ID: 933185560

View in Genome Browser
Species Human (GRCh38)
Location 2:79275256-79275278
Sequence ATCTTGTCCAAGAGGATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933185558_933185560 1 Left 933185558 2:79275232-79275254 CCAAAAGAGGTAACTGGAGTTTA 0: 1
1: 0
2: 1
3: 18
4: 159
Right 933185560 2:79275256-79275278 ATCTTGTCCAAGAGGATCAAAGG 0: 1
1: 0
2: 2
3: 12
4: 114
933185557_933185560 2 Left 933185557 2:79275231-79275253 CCCAAAAGAGGTAACTGGAGTTT 0: 1
1: 0
2: 1
3: 20
4: 203
Right 933185560 2:79275256-79275278 ATCTTGTCCAAGAGGATCAAAGG 0: 1
1: 0
2: 2
3: 12
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933185560 Original CRISPR ATCTTGTCCAAGAGGATCAA AGG Intronic
906893298 1:49741690-49741712 ATCTTATCCATCATGATCAAGGG + Intronic
907173602 1:52496938-52496960 CTCTAGTTCAAGAGGAGCAAGGG + Intronic
911239257 1:95448169-95448191 ATCTTGCCCAAGACCACCAAGGG - Intergenic
912203502 1:107484477-107484499 ATCTTGTGCAAAAGTACCAATGG - Intergenic
913466042 1:119143950-119143972 TCCTTGTCCAAGAACATCAAGGG + Intergenic
915041378 1:152970755-152970777 ATCTTGGCCTAGCGGCTCAAAGG - Intronic
915643238 1:157246177-157246199 ATCTGGTCCAAGAGGAGCACCGG - Intergenic
916635967 1:166668873-166668895 ATATTGCCCAACAGGAACAACGG - Intergenic
919604419 1:199663814-199663836 CTCTTGTCCAAGAGAGACAATGG - Intergenic
922910916 1:229216528-229216550 ATGTTATCCAAGAGGACCCAAGG - Intergenic
923679772 1:236110244-236110266 ATCTTCTCCAAGAGGGTCAGAGG - Intergenic
1065563883 10:26989852-26989874 ATCTTGTCCAGGAAGTTCAGAGG + Intergenic
1066271158 10:33824920-33824942 ATCTTGTTCAAAAGCATCAAAGG - Intergenic
1067233910 10:44431403-44431425 ATCTTGTGGAATAGCATCAATGG + Intergenic
1067962889 10:50876340-50876362 AGCTTGTCCAAGTGGAGCACAGG - Intronic
1073946682 10:108758549-108758571 ATCTTGTGAATGAGAATCAAAGG + Intergenic
1076482257 10:130792366-130792388 ACCTGGACCAAGAGGAGCAAGGG - Intergenic
1082919581 11:58478512-58478534 ATCTAGCCAAAGAAGATCAATGG - Intergenic
1088727511 11:112652732-112652754 CTCCTGTCCAAGTAGATCAAAGG + Intergenic
1090617122 11:128524971-128524993 ATCTTGCCCAAGTGGATGAAAGG - Intronic
1091627828 12:2136579-2136601 GTCTTTACCAAGAGGACCAAGGG + Intronic
1099769540 12:87033617-87033639 ATTTGGTCCAAGAGGACCAGAGG - Intergenic
1103237802 12:119388215-119388237 ATCCTGGCCAAGGGGATCCAAGG - Intronic
1108138126 13:47386873-47386895 ATCTTATCCAAGACCATAAAGGG + Intergenic
1110142479 13:72147947-72147969 GGCTTATCCCAGAGGATCAATGG + Intergenic
1113847042 13:113398164-113398186 ATCTTCTCCTAGAAGAACAAAGG - Intergenic
1116188942 14:41637819-41637841 ATCTTGTCTAAAAGGTTCTAAGG - Intronic
1121721875 14:96115060-96115082 AACTGGTCCAAGGGGATAAATGG - Intergenic
1124153340 15:27202110-27202132 GTCTTCTCCAAGAGAACCAACGG + Intronic
1124890538 15:33727943-33727965 ATCTTAATCAAGAGGTTCAAAGG - Intronic
1126246610 15:46513562-46513584 ATCTTGGCCAAAAAGAACAAAGG - Intergenic
1126433127 15:48608061-48608083 CTGTTGTCCAAGAGAATCACTGG + Intronic
1127019179 15:54726965-54726987 ATCTTATCCAAGACCTTCAAGGG - Intergenic
1129576846 15:76758530-76758552 ATCTTGAGCAAGAAGAGCAAAGG - Intronic
1130443761 15:83979720-83979742 GTCTTCTGCAAGAGGATCATGGG - Intronic
1130939900 15:88498718-88498740 ACCTTGTGCAAGAGGAGCAAGGG - Intergenic
1131769943 15:95726624-95726646 ATTTTGTCCAAATGTATCAAAGG + Intergenic
1139455250 16:67069614-67069636 ACATTGTCCAAGAAGCTCAATGG + Intronic
1140219615 16:73034146-73034168 ACCTTGTCCATGAGAATCAGGGG - Intronic
1141233067 16:82188770-82188792 AGCTTCTCCAAGAGGATACAGGG - Intergenic
1152988651 18:342565-342587 ATCTCATCCCAGAGGATGAAGGG - Intronic
1155729336 18:29133127-29133149 ATTTTTTCCACAAGGATCAAAGG - Intergenic
1156020430 18:32594003-32594025 AGCTTGTAAAAGAGGATGAAGGG + Intergenic
1167084808 19:47301971-47301993 ATCTTGAAGAAGAGGATGAAGGG + Intronic
926679078 2:15650338-15650360 ATAGTGACCAAGAGGATGAAAGG - Intergenic
928421665 2:31141777-31141799 ATCTGATCCAAAAGGAACAAAGG - Intronic
929344196 2:40860542-40860564 ATCTTATGCAAGAGGAAAAAAGG + Intergenic
930294438 2:49536704-49536726 ATATTGTTCAAGACCATCAAGGG + Intergenic
930439555 2:51389682-51389704 ATCTTATCCAAGACAACCAAGGG - Intergenic
931980131 2:67685659-67685681 ATCCTGTCCTACAGGATCATGGG + Intergenic
933185560 2:79275256-79275278 ATCTTGTCCAAGAGGATCAAAGG + Intronic
933457380 2:82533667-82533689 ATCTTGTGCAAGATCATGAAAGG + Intergenic
934126852 2:88902504-88902526 TTCTTTCCCAAGAGAATCAATGG - Intergenic
934528781 2:95071985-95072007 AGATAATCCAAGAGGATCAATGG - Intergenic
938664554 2:133521009-133521031 AATTTATCCAAGTGGATCAAAGG + Intronic
938794353 2:134705675-134705697 GTCTTGTCCAAGAAGAGCTACGG + Intronic
939102842 2:137915271-137915293 AGCCTGTCCAACAGGATCAAGGG + Intergenic
943753287 2:191532318-191532340 TTTTTGTACAAAAGGATCAAAGG - Intergenic
1170013583 20:11755562-11755584 ATCTCTTCAAAGAGGATGAAAGG - Intergenic
1170179004 20:13507776-13507798 ATCTTGTGCAAGAAAAACAAGGG + Intronic
1175356145 20:58370023-58370045 CTATTGTCCAAGAGGATTTAGGG - Intergenic
1177401166 21:20606602-20606624 ATCTTGTCCAAGACCTTCTAAGG + Intergenic
1177801350 21:25831956-25831978 ATCTTGTGCAAGAAAATTAATGG - Intergenic
1178486070 21:33020814-33020836 ATCTTGTCCAAGCCGTTCAGGGG - Intergenic
1178582382 21:33847700-33847722 CCATTGTCCAAGAGGCTCAATGG - Intronic
1181686681 22:24534009-24534031 GTCAGGTCCAAGAGGAACAAGGG + Intergenic
1181714085 22:24711796-24711818 CTCATGTCCAGGAGGATAAAGGG - Intergenic
951940998 3:28078964-28078986 ACCATGTTCAAGAGGAGCAAGGG - Intergenic
952675528 3:36025964-36025986 ATCTTGTCAATGAGGAGCACAGG + Intergenic
956098443 3:65742132-65742154 ATCAAGTCCAAGAAGAACAAAGG + Intronic
956987816 3:74723495-74723517 ATCTTTCCCAAGAGAATCCAGGG + Intergenic
962688494 3:137869664-137869686 ATCTTGTCCAAGACTATCAAGGG + Intergenic
966967245 3:185006186-185006208 ATCTTATGCAAGAAAATCAAAGG - Intronic
967101613 3:186220722-186220744 CTCTTGTCCCAGAGTAACAAAGG + Intronic
970071093 4:12161328-12161350 ATCTTGTCCAAGACCTTCAAGGG - Intergenic
975200540 4:71583022-71583044 TTCTTGTAAAAGAGGCTCAAGGG + Intergenic
978633793 4:110779595-110779617 ATTTTGGCTAAGAGGATAAAAGG + Intergenic
978984744 4:114997905-114997927 ATCTTTTTGAAGAGGATTAAAGG + Intronic
979754208 4:124319964-124319986 AGCTTGACCAAGAAGAACAAGGG - Intergenic
981148111 4:141349497-141349519 ACCTTCTCCAAGGGGAGCAATGG - Intergenic
982394212 4:154898335-154898357 ATCTGGTCCAAGAGGAACCTAGG - Intergenic
984775869 4:183481394-183481416 ATCCTGACCAAGAGGCACAATGG - Intergenic
986021502 5:3808705-3808727 ATCATGTCAAAAAGGATCAATGG + Intergenic
987327462 5:16825368-16825390 ATCCTGACCAAGAGGTTCCAGGG - Intronic
988103692 5:26715282-26715304 ATGTTTTTCAAGTGGATCAATGG - Intergenic
992011101 5:72528663-72528685 AAATTGTCCAAGAACATCAAGGG + Intergenic
993701318 5:91122274-91122296 TTCTTGTTCAAGAACATCAAAGG - Intronic
994104110 5:95926540-95926562 ATCTTGCTAAAGAGGAACAATGG - Intronic
994788891 5:104199328-104199350 ATCTTGTCCCAAAGGAACAAAGG + Intergenic
995268525 5:110194206-110194228 ATCTTATCCAAGATCATCAAGGG - Intergenic
997790508 5:136755382-136755404 CTCTTGTCCCAGAGCATCACTGG + Intergenic
999894061 5:156009400-156009422 ATCTTGGCCAAGTGGCTCAGTGG + Intronic
1002495648 5:179609593-179609615 TTCTTTCCCAAGAGTATCAAAGG + Exonic
1004913696 6:20311798-20311820 ATCTTGTCCAGAAGGAAGAAAGG - Intergenic
1004986988 6:21093559-21093581 AACTTCTTCAAGAGGATGAAAGG + Intronic
1006598618 6:35211629-35211651 ATCTGGTCCAAGAGGAAAAGAGG + Intergenic
1010686939 6:78864284-78864306 ATACTTTCCAAGAGGATCAGAGG - Intergenic
1012289372 6:97433999-97434021 ATCTTACCCTACAGGATCAATGG + Intergenic
1012679060 6:102154872-102154894 AACTTGTCCAAAATCATCAAGGG + Intergenic
1015391519 6:132687462-132687484 ATCTTCACCATGAGGATAAAGGG + Intronic
1016428201 6:143956398-143956420 ATCTTATCCAAGAGGAGCTGGGG - Intronic
1029250918 7:99235859-99235881 ATTTTGTCCAATAGGACCACAGG + Intergenic
1030479019 7:110078496-110078518 ATCATGTCAAAGTGGATTAAAGG - Intergenic
1031198474 7:118646951-118646973 GACTTGGCCAAGAGGATGAATGG + Intergenic
1031401068 7:121327061-121327083 AGCTTCTCCAAGAGGGACAATGG - Intronic
1031493384 7:122417363-122417385 ACCTTGTCACAGAGGAGCAATGG - Intronic
1031594155 7:123628453-123628475 ATCTTGACCATTAGGATCATGGG - Intronic
1035066675 7:156110117-156110139 ACTCTGTCCAAGAGGGTCAAGGG - Intergenic
1036820695 8:11937092-11937114 ATCTTGTTCATAAGGTTCAATGG + Intergenic
1036906752 8:12713742-12713764 ATCTTGTTCATAAGGTTCAATGG + Intergenic
1042219692 8:66461246-66461268 ATATTGGCCAAGAGGACTAAAGG - Intronic
1042765002 8:72311795-72311817 CTCATGTGCAAGAGTATCAAAGG + Intergenic
1043079466 8:75747827-75747849 ATCTTGTGCAAAAGGATGTATGG + Intergenic
1044799355 8:95937662-95937684 CTCTTGTGAAATAGGATCAAGGG - Intergenic
1047188745 8:122659078-122659100 GTCATTTACAAGAGGATCAAGGG - Intergenic
1047578625 8:126187183-126187205 ACCTTGCCCAAGAGAATTAAAGG - Intergenic
1047655455 8:126972212-126972234 ATTTTATCCAAAAGGAACAATGG + Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1050125275 9:2350396-2350418 ATTGTCTCCAAAAGGATCAAAGG - Intergenic
1056064787 9:82923037-82923059 ATGTTGGCCAATAGGATCATTGG - Intergenic
1058924697 9:109651356-109651378 ATCAAGTCCCAGAGGAGCAAAGG - Intronic
1062438055 9:136555639-136555661 GTCTTGTCCATGAGGATTCAAGG - Intergenic
1188930250 X:36100573-36100595 ATCTTGTCCACTAGGACCAATGG + Intronic
1189713617 X:43841605-43841627 ATCTTGTACAAAAAGAACAAAGG + Intronic
1191008037 X:55731558-55731580 ATCTGGTACAGGAGGATCAACGG + Exonic
1192822289 X:74657896-74657918 CTCTTGTTCAAGACCATCAAAGG - Intergenic
1193236371 X:79112701-79112723 ATCTTGTCCATAAGGGTCAGTGG + Intergenic
1196233387 X:113252233-113252255 ATCTTGTCCAAGATCATCAAGGG - Intergenic
1198607897 X:138363724-138363746 ATCATATCAATGAGGATCAAGGG - Intergenic