ID: 933185200

View in Genome Browser
Species Human (GRCh38)
Location 2:79270616-79270638
Sequence GAGAGTCTCAAATGCCTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933185200_933185203 12 Left 933185200 2:79270616-79270638 CCTCTCAGGCATTTGAGACTCTC 0: 1
1: 0
2: 2
3: 8
4: 123
Right 933185203 2:79270651-79270673 ATCTTCTCAGATAACCCTCAGGG 0: 1
1: 0
2: 1
3: 76
4: 184
933185200_933185202 11 Left 933185200 2:79270616-79270638 CCTCTCAGGCATTTGAGACTCTC 0: 1
1: 0
2: 2
3: 8
4: 123
Right 933185202 2:79270650-79270672 AATCTTCTCAGATAACCCTCAGG 0: 1
1: 0
2: 0
3: 14
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933185200 Original CRISPR GAGAGTCTCAAATGCCTGAG AGG (reversed) Intronic
903016091 1:20362863-20362885 GAGAGTCTTAAATGTCAGACAGG + Intergenic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
908429650 1:64043412-64043434 TAGAGTCTCAATTCCCAGAGAGG + Intronic
908853973 1:68403079-68403101 AAGAGACTCAAATCCTTGAGGGG - Intergenic
909300519 1:74007621-74007643 GAGAGCCTCACCTGCCTCAGTGG + Intergenic
910169348 1:84360945-84360967 CAAAATCTCAAATGCTTGAGAGG - Intronic
912380796 1:109247265-109247287 GAGAGTCTCAAATGAGGGAGGGG - Intergenic
912523845 1:110266244-110266266 GAGAGTCTCAGTTGACTGAAAGG + Intronic
914672884 1:149885420-149885442 GAGAGGCGCGAATTCCTGAGTGG + Exonic
917498992 1:175568760-175568782 AAGAGTCTCAAGTCCCTAAGAGG - Intronic
919040953 1:192387769-192387791 CAAAGTCTCAAGGGCCTGAGTGG + Intergenic
919858933 1:201725518-201725540 GATAGTCTCAACTACCTGGGAGG + Intronic
922362064 1:224832108-224832130 AAGAGTCACAAATGCCTGAGAGG + Intergenic
924118032 1:240767073-240767095 CAGAGTCTGAATTGCCTGTGTGG - Intergenic
1063067852 10:2626950-2626972 CAGAGCCTCAAATGCATGACTGG + Intergenic
1064454924 10:15478428-15478450 CAGACTCTCAATTGCTTGAGTGG - Intergenic
1065284406 10:24173929-24173951 GACATTCAGAAATGCCTGAGGGG - Intronic
1065806969 10:29402735-29402757 GAGAGCATCAAATGCTGGAGAGG + Intergenic
1068003193 10:51360917-51360939 TAGAGTGAAAAATGCCTGAGTGG - Intronic
1070829038 10:79407543-79407565 CAGAGTCTCAAATGCCTGGGCGG + Intronic
1071346878 10:84701679-84701701 GAGACACTCTAATGCCTGAGTGG - Intergenic
1071430127 10:85600860-85600882 GAGGTTATCAGATGCCTGAGTGG + Exonic
1077096935 11:803028-803050 GGGAGTCTCAAAGGCCAGGGAGG + Intronic
1077135751 11:997440-997462 GAGGGTCTCCCAGGCCTGAGAGG + Intronic
1080699526 11:34632657-34632679 GTCATTCTCAAATGCCAGAGAGG + Intronic
1082032465 11:47615435-47615457 GAGAGTCCCAACTGGGTGAGAGG - Intergenic
1083931127 11:65846179-65846201 GAGAATCCCATAAGCCTGAGTGG + Intronic
1085170573 11:74446244-74446266 GAGATTCTCAAAGTCCTGGGGGG + Intergenic
1088537712 11:110879266-110879288 GACAGTCTAGAATGCATGAGAGG + Intergenic
1091033740 11:132214627-132214649 AAGAGGCTCAAATGTCAGAGGGG - Intronic
1091653964 12:2330883-2330905 TAGAGTATCAAATGTCTGACTGG + Intronic
1094433420 12:30395522-30395544 CAGAGTGTCAATTGCTTGAGGGG - Intergenic
1100416267 12:94379752-94379774 GAGCTTCTGAAATGCCTCAGAGG - Intronic
1102519434 12:113469551-113469573 GAGAGTCTGAAAAGCCCCAGTGG - Intronic
1103043725 12:117717872-117717894 AAGAGACTCAATTGCCTCAGTGG - Intronic
1108572641 13:51766525-51766547 GAGTGTGGCAAATGCCGGAGGGG - Exonic
1111408048 13:87836024-87836046 GACAATCTTAAATGCCTGGGTGG - Intergenic
1115797376 14:36953800-36953822 GAGTGTCTAAAATGCCTATGTGG - Intronic
1116113752 14:40621637-40621659 GAGAGTATCAAAACCCAGAGTGG - Intergenic
1119513481 14:75229867-75229889 GGGTGTCTCAGATGCCTGGGAGG + Intergenic
1121809893 14:96875645-96875667 GAGAGTATCATTGGCCTGAGTGG + Intronic
1128107115 15:65053231-65053253 GAGAGACTCTAAAACCTGAGAGG - Exonic
1130054682 15:80512302-80512324 GCGAGGCTCAAATCCCTGAAGGG - Intronic
1139959979 16:70711946-70711968 CAGAGTCTCAAAGGACTGGGAGG + Intronic
1144704261 17:17356889-17356911 CAGGGTCTCAAATGCCATAGGGG - Intergenic
1153572689 18:6488943-6488965 GAAAATCTTAAATGACTGAGAGG + Intergenic
1154300492 18:13186968-13186990 GAGCTTTTCAAATGCCTGAAAGG + Intergenic
1160951278 19:1668844-1668866 CAGAGTTTCAAATGCCTGTAAGG - Intergenic
1164849602 19:31470684-31470706 CAGTGTCTGAAAGGCCTGAGGGG + Intergenic
1165222693 19:34329993-34330015 GAGAATCACATAAGCCTGAGGGG + Intronic
1165271525 19:34711745-34711767 GAGAGTCTCATGTGCTCGAGAGG - Intergenic
1166301430 19:41913880-41913902 GAGGGGCTGAAGTGCCTGAGGGG - Intronic
933185200 2:79270616-79270638 GAGAGTCTCAAATGCCTGAGAGG - Intronic
938745909 2:134278086-134278108 GACAGTATCCAATACCTGAGAGG - Intronic
939322604 2:140643598-140643620 GAGAGTTTCTAAGGCCTCAGTGG - Intronic
942706284 2:178776437-178776459 AAGAATCCCAATTGCCTGAGGGG - Exonic
944483181 2:200178132-200178154 GTGAGTCAGAAAAGCCTGAGTGG + Intergenic
944635868 2:201675577-201675599 GACAGGCTAACATGCCTGAGAGG - Intronic
945042289 2:205752367-205752389 GAGAGACTGAAATCCCTGGGAGG - Intronic
945841281 2:214890704-214890726 GAGATGCTCAAATGGCTGAGGGG + Intergenic
946267148 2:218555857-218555879 GAGAGTCTCAAGTTTTTGAGTGG - Intronic
946530661 2:220566639-220566661 GAGGGTCCCAAATGCCTGCCAGG - Intergenic
1170510641 20:17072883-17072905 GAGTGGCTCAACTCCCTGAGAGG - Intergenic
1173539803 20:43842868-43842890 TGGAGCCTCAAATGTCTGAGGGG + Intergenic
1174253099 20:49234031-49234053 GAGAGTCACAAAAGGCCGAGTGG - Intronic
1175329002 20:58149819-58149841 GAGAGTCTCAGATACCTAACTGG + Intergenic
1177458365 21:21374724-21374746 GAGAGTCTCTGATGCTTGAAAGG + Intronic
1178006998 21:28233444-28233466 CAGAGTCTAGACTGCCTGAGAGG - Intergenic
1179824471 21:43956452-43956474 GAGAGTCTGGAATGCGTGAGAGG + Intronic
1180221949 21:46364779-46364801 GAGTTTCTCCAATCCCTGAGCGG - Intronic
1184266241 22:43348073-43348095 CAGAGACTCAAAGGGCTGAGGGG + Intergenic
951903203 3:27677785-27677807 GAGAGTTGGAAATGCCTTAGGGG - Intergenic
960082054 3:113552380-113552402 GAGACTCTAAAATGGCTGTGAGG + Intronic
961207767 3:125100131-125100153 GAGAGTCTCAGAGGCCTAATGGG + Intronic
964068726 3:152606594-152606616 AAAAATCTCAAATGCCTGAAGGG - Intergenic
967222056 3:187255699-187255721 GAGAGGCAGAAAAGCCTGAGAGG - Intronic
967761022 3:193226487-193226509 TAGAGTCTCAGATCCATGAGTGG + Intergenic
969315242 4:6377845-6377867 GAGAGCCTCCGGTGCCTGAGGGG + Intronic
972760259 4:42096384-42096406 GAGAGTGACAAAAGCCTGATTGG - Intergenic
973658777 4:53080297-53080319 GAAAGTCTTAGATTCCTGAGTGG - Intronic
973948600 4:55987190-55987212 GAGATTTTCAAATGACTGATGGG + Intronic
975395109 4:73865783-73865805 AAGAATCTTAAATGGCTGAGTGG - Intergenic
976009736 4:80472771-80472793 GAGAGCCTCAATTGCCTGTATGG + Intronic
977191692 4:94008974-94008996 GAGACTCTCAAATACCTTTGGGG + Intergenic
982456810 4:155619682-155619704 GAAAATCTCCAATGCCTTAGAGG - Intergenic
985375975 4:189338983-189339005 GAGAGTCTCACAGGCCTTACAGG - Intergenic
985943152 5:3155172-3155194 CAGAATCTCAAATTCCTGAATGG - Intergenic
988646992 5:33105595-33105617 CAGAGACTAAAATGCCTGTGTGG + Intergenic
988838648 5:35060900-35060922 GAGAGTCTCAAATCACAGGGTGG + Exonic
989173692 5:38499318-38499340 GAGATCCTCAAATGACTGTGGGG + Intronic
989726450 5:44592312-44592334 GAAAATATCAAAAGCCTGAGTGG + Intergenic
994237891 5:97386591-97386613 GAGAATCTCAAGTACCTGGGAGG - Intergenic
994864397 5:105247290-105247312 GAAAGCCTAAAATGCCTCAGAGG - Intergenic
996348975 5:122517763-122517785 AAGAGTCTCAAATGCATTGGTGG - Intergenic
998121942 5:139585658-139585680 GAGGCACTCAAATGTCTGAGTGG - Intronic
998330907 5:141326236-141326258 GTGTGTCTCAAAAGCCTGCGGGG - Intergenic
1002924641 6:1598248-1598270 GAGAGGCTCAGATGCCTGCAGGG - Intergenic
1003604559 6:7547515-7547537 GAGAGTCACTTAAGCCTGAGTGG - Intronic
1003853652 6:10250804-10250826 TAGAGTCTCAAATGCTTTATGGG - Intergenic
1006388143 6:33743509-33743531 GAGTTTCTCACATGGCTGAGGGG + Intronic
1006767455 6:36520716-36520738 GGGAGTATCAAATACCTGGGCGG - Intronic
1011942755 6:92863276-92863298 GAGAGTCTGTAAAGCCTGAGAGG + Intergenic
1011954924 6:93015272-93015294 CTGAGACTAAAATGCCTGAGAGG - Intergenic
1013630463 6:111981303-111981325 GAGAAACTAAAATGCCTGATAGG + Intergenic
1017345347 6:153373079-153373101 TTTAGTCTCAAATGCATGAGTGG - Intergenic
1020757573 7:12222691-12222713 GAGAGTCCAAAATGAGTGAGTGG + Intronic
1022891471 7:34704664-34704686 CAGAGACTCAAAAGGCTGAGTGG + Intronic
1023628902 7:42143390-42143412 GAGAGACAAAAATGCCTAAGAGG - Intronic
1026326404 7:69314401-69314423 GAGTCTCTCAAATGTCCGAGAGG - Intergenic
1033567424 7:142592902-142592924 GAGAGTCTCCAGTCCCTGATAGG - Intergenic
1033646053 7:143305168-143305190 GAGATTCCCACATCCCTGAGGGG - Exonic
1034140344 7:148809918-148809940 GATATTCTCAAAGGACTGAGAGG - Intronic
1034737689 7:153444133-153444155 GGGAGCCTCACATGCCTGAGAGG + Intergenic
1039525739 8:38214501-38214523 GCTAGTCTCAAATGCCTGGCTGG + Intergenic
1043429336 8:80179553-80179575 GAGAGTTTCGAAAGCATGAGAGG + Intronic
1049031306 8:140040062-140040084 GAGAGTCTCAAATTTCTTAAGGG - Intronic
1050421318 9:5468077-5468099 GATACTTTCAAATGCCTGAGGGG + Exonic
1051351906 9:16205149-16205171 GAGAGCCTCAAAGGCCAGATGGG + Intronic
1053311478 9:37023578-37023600 CAGAGTCACAAAGGCCTCAGGGG - Intronic
1055678658 9:78692045-78692067 AAGATTCTCAAATGGCTAAGAGG + Intergenic
1056538535 9:87551908-87551930 GTGAGTCTCAGATGCCTCCGTGG + Intronic
1058902413 9:109453558-109453580 GAGAGACTCCAAGCCCTGAGGGG + Intronic
1059694480 9:116717883-116717905 GAGGGTCATAAATGCCTTAGTGG - Intronic
1060302067 9:122380160-122380182 GAGAGTCTATGATGCCTGATAGG + Intronic
1060782708 9:126424616-126424638 CAGTGTCTCAAATTGCTGAGTGG - Intronic
1060911885 9:127357892-127357914 GAGAGTCTGCAGTGCCTCAGAGG - Intronic
1062348954 9:136129473-136129495 GAGAGCCCCAGATGCCTGAGCGG - Intergenic
1186216489 X:7306678-7306700 GAGAGCCTCACTTGGCTGAGGGG + Intronic
1187030812 X:15486340-15486362 GGGAGTACCACATGCCTGAGGGG - Intronic
1188252596 X:27916121-27916143 GAAAGTCACAAAGGCATGAGAGG - Intergenic
1188675589 X:32935590-32935612 GAGTGTCTCCAGTGCCAGAGAGG - Intronic
1192806618 X:74515387-74515409 AAGAGCCTCAGATGCCTGTGAGG + Intronic
1197252509 X:124230182-124230204 GAGGGTCTTAGATGTCTGAGGGG - Intronic
1200444900 Y:3248618-3248640 GAGAGTCAGACATGCCTCAGTGG + Intergenic