992017 GAAGAGGCTCCCTGCTGGGGCGG + Intergenic
1062355909 9:136162190-136162212 GAGGGGGCTCCCTGGAGGGCTGG - Intergenic
1185950102 X:4423026-4423048 GAAGTGGCTCTCAGCAGAAGGGG + Intergenic
1185975401 X:4714235-4714257 GAAGTGGCTCTCAGCAGAAGGGG - Intergenic
1188133194 X:26463311-26463333 GAAGTGTCTCCCAGTAGAACAGG + Intergenic
1192582453 X:72295915-72295937 TCAGTGGCTCCCTCCAGAACTGG - Intronic
1200938614 Y:8760006-8760028 GATTTGGTTCCCAGCAGAGCAGG - Intergenic
1201937156 Y:19421343-19421365 GGAGTGGCTGCCTGGTGAGCTGG - Intergenic