ID: 933184598

View in Genome Browser
Species Human (GRCh38)
Location 2:79264966-79264988
Sequence CTGTACAGAAGCAGAGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 378}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933184598_933184602 12 Left 933184598 2:79264966-79264988 CCATCTGCTCTGCTTCTGTACAG 0: 1
1: 0
2: 1
3: 35
4: 378
Right 933184602 2:79265001-79265023 ATTTTTCATTAGCTTTTTAGAGG 0: 1
1: 0
2: 3
3: 70
4: 654

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933184598 Original CRISPR CTGTACAGAAGCAGAGCAGA TGG (reversed) Intronic
900376441 1:2356977-2356999 CCGTGCAGAAGCGGAGCAGCGGG + Intronic
901480330 1:9520625-9520647 CTGTGCAGACGCAGCCCAGAAGG - Intergenic
902308261 1:15560271-15560293 CTTTACAGAAGCACAGAATATGG + Intronic
904263697 1:29305653-29305675 CTTTAGAGAAGCAAAGCAAAGGG + Intronic
904310878 1:29628801-29628823 CAGTGCAGAACTAGAGCAGAAGG + Intergenic
904497587 1:30895812-30895834 CTCTAGGGAAGCAGAGCAGGGGG + Intronic
904722835 1:32523541-32523563 CCCTCCAGAAGCAGAGCGGAGGG + Intronic
905222981 1:36461655-36461677 CTGCATAGGAGCTGAGCAGAGGG + Intronic
905404625 1:37724544-37724566 AGGAACAGAAGGAGAGCAGAGGG + Intronic
906777990 1:48547324-48547346 CTGTACAGAGGCAGTAGAGATGG + Intronic
907914186 1:58853474-58853496 CTGTGCAGGAGCAGAGGAGCAGG + Intergenic
909251922 1:73368822-73368844 ATGTAGAGAGGCAGAGAAGAAGG - Intergenic
909607006 1:77517791-77517813 CTATACTGAAGGAAAGCAGAAGG + Intronic
911903603 1:103536919-103536941 CTTTCCAAAAGTAGAGCAGAGGG + Intronic
912411416 1:109483320-109483342 CTGCCCTGATGCAGAGCAGAGGG - Intergenic
913391085 1:118313127-118313149 CTGTACAAGAGCAGCACAGAGGG - Intergenic
914249173 1:145907675-145907697 CTGTACATCAGCATGGCAGAGGG - Intronic
914967269 1:152271175-152271197 CTCTTCAGAAGCTGAACAGATGG - Intergenic
914969099 1:152290938-152290960 CTCTTCAGAAGCTGAACAGATGG + Intergenic
915459460 1:156061168-156061190 CTGTAAGGAAGCAGAGAGGACGG - Exonic
916844011 1:168630015-168630037 CTGAACAGAAGCACTGAAGAGGG + Intergenic
917048132 1:170886407-170886429 CTGTATAAAAGCAGAGTGGAGGG + Intergenic
917205182 1:172564166-172564188 CTCTACAAGAGCAGTGCAGAGGG + Intronic
917313889 1:173704864-173704886 AGGGACAGAAGCAGGGCAGAGGG + Intergenic
917510368 1:175664331-175664353 GTGTCCAGGAGCAGAGTAGAGGG + Intronic
917635181 1:176929045-176929067 CTGTACAGAAGCAAATGAAAAGG + Intronic
917665347 1:177220531-177220553 CTCTCTAGAAGTAGAGCAGATGG + Intronic
919479858 1:198074944-198074966 CTGTAGAGAAGGAGTGCTGATGG + Intergenic
919745700 1:201008087-201008109 CTGGACACAATCAGAGCAGCAGG + Intronic
919868907 1:201805454-201805476 CTGTGCAGAAGAGAAGCAGAGGG + Intronic
920076946 1:203344152-203344174 CTGTGTACAAGCAGAGCAGTGGG + Intronic
921046309 1:211480189-211480211 CAGTACAGAATCAGAGCTGGGGG + Intronic
921465215 1:215478649-215478671 CTCCCCAGAAGCTGAGCAGATGG - Intergenic
921498512 1:215870552-215870574 CTGTACAGAATCCCAGCAGTGGG - Intronic
921704335 1:218304421-218304443 CTGTACAGAAGCAGAAGGGGAGG - Intronic
922763099 1:228144553-228144575 CTGCACAGCCGCAGAGCAGGTGG + Intronic
923994989 1:239484195-239484217 CTCACCAGAAGCTGAGCAGATGG - Intronic
924143727 1:241052263-241052285 CATTACAGAAGCCCAGCAGAAGG + Intronic
1063037557 10:2302057-2302079 CTGCACAGAAGGAAAGCAAAGGG + Intergenic
1064316582 10:14263284-14263306 CTGCACAGAAACAGGGCATATGG + Intronic
1065338570 10:24680496-24680518 CTTTACACAAACAGAGAAGATGG + Intronic
1071672188 10:87618989-87619011 GTGTACAGAGGCACAGCAGCCGG - Intergenic
1071921452 10:90355495-90355517 CTGTAAAGGAGCAGACAAGATGG - Intergenic
1072546662 10:96445308-96445330 CTGTTCAGAAGCAGTGCTGGAGG - Intronic
1073829912 10:107371893-107371915 CAGAACAAAAGAAGAGCAGATGG - Intergenic
1073900792 10:108218008-108218030 CTTTGCAGGAGAAGAGCAGAGGG + Intergenic
1074375498 10:112937936-112937958 CTTTCCAGTAGCAAAGCAGAAGG - Intergenic
1074592522 10:114826632-114826654 CTTTAGAGAGGCAGAGAAGATGG + Intronic
1074881880 10:117666037-117666059 CTCCCCAGAAGCAGAGCAGATGG - Intergenic
1076437048 10:130453686-130453708 CTCAGCGGAAGCAGAGCAGAGGG - Intergenic
1078246870 11:9581581-9581603 CTTTAAAGAAGCAGAGTTGAAGG + Exonic
1079346494 11:19657089-19657111 CTCTACAGATTCAGAGCTGAGGG + Intronic
1079743636 11:24097281-24097303 TTATACAGAGGCAGAGGAGAGGG + Intergenic
1081455945 11:43222927-43222949 CTGTAAGGAAGGAAAGCAGATGG + Intergenic
1082139313 11:48589483-48589505 CTGTACAGAAGAAGAGTTAAAGG - Intergenic
1082142576 11:48627269-48627291 CTGTACAGAAGAAGAGTTAAAGG - Intergenic
1082569780 11:54724637-54724659 CTGTACAGAAGAAGAGTTAAAGG - Intergenic
1082613007 11:55325489-55325511 CTGTACAGAAGAAGAGTTAAAGG - Intergenic
1083367025 11:62147565-62147587 GTGCACAGAAGTAGAGCACAAGG + Intronic
1084750977 11:71204402-71204424 CTTTACAGAGGCAGCGCAGATGG - Intronic
1085758442 11:79221077-79221099 CTGGACAGAATCAGACCAGGTGG + Intronic
1086129088 11:83382643-83382665 TTGTATAGAGGCAGTGCAGAGGG - Intergenic
1086852884 11:91831819-91831841 CAGCACAGAAGCAAAGTAGAGGG - Intergenic
1087750817 11:102005284-102005306 CTCCCCAGAAGCTGAGCAGATGG - Intergenic
1089082293 11:115787048-115787070 CTGGACTGAGGCACAGCAGATGG + Intergenic
1089730419 11:120515512-120515534 CCATACAGAGGGAGAGCAGAAGG - Intronic
1090292264 11:125555629-125555651 CTGTAAAGGAGCAGACAAGATGG - Intergenic
1090426248 11:126608731-126608753 CTGTCCAGAGGCAGAGCATTGGG + Intronic
1090712801 11:129403111-129403133 CTGTAAAGCAGCAGAGCCGCAGG - Intronic
1091057973 11:132436613-132436635 CAGTTCTGAAGCAGAGCTGATGG - Intronic
1091113725 11:132994652-132994674 CTGAACTGAAACAGTGCAGAAGG - Intronic
1091152386 11:133341007-133341029 CTGTGAAGAAGAAGAGAAGAAGG - Intronic
1091844022 12:3641448-3641470 CTGCAGAGCAGCAGAGGAGAGGG - Intronic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1092935559 12:13360337-13360359 CTATACAAAAGCACAGAAGAGGG - Intergenic
1093396926 12:18693970-18693992 CTGTACAGAAGCTGGTCTGATGG + Intronic
1093927477 12:24923350-24923372 CTGTGCAGAAGCAGAGGACGGGG + Intronic
1094087190 12:26607165-26607187 CAGTACAGATGGTGAGCAGAAGG - Intronic
1094188800 12:27675454-27675476 TTTTACAGAAGCAGAGAAAAGGG - Intronic
1094491821 12:30965483-30965505 CTCCACAGAAGCAGGACAGATGG - Intronic
1095440537 12:42235204-42235226 CTGGATAGCTGCAGAGCAGAAGG - Intronic
1098131440 12:67354648-67354670 CTGGAAAGAGGCAGAGCTGAGGG + Intergenic
1098228243 12:68346792-68346814 CTGTACTGAGGCATAGCAGAGGG - Intergenic
1098454010 12:70652053-70652075 CTGGACAGATTCAGAGCTGAAGG + Intronic
1098705340 12:73681238-73681260 TTAAACAGAAGCACAGCAGAAGG - Intergenic
1098845268 12:75527189-75527211 CTGTAAGGCAACAGAGCAGATGG - Intergenic
1101715466 12:107308400-107308422 CTTTAAAGAAGCAGAGCAAAGGG + Intergenic
1102234785 12:111287503-111287525 TTGTACAAAGGCAGTGCAGATGG + Intronic
1102415596 12:112759817-112759839 CTGTGCTGGAGCAGAGCAGAAGG - Intronic
1104151365 12:126087088-126087110 CTCTCCAGAACCTGAGCAGATGG - Intergenic
1104770253 12:131357129-131357151 ATGTACAGGAGCAGTGCAGGAGG - Intergenic
1105074135 12:133260502-133260524 CTGTACAATAGCAGAACAGAGGG - Intergenic
1105263518 13:18797170-18797192 CAGTACAGAAGGAGAGTATAGGG - Intergenic
1106003726 13:25749468-25749490 CTGGAGAAAAGCAGAGCAGTGGG + Intronic
1106474661 13:30088438-30088460 CTCCCCAGAAGCTGAGCAGATGG - Intergenic
1107013259 13:35688563-35688585 CTGTAAAGGAGCAGACAAGATGG - Intergenic
1107429046 13:40322339-40322361 CTGTACACAAGCAGCACAGCAGG - Intergenic
1109056061 13:57550733-57550755 AAGTACAGAAGAAGAGAAGAGGG + Intergenic
1109555320 13:63966852-63966874 CTCTACTGAAACAAAGCAGAAGG + Intergenic
1112334440 13:98502264-98502286 CTGGCCCGAAGCAGAGCAGCTGG + Intronic
1112727311 13:102319352-102319374 CTGTATCTAAGCAGAGCAGGGGG - Intronic
1112917357 13:104567941-104567963 ATGGACAGAAGCGGAGCAGGAGG + Intergenic
1113353379 13:109552466-109552488 CTCCATAGAAGCTGAGCAGAAGG + Intergenic
1113545743 13:111148059-111148081 CACTACAGAAGCATGGCAGAGGG - Intronic
1113581243 13:111431038-111431060 CTGAACAGAACCAGAGAGGAAGG - Intergenic
1114376103 14:22148329-22148351 CTGTTTAGAAACAGAGCAGAAGG - Intergenic
1114376194 14:22148982-22149004 CTGTGTAGAAACAAAGCAGAAGG + Intergenic
1115343165 14:32314021-32314043 CCGTAGAGAAGTAGAGCACAGGG - Intergenic
1117010125 14:51462497-51462519 CTGCACAGAAGCCCAGAAGAAGG - Intergenic
1119020768 14:71110812-71110834 GTGGAGAGAAGCAGAGCACATGG - Exonic
1119032974 14:71206882-71206904 CTGAACAGAACCAGAGCTGCTGG + Intergenic
1119475747 14:74926667-74926689 TGGAAAAGAAGCAGAGCAGAGGG - Intergenic
1119609418 14:76048985-76049007 AAGAACAGAAGCAGAGAAGATGG + Intronic
1120220201 14:81723015-81723037 CTTATCAGAAGCAAAGCAGATGG + Intergenic
1120425457 14:84341701-84341723 CTGTACAGAGACAGAGCCGGGGG - Intergenic
1120978661 14:90272278-90272300 CTGTACAGAAGCTGGTCTGATGG + Exonic
1121083064 14:91124295-91124317 CTGTCAAGGAGCTGAGCAGATGG + Intronic
1121798538 14:96754987-96755009 CTAAGCAGATGCAGAGCAGATGG + Intergenic
1122015379 14:98790732-98790754 CTGTAGAGAAGCAAAGAACATGG + Intergenic
1122882940 14:104698146-104698168 CTTTCCAGATGGAGAGCAGAGGG + Intronic
1123899458 15:24862280-24862302 CTGTCCAGAAGAACAGAAGAGGG + Intronic
1123962610 15:25421292-25421314 CTCCCCAGAAGCTGAGCAGATGG + Intronic
1126769446 15:52040448-52040470 CTGAGAAGCAGCAGAGCAGAAGG + Intronic
1126887383 15:53165306-53165328 CTGTGCAGGAGAAAAGCAGAGGG - Intergenic
1126912936 15:53434260-53434282 GTGTACAGAATCAGAGCTGGGGG - Intergenic
1127376319 15:58388338-58388360 CTGTAGAGAAACAGAGCAGTAGG - Intronic
1127903065 15:63355279-63355301 CTGTATAGGAGCACAGAAGAGGG - Intronic
1128815410 15:70604666-70604688 GTACACACAAGCAGAGCAGAGGG + Intergenic
1129253269 15:74320174-74320196 CTGTTCAGAAGCAGAGCTTCCGG + Intronic
1129314475 15:74732914-74732936 AGGTACAGAAGCAGACCAGTGGG - Intergenic
1129442492 15:75591880-75591902 CTGTGCAGCAGCAGAGAGGAGGG + Intergenic
1130438416 15:83925889-83925911 CTGTACAGGAGCAAGGCACAGGG + Intronic
1130720019 15:86377371-86377393 CAGCACAGAATCAGAGCAGAGGG + Intronic
1130846901 15:87756032-87756054 GTGAAGAAAAGCAGAGCAGATGG + Intergenic
1131016729 15:89063899-89063921 CTGCACAGCTGCACAGCAGAAGG - Intergenic
1131651971 15:94409932-94409954 CTGGAGAGAGGCAGAGTAGAGGG - Intronic
1132169863 15:99639415-99639437 CTGTATTGAATGAGAGCAGATGG - Intronic
1132361592 15:101220611-101220633 CTCTCCATGAGCAGAGCAGAGGG + Intronic
1134856553 16:17524737-17524759 CTCTTCAGAAGAAGAGCAGGTGG - Intergenic
1137244626 16:46692504-46692526 CTGTATAGAAGCAGTGAACATGG + Exonic
1137705609 16:50533770-50533792 CTGGACAGTAGCAGTGCTGAGGG + Intergenic
1137780278 16:51092411-51092433 CTGCACAGAACAACAGCAGAGGG + Intergenic
1137869417 16:51935191-51935213 GTCAACAGAAGCAGAGCAAAGGG - Intergenic
1138331890 16:56221950-56221972 CTGCATAGAAGCAGAGCACTGGG - Intronic
1139061220 16:63254117-63254139 CTCCACAGAAGCAGAAGAGAAGG - Intergenic
1139082456 16:63539640-63539662 TTGAACAGATGCAGAGCAGAGGG + Intergenic
1139222877 16:65202447-65202469 CTTTATAGAAGCCGAGTAGAAGG + Intergenic
1139612738 16:68070439-68070461 ATGTACAGAGACAGAGCAGGGGG + Intronic
1140309835 16:73838670-73838692 CTGTACAGAAAGGAAGCAGAAGG + Intergenic
1140751299 16:78026446-78026468 CTGTGCAGAAGCAGGTAAGAGGG + Intronic
1141046817 16:80722963-80722985 ATTTCCACAAGCAGAGCAGAAGG + Intronic
1141055567 16:80810643-80810665 CTATAAAGAAGCAGAGAAGTGGG + Intergenic
1142412923 16:89925196-89925218 GTGTTCAGAAGCAGAGCACAAGG - Intronic
1143205175 17:5136182-5136204 CTGAACAGAATCAGAGCCGGAGG - Intronic
1143566815 17:7727101-7727123 TTCTACAGAAGGAGAGCAGAGGG - Exonic
1144192155 17:12856401-12856423 CTGTAGGGAAGCAGAGAAGAAGG - Intronic
1144818814 17:18056506-18056528 CTGTACAGTCCCAGAGTAGAAGG + Intronic
1145122002 17:20268649-20268671 CGGTACAGAAGCAGAGAAAGTGG - Intronic
1145315302 17:21727409-21727431 CTCACCAGGAGCAGAGCAGATGG + Intergenic
1145413436 17:22693786-22693808 CTTTAAAGAAGCAGAGTTGAAGG - Intergenic
1146160909 17:30559173-30559195 CTGCACAGAATCAGAGCCGGAGG - Exonic
1146429743 17:32780785-32780807 CTGTACAGAAGCAAAAGAAAAGG + Intronic
1146843466 17:36169614-36169636 CTGCACAGAATCAGAGCCGGAGG + Intronic
1146855774 17:36257552-36257574 CTGCACAGAATCAGAGCCGGAGG + Intronic
1146864846 17:36330823-36330845 CTGCACAGAATCAGAGCCGGAGG - Intronic
1146871681 17:36381463-36381485 CTGCACAGAATCAGAGCCGGAGG + Intronic
1146879040 17:36432545-36432567 CTGCACAGAATCAGAGCCGGAGG + Intronic
1146922693 17:36723746-36723768 CTGTACAGGAGAACAGAAGAAGG - Intergenic
1147067705 17:37931417-37931439 CTGCACAGAATCAGAGCCGGAGG - Intronic
1147074567 17:37982087-37982109 CTGCACAGAATCAGAGCCGGAGG + Intronic
1147079236 17:38010972-38010994 CTGCACAGAATCAGAGCCGGAGG - Intronic
1147086090 17:38061626-38061648 CTGCACAGAATCAGAGCCGGAGG + Intronic
1147095175 17:38134914-38134936 CTGCACAGAATCAGAGCCGGAGG - Intergenic
1147102035 17:38185591-38185613 CTGCACAGAATCAGAGCCGGAGG + Intergenic
1147155953 17:38544608-38544630 GTTTACAGATACAGAGCAGAAGG + Intronic
1147455186 17:40533333-40533355 CACTACAGAAGCAGGGCTGATGG - Intergenic
1149495961 17:57117688-57117710 ATGGACAGAAGCAGAGAGGAAGG - Intronic
1149846627 17:60012102-60012124 CTGCACAGAATCAGAGCCGGAGG + Intergenic
1150084973 17:62268676-62268698 CTGCACAGAATCAGAGCCGGAGG + Intergenic
1152579438 17:81159641-81159663 ATTCCCAGAAGCAGAGCAGAAGG + Intronic
1152842343 17:82578147-82578169 GTGTACAGAAACTGAGGAGAAGG - Intronic
1154430244 18:14303104-14303126 CAGTACAGAAGGAGAGTATAGGG + Intergenic
1154432518 18:14319454-14319476 CAGTACACAAGCAGAGTATAGGG + Intergenic
1156151580 18:34249822-34249844 CTGTACTACAGCAGTGCAGAGGG - Intergenic
1156292102 18:35756216-35756238 CTTCCCAGCAGCAGAGCAGACGG + Intergenic
1157225766 18:45862699-45862721 CTCTCCAGAGGCCGAGCAGATGG + Intronic
1157678062 18:49582208-49582230 TTGGACAGAACAAGAGCAGATGG + Intronic
1158623154 18:59049830-59049852 CCCTTCAGAAGGAGAGCAGAAGG - Intergenic
1159174169 18:64812964-64812986 CTGTAAAGGAGCAGACAAGATGG + Intergenic
1159332952 18:67024970-67024992 CATTACAGAAGAAGAGCACAAGG + Intergenic
1161351447 19:3794332-3794354 CCTTACAGAAGCAGATGAGAGGG + Intronic
1161830742 19:6602409-6602431 CTGTAAAGGAGCAGACAAGATGG + Intronic
1162994357 19:14324599-14324621 CTGCACACCAGGAGAGCAGATGG + Intergenic
1163888897 19:19993563-19993585 CTATTCAGAAGGAGACCAGAGGG - Intergenic
1164504099 19:28843909-28843931 CTGTCCAGCAGCAGAGCTGGAGG - Intergenic
1164598842 19:29547837-29547859 CTGTAGGGAACCAGAGCACATGG + Intronic
1164873885 19:31669567-31669589 CTCTACAGACACAGAGCAGATGG - Intergenic
1165411592 19:35665712-35665734 CTGGACCGAGGCAGAGCAGTGGG - Intergenic
1165705133 19:37970576-37970598 CTGCACAGAAGCTGAACGGATGG - Intronic
1165800164 19:38544411-38544433 CCAGACAGAAGCAGAGCAAATGG - Intronic
1167199725 19:48056102-48056124 CTGTCCTGAACCAGAGCAAAAGG + Intronic
1167647979 19:50716084-50716106 CTGGTCAGAAGCAGAACAGATGG + Intronic
925140015 2:1543863-1543885 CTCCCCAGAAGCCGAGCAGATGG - Intergenic
925773214 2:7304819-7304841 CTGTCTAGAAGCAGCACAGAGGG + Intergenic
926423512 2:12720054-12720076 CTGTACTGAAGTTGAGCAAAAGG - Intronic
926868480 2:17386289-17386311 CTGTACAGAAGCTGGTCTGATGG + Intergenic
927035679 2:19173565-19173587 CTGTACAGAAGAAGAGCTGCTGG - Intergenic
927328535 2:21834940-21834962 ATGTACAGAAACAGAGTAGAAGG + Intergenic
927333311 2:21891443-21891465 ATGGACAGAAGCTGAGGAGAGGG - Intergenic
927684957 2:25164082-25164104 CTGTAGAGGAACACAGCAGAAGG + Intronic
927721699 2:25387379-25387401 CTGAGGAGAGGCAGAGCAGATGG + Intronic
928447128 2:31342517-31342539 CTGTACAGAATGAGTACAGAAGG - Intronic
929255115 2:39802279-39802301 CTCCCCAGAAGCAAAGCAGATGG - Intergenic
932052496 2:68412693-68412715 CTGTAGTGAAGGAGAGCAGAGGG - Intergenic
932311437 2:70745409-70745431 AAGTACAGAATCAGAGGAGAGGG + Intronic
932891734 2:75602800-75602822 CTGTACAGCTGGAGAACAGAGGG + Intergenic
932921741 2:75923733-75923755 CTGAATAGAAGGAGAGGAGAGGG + Intergenic
933105201 2:78316028-78316050 CTGGACAGGAGCAGAGGTGAGGG + Intergenic
933184598 2:79264966-79264988 CTGTACAGAAGCAGAGCAGATGG - Intronic
933467630 2:82675669-82675691 CTGAACACAAACAGAGTAGAAGG + Intergenic
933900541 2:86846591-86846613 CTCTAGGGGAGCAGAGCAGATGG - Intronic
934493203 2:94776314-94776336 CAGTACAGAAGAAGAGTATAGGG - Intergenic
934907314 2:98216628-98216650 CTGTTTAGACTCAGAGCAGAGGG + Intronic
935164849 2:100561535-100561557 CTGCACAGCAACAGAGCAGGTGG - Intergenic
935780006 2:106502634-106502656 CTCTAGGGGAGCAGAGCAGATGG + Intergenic
935880469 2:107559775-107559797 CTGTAAAGGAGCAGACAAGATGG + Intergenic
936339103 2:111615714-111615736 CTTTCCAGAAGTGGAGCAGATGG + Intergenic
937262986 2:120598223-120598245 TTGTGGAGAAGCAGTGCAGAGGG - Intergenic
938644414 2:133316325-133316347 CTTTTTAGAAACAGAGCAGATGG + Intronic
938730628 2:134144257-134144279 CTCCCCAGAAGCCGAGCAGATGG - Intronic
939125527 2:138173031-138173053 CTCCCCAGAAGCTGAGCAGATGG + Intergenic
940143402 2:150520972-150520994 GTGAACAGAATCAGAGCAGGAGG - Intronic
941453604 2:165690279-165690301 CTGAACAGAAGCAGGGAAAATGG - Intergenic
942568210 2:177287658-177287680 CTGTGATGAAGTAGAGCAGAGGG - Intronic
942985768 2:182139779-182139801 CTGGGCAGAAGCACAGCAGAAGG - Intergenic
947313605 2:228830706-228830728 CTCATCAAAAGCAGAGCAGATGG - Intergenic
947869992 2:233429719-233429741 TTGAACAGCAGCAGGGCAGAAGG + Intronic
1170556533 20:17519324-17519346 CTGTACTGAAGCAAAGCCAAGGG + Intronic
1173079233 20:39850067-39850089 CCGTACAGAGCCAGGGCAGAGGG + Intergenic
1173242793 20:41312719-41312741 CTGTACAGAAGAGGAGAATACGG + Intronic
1173365467 20:42380913-42380935 CTCCCCAGAAGCCGAGCAGATGG - Intronic
1173932363 20:46831356-46831378 CAGCACTGGAGCAGAGCAGAAGG + Intergenic
1175738969 20:61407054-61407076 CTGTATCCAGGCAGAGCAGATGG - Intronic
1176371067 21:6061630-6061652 CTGTCCAGCACCAGAGCAGTTGG - Intergenic
1176845147 21:13871064-13871086 CTGTACTGTGGCAGTGCAGAAGG + Intergenic
1178359355 21:31935059-31935081 CTGTTGAGTAGCTGAGCAGAGGG + Intronic
1178468602 21:32871516-32871538 CTGTGCAGCAGCAGAGAAAATGG - Intergenic
1178644336 21:34373028-34373050 CTGTCTGGATGCAGAGCAGAGGG - Intergenic
1179545982 21:42112475-42112497 CTGGACAGATACAGAGCAGCTGG - Intronic
1179752452 21:43476911-43476933 CTGTCCAGCACCAGAGCAGTTGG + Intergenic
1181125403 22:20698935-20698957 CTGTAGAGGACCAAAGCAGAAGG + Intergenic
1182181113 22:28349110-28349132 CTTTGGAAAAGCAGAGCAGAAGG + Intronic
1183088780 22:35506948-35506970 GAGGACAGAATCAGAGCAGAAGG + Intergenic
1183768563 22:39902656-39902678 CTTTACTGAAGCAGAGGAGAAGG + Intronic
1184080413 22:42215307-42215329 CTGTTCAGCAGCACAGCAGCAGG + Exonic
1184644264 22:45887888-45887910 CTGGCCATAAGCAGAGCTGACGG + Intergenic
1184957600 22:47902081-47902103 ATGGACAGAACCAGAGCTGAGGG - Intergenic
951098109 3:18655121-18655143 CAGGAGAGAAGCAGAGCACAAGG + Intergenic
951630741 3:24717126-24717148 CTAAACAGAAGCAGAGGAGCCGG + Intergenic
952739312 3:36720280-36720302 CTTATCAGAAGCAGAGCAGATGG + Intronic
954304381 3:49717739-49717761 CTGTGCAGGGGCAGAGCAGAAGG + Exonic
954984741 3:54779696-54779718 CAGTAGAGAAGCAGAGCAGCAGG - Intronic
955075158 3:55606823-55606845 CTGTAAAGAAGAAGAGGAGGAGG - Intronic
955986385 3:64577762-64577784 CTCTACAGAAGCATTTCAGAAGG - Intronic
956088902 3:65643121-65643143 CTGAACTGCAGCAGACCAGATGG + Intronic
956191904 3:66615908-66615930 CTGCAAAGAAGCATGGCAGAGGG - Intergenic
956378092 3:68636898-68636920 CTGTACAGAAGCTGGTCTGATGG + Intergenic
957246193 3:77719756-77719778 CTCCCCAGAAGCAGAGCAGATGG + Intergenic
958441137 3:94157543-94157565 TTGTAGAGAAGAAGAGCAAATGG + Intergenic
959188716 3:103082043-103082065 CTCACCAGAAGCTGAGCAGATGG + Intergenic
959476449 3:106818106-106818128 CTGTAGAGAAGTAGGGGAGAAGG + Intergenic
963530148 3:146464353-146464375 CTCTAAAGAAACAGAGCAGTAGG - Intronic
963866094 3:150363205-150363227 GTGTAGAGAAGCAGAGCAAGGGG + Intergenic
964092239 3:152891455-152891477 CTCCCCAGAAGCTGAGCAGATGG - Intergenic
966843824 3:184110851-184110873 CTGAACAGAAAAAGAACAGATGG - Intergenic
967592937 3:191299641-191299663 CTCTACTAAAGCAGTGCAGAGGG + Intronic
968268674 3:197382614-197382636 CTGTTGGGCAGCAGAGCAGAGGG + Intergenic
968382181 4:106668-106690 CTTTAAAGAAGCAGAGTTGAAGG - Intergenic
968592813 4:1467397-1467419 TGGTACAGAAGAAGATCAGAAGG + Intergenic
969199528 4:5591509-5591531 CTGCAGAGGTGCAGAGCAGAGGG + Intronic
969576272 4:8037906-8037928 CTGGGCAGAATCAGAGCAGAGGG - Intronic
971063844 4:23004861-23004883 CTCCCCAGAAGCTGAGCAGATGG - Intergenic
971098246 4:23433330-23433352 TTGTCCAGAAGCAGAGAAGTGGG - Intergenic
971203667 4:24539075-24539097 CTGATCAGACTCAGAGCAGATGG - Intronic
972158194 4:36191059-36191081 CTCTACAGACTTAGAGCAGAGGG - Intronic
974121934 4:57649379-57649401 ATGATCAGAGGCAGAGCAGAAGG + Intergenic
974157688 4:58095298-58095320 CTTTCCAGAAGCTGAACAGATGG - Intergenic
975589475 4:75986034-75986056 CTGTAGAGAAGGAAAGCACAGGG - Intronic
977138427 4:93336162-93336184 CTGTAAAGAAAGAGAGGAGAAGG - Intronic
977657297 4:99536686-99536708 ATGTAGAGGAGCAGGGCAGATGG + Intronic
978448435 4:108803149-108803171 CTGCAAAGAAGAAGGGCAGAGGG + Intergenic
978749241 4:112228518-112228540 CAGTACTGAAGCATGGCAGAAGG + Intergenic
978750452 4:112240380-112240402 ATGCACAGAAGAAAAGCAGATGG - Intronic
978783979 4:112588778-112588800 CTGGAAAGTAGCAGAGCAGTAGG + Intronic
979474249 4:121136014-121136036 CTGGCCAGCAGCAGAGAAGAGGG - Intronic
979972541 4:127154806-127154828 CTGCACAGGAGGTGAGCAGAAGG + Intergenic
983383214 4:167023631-167023653 AAGTACAGAAGCAGAGAAAAAGG - Intronic
984562751 4:181290314-181290336 AAACACAGAAGCAGAGCAGAGGG + Intergenic
985347423 4:189021191-189021213 CTGTTCAGATGCAGCACAGAAGG + Intergenic
985801913 5:2010107-2010129 CTGGACAGAGGCCGTGCAGAAGG + Intergenic
986076498 5:4343409-4343431 CTGTACAGGAGCAGCACAGTAGG + Intergenic
986434718 5:7717860-7717882 CTGAACCCATGCAGAGCAGAAGG + Intronic
988589910 5:32539809-32539831 CTGTTCAGAAGTAAAGCAGTTGG + Intronic
989297623 5:39848314-39848336 CTGTAATGAAGCAGAGTGGAAGG - Intergenic
990115582 5:52386311-52386333 CTTCACAGAAGTAGAGTAGAGGG + Intergenic
990487677 5:56275406-56275428 CTGTACAGAAGCTGGTCTGATGG - Intergenic
991038176 5:62149318-62149340 CTGTACAGCAGCTGAGTTGAGGG - Intergenic
992416411 5:76556300-76556322 CTGTAAAGGAGCAGACAAGATGG - Intronic
992866033 5:80958130-80958152 TTGTCCAGGGGCAGAGCAGATGG + Intergenic
993099238 5:83516512-83516534 CGCAACAGAAGCAGAGAAGATGG + Intronic
994419086 5:99509923-99509945 CTGTTGAGAAATAGAGCAGACGG + Intergenic
994646984 5:102482668-102482690 CAGTAAAGAAGTATAGCAGAAGG - Intronic
995005928 5:107195269-107195291 CTGTACAGAAGCTGGTCTGATGG + Intergenic
996477583 5:123938464-123938486 CTGTAAAGGAGCAGACAAGATGG - Intergenic
996709845 5:126533589-126533611 CTGTACAGAAGTGTAGAAGAAGG - Intergenic
997202254 5:132018052-132018074 CAGTACAGAGGGAGAGAAGAGGG + Intergenic
997748310 5:136319325-136319347 CAGCACATAAGCAGAGGAGATGG - Intronic
998505895 5:142672478-142672500 CTGTACAGAAAAAGACCTGAAGG - Intronic
1000518282 5:162267591-162267613 CTTTACAGAAGTAAAGTAGAGGG + Intergenic
1001278813 5:170371113-170371135 CTATGCAAAAGCAGAACAGAAGG - Intronic
1001305964 5:170573030-170573052 CTGCTAAGCAGCAGAGCAGAGGG + Intronic
1001875175 5:175194173-175194195 ATGTAAAGAAGCACAGAAGACGG + Intergenic
1003282178 6:4703650-4703672 CTGTACAGAAGCTGGTCTGATGG + Intergenic
1005225850 6:23641006-23641028 CTCTACAAAAGAAGAGCAAACGG + Intergenic
1005656236 6:27940936-27940958 TTTTACAGAGACAGAGCAGATGG + Intergenic
1006189132 6:32196876-32196898 CTATAGAGAAGTTGAGCAGATGG - Intronic
1006830956 6:36968026-36968048 CTGTAAAGAGGCAGGGCAGGGGG - Intergenic
1007865605 6:44966145-44966167 CTGAATAGAGGCAGAGGAGAAGG - Intronic
1008191220 6:48460941-48460963 CTTTATAAAAGCAAAGCAGAGGG + Intergenic
1009413586 6:63393478-63393500 CTGTACAGAAGAAGGGAAGATGG - Intergenic
1010354714 6:74918663-74918685 GTGCTCAGATGCAGAGCAGAGGG + Intergenic
1010737766 6:79461775-79461797 CTGGACAGCAGCAGAGGAGAGGG - Intergenic
1011477531 6:87762691-87762713 CAGAGCAGAAGCAGAGCTGAAGG - Intergenic
1014180986 6:118384040-118384062 CCTCACAGAAGCAGGGCAGAGGG + Intergenic
1014424960 6:121292856-121292878 CTGGGCAGGAGCAAAGCAGAAGG + Intronic
1014457253 6:121650193-121650215 CTGCAAGGAGGCAGAGCAGAGGG + Intergenic
1014814600 6:125921517-125921539 CTTTTCAGAGGCAGAGCAGGGGG - Intronic
1015631249 6:135234046-135234068 CAATCCAGAGGCAGAGCAGATGG - Intergenic
1016117389 6:140303776-140303798 CTGCAGAGAAGGAGAGCAGAGGG - Intergenic
1016792041 6:148076285-148076307 TGGTTCAGAAGAAGAGCAGATGG + Intergenic
1021206258 7:17785111-17785133 CTCCCCAGAAGCTGAGCAGATGG - Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022637638 7:32152233-32152255 CTGAACAGCAGCAGAGCGGAGGG - Intronic
1022953499 7:35361104-35361126 CTGTTCAGAAGCAGAGAATTAGG + Intergenic
1024212180 7:47215610-47215632 CTGACCAGGAGCAGGGCAGACGG + Intergenic
1024412465 7:49060909-49060931 GTGAACAGAATCTGAGCAGATGG - Intergenic
1024432109 7:49300993-49301015 CTGTAGAGGAGCAGACAAGATGG - Intergenic
1024538370 7:50457396-50457418 CTGTACAGAAGCAGGGCAGGAGG - Intronic
1024838753 7:53558570-53558592 CTGTAAAGAAGCACAACACATGG + Intergenic
1025079498 7:55969440-55969462 CTGGAAAGAAGAGGAGCAGATGG - Intronic
1026117768 7:67510646-67510668 CCGTACATAGCCAGAGCAGAAGG - Intergenic
1026958666 7:74394623-74394645 CTGTATAGAAGGAAAGGAGATGG - Intronic
1028184821 7:87769946-87769968 TAGAACAGAAGCAGAGCATAAGG - Intronic
1028627037 7:92889139-92889161 CTGTAGTGAAGCACAGCAGCTGG - Intergenic
1030196656 7:106859447-106859469 CTGTTCAAGAGCATAGCAGAGGG - Intergenic
1030198184 7:106874225-106874247 CTGTAGAGAAGTAGAGAAGATGG - Intronic
1030923522 7:115421981-115422003 ATGTACAGCAGAAGAGCAAAAGG + Intergenic
1031627728 7:124009599-124009621 CTCCCCAGAAGCTGAGCAGATGG + Intergenic
1032584413 7:133132945-133132967 CTGTAAATAAGCAAAGAAGAAGG + Intergenic
1032854425 7:135822564-135822586 CTGTGCAGAAGAATGGCAGACGG + Intergenic
1033063286 7:138128528-138128550 CTCCCCAGAAGCTGAGCAGATGG - Intergenic
1034944879 7:155255399-155255421 CTATACAGAAGCAGATGGGATGG + Intergenic
1035160285 7:156944944-156944966 GTGGACAGAAGCTGTGCAGATGG - Intergenic
1035606823 8:934897-934919 CTTTAAAGAGGCAGAGCTGAGGG - Intergenic
1036057648 8:5276031-5276053 TTGTACTAAAGCAGTGCAGAGGG - Intergenic
1036065948 8:5381583-5381605 CTGTACAGAAGAGGAGCTGGTGG + Intergenic
1036622481 8:10433855-10433877 CTGTACAGCAGGGGAGGAGAGGG - Intergenic
1037373396 8:18203951-18203973 CTGTAAAGGAGCAGACAAGATGG + Intronic
1038415248 8:27390170-27390192 CTGTGCAGGAGCAGAGGAGAGGG + Intronic
1039019755 8:33191964-33191986 CTGTATATAAGCACAGCATATGG - Intergenic
1040514445 8:48123357-48123379 CTGGGCAGAAGCAGAGAAGGTGG + Intergenic
1040525906 8:48225174-48225196 CTGTAAAGGAGCAGAGAAGGTGG + Intergenic
1040528346 8:48244106-48244128 CTGTAAAGGAGCAGACAAGATGG + Intergenic
1041706519 8:60852289-60852311 GTCTACAGGAGCAGGGCAGAGGG - Intronic
1042125206 8:65531284-65531306 CTGTGCAGAAGCAAAGCGGGTGG - Intergenic
1043975967 8:86584976-86584998 CTGTTCAGAAACACAGTAGATGG - Intronic
1045234048 8:100334323-100334345 CTGTGTGGAAACAGAGCAGAGGG - Intronic
1046037374 8:108860219-108860241 CAGTACAGAAACAGAACATAGGG + Intergenic
1046307897 8:112394499-112394521 GTTTAGAGAGGCAGAGCAGAGGG - Intronic
1047331851 8:123896489-123896511 CTTTCCAGAATCAAAGCAGAAGG - Intronic
1049006493 8:139858939-139858961 CCGTGCAGAAGCAGAGGAGACGG - Intronic
1049192128 8:141294369-141294391 CTGCCTAGAAGCAGAGCAGGAGG + Intronic
1050179862 9:2909857-2909879 CTGTATAGAGACAGAGCAGGTGG + Intergenic
1050503370 9:6322062-6322084 CTCAACAGAAGCCAAGCAGATGG + Intergenic
1053308636 9:37001588-37001610 CAGTGCAGAAGCAGAGCCGGTGG - Intronic
1055680119 9:78705845-78705867 TTGTACAGTAGCAGTGCAGAAGG + Intergenic
1056389584 9:86128602-86128624 CTGGACAGCAGCAGAACAGTGGG - Intergenic
1056856203 9:90131749-90131771 CTGTACAGCAGCATAGCACGTGG - Intergenic
1057399042 9:94706313-94706335 ATGAAAAGAAGCAGAGCATAAGG + Intergenic
1057976086 9:99607888-99607910 CTGCACAGAAGCATAACAGTGGG - Intergenic
1058813218 9:108660814-108660836 CTCCCCAGAAGCTGAGCAGATGG + Intergenic
1059258809 9:112956209-112956231 CTGTAAAGAAACACAGCAGGTGG + Intergenic
1059313906 9:113408042-113408064 CTGTACAGTAGCAGAGAGTAAGG + Exonic
1059605004 9:115824907-115824929 CTCTACTGAGGCAGTGCAGAGGG + Intergenic
1060565115 9:124583852-124583874 GAGTACAGAAGCTGTGCAGAGGG - Intronic
1061516802 9:131094887-131094909 CAGTCCAGCAGCTGAGCAGAAGG + Intergenic
1061604933 9:131702139-131702161 CTCTACAGAAGCAGCGAAGAGGG + Intronic
1061650148 9:132041055-132041077 CAGCAGAGAAGAAGAGCAGAAGG + Intronic
1185936159 X:4258662-4258684 ATGTAGAGAAGGAGAGCTGATGG - Intergenic
1186257225 X:7735743-7735765 CTCTCCAGAAGCAGAGCAGGTGG - Intergenic
1186766957 X:12780844-12780866 CTGTATAGAAACAAAGCAGCTGG - Intergenic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1187985272 X:24803279-24803301 CTGGAGAGAAGGAGAGCACACGG + Intronic
1188262756 X:28038521-28038543 ATGTACAGAAGAAGAGCCCATGG + Intergenic
1188713341 X:33429481-33429503 CTCACCAGAAGCTGAGCAGATGG + Intergenic
1189258440 X:39658923-39658945 CTTTTCAAAGGCAGAGCAGAAGG - Intergenic
1189379499 X:40491729-40491751 CTGAGAAGCAGCAGAGCAGATGG + Intergenic
1194465556 X:94230662-94230684 CTGTGCAGAAGCTCAGCAAAAGG + Intergenic
1194693076 X:97010392-97010414 CTGAAAAGAAGCAGTGAAGAAGG - Intronic
1196455621 X:115889427-115889449 ATGTACTGAAGCAAGGCAGAAGG + Intergenic
1197715952 X:129706220-129706242 CTGTACAGAAGTCAAGCAAACGG + Intergenic
1198261951 X:134972935-134972957 CTCCCCAGAAGCTGAGCAGATGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198566667 X:137912258-137912280 CTGAGCAGAGGCAGAGGAGAGGG - Intergenic
1199158203 X:144574586-144574608 CTGTAGATAAGCAGAAGAGAAGG - Intergenic