ID: 933194349

View in Genome Browser
Species Human (GRCh38)
Location 2:79371626-79371648
Sequence CCTACTTTGCAGGAGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933194336_933194349 26 Left 933194336 2:79371577-79371599 CCCAAGAAAATGAGTTGGCCTGA 0: 1
1: 0
2: 2
3: 16
4: 176
Right 933194349 2:79371626-79371648 CCTACTTTGCAGGAGGAACATGG 0: 1
1: 0
2: 2
3: 24
4: 212
933194337_933194349 25 Left 933194337 2:79371578-79371600 CCAAGAAAATGAGTTGGCCTGAG 0: 1
1: 0
2: 2
3: 13
4: 161
Right 933194349 2:79371626-79371648 CCTACTTTGCAGGAGGAACATGG 0: 1
1: 0
2: 2
3: 24
4: 212
933194342_933194349 8 Left 933194342 2:79371595-79371617 CCTGAGAAAGGTTAGGGTAGGAA 0: 1
1: 0
2: 1
3: 18
4: 175
Right 933194349 2:79371626-79371648 CCTACTTTGCAGGAGGAACATGG 0: 1
1: 0
2: 2
3: 24
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933194349 Original CRISPR CCTACTTTGCAGGAGGAACA TGG Intronic
903304864 1:22406300-22406322 CCCACTTTGCAGTAAGAAGATGG + Intergenic
904774069 1:32895997-32896019 ACTCCTTGGCTGGAGGAACAGGG + Intronic
907971314 1:59384315-59384337 CCACCTTTGCAAGAGGAACCTGG - Intronic
912977152 1:114341182-114341204 CCTACTGTGTGGAAGGAACATGG + Intergenic
912982290 1:114386533-114386555 GCTAGTTTGCAGGAGAACCAGGG - Intergenic
913158133 1:116120213-116120235 CCTACGTCAGAGGAGGAACATGG + Intronic
915134867 1:153723925-153723947 TCTATTTTGCAGTAGAAACAGGG - Intergenic
916140110 1:161689489-161689511 TGTACTTAGCAGGAGGAATAGGG + Intergenic
916203980 1:162297777-162297799 TGTACTTAGCAGGAGGAATAGGG - Intronic
916925920 1:169520848-169520870 TGTACTTAGCAGGAGGAATAGGG - Intronic
919401712 1:197126517-197126539 TCCACTTTCTAGGAGGAACAAGG - Intronic
920305567 1:205016143-205016165 CCTGCTTTGCAGAAGGGAAATGG - Intronic
922927892 1:229365662-229365684 CCAACGTTGGAGGAGGAACCTGG + Intergenic
923439903 1:234007402-234007424 CCTTCTCCGCAGGAGGAACTTGG - Intronic
1063697957 10:8356193-8356215 CCTTCTTTAAAGGAGTAACAAGG - Intergenic
1063946397 10:11180399-11180421 CCTCATCTGCAGGATGAACAGGG + Intronic
1066055796 10:31678926-31678948 CCTACTTTTCTGGAGGAATGGGG - Intergenic
1071318046 10:84422132-84422154 CTCACTTTGCAGAAGGAAGAAGG + Intronic
1074535192 10:114324084-114324106 CCTACTATGCAGGTGGAATAAGG - Intronic
1075106061 10:119540906-119540928 CCCACTTTGCAGGTGGAGAAAGG + Intronic
1075702464 10:124478260-124478282 CCTGCTTTGTAGGATGATCAGGG + Intronic
1076809977 10:132881420-132881442 CCTCCTTTCCAGCAGGGACATGG - Intronic
1077424094 11:2466362-2466384 CCTACTTTGCAGGAGGAGGGGGG + Intronic
1079432607 11:20408464-20408486 CTTAATTTGAAGGAGGTACATGG - Intronic
1080404861 11:31970204-31970226 CTTATTTTGCAGGAGAAACTAGG + Intronic
1081995618 11:47361827-47361849 CCTGCTTTGCAGTATGACCATGG + Intronic
1085874209 11:80386570-80386592 TCAACTTTGCAGCAGGAAGAAGG - Intergenic
1088970075 11:114766180-114766202 CCTGCATTGCAAGATGAACAAGG - Intergenic
1089053823 11:115568251-115568273 CATTCTTCGCAGGAGGAATAGGG - Intergenic
1089734083 11:120537743-120537765 TCTACTTTGCAGGTGGCACTGGG - Intronic
1089967941 11:122669241-122669263 CATTCTTTCCAGGAAGAACACGG - Intronic
1090828958 11:130407687-130407709 CTTACTCTGCAGGAAGTACATGG + Intronic
1091605396 12:1947367-1947389 ACTACTTTGCAGGAAAAAGAGGG - Intronic
1092181692 12:6450979-6451001 CCTTCGTTGATGGAGGAACAGGG - Exonic
1095733148 12:45527340-45527362 CCATTTTTGCAGGAGTAACATGG - Intergenic
1098103740 12:67046846-67046868 CCTACTTTAAAAGAGGAAAACGG + Intergenic
1100300745 12:93305323-93305345 TGTACTTTGCAGAAGGAATAGGG - Intergenic
1100373504 12:93991154-93991176 CATACTTTGCGGGAGGACCCTGG - Intergenic
1103136333 12:118511014-118511036 CCTACTATGCACCAGGCACAAGG - Intergenic
1104033252 12:125080282-125080304 CCCACTTTACAGGAGAAACCAGG - Intronic
1104576852 12:129973873-129973895 TCTACTTAGCAGGAGGAATAGGG - Intergenic
1104872295 12:132008697-132008719 CCTCCTGGGCAGGAGGATCAAGG + Intronic
1105296819 13:19095079-19095101 CCTTTTTTGAAGGAGGAACTGGG - Intergenic
1106891964 13:34255371-34255393 ACTCCTTTGCTGGAGGAGCAGGG - Intergenic
1107043735 13:35974481-35974503 CCAATTTTGGAGGAGGGACATGG + Intronic
1110246932 13:73336698-73336720 TCTAGTTTGCAGCAGGAAAATGG - Intergenic
1110427726 13:75388071-75388093 CCGGCTTTGCAGGTGGAAGAAGG - Intronic
1110523620 13:76509638-76509660 AGTACTTAGCAGGAGGAATAGGG - Intergenic
1110636615 13:77774410-77774432 CCTACTTTGCATGAGCTACGAGG - Intergenic
1111902588 13:94218206-94218228 CCCATTTTACAGGAGGAAAAGGG - Intronic
1112809102 13:103197024-103197046 CCTGCTTTGCAGGTGGGAGATGG + Intergenic
1113662429 13:112116760-112116782 CCTTCCTTACAGGAGGGACAGGG - Intergenic
1114649222 14:24273005-24273027 CCTTCTTTGCAGTAGGCACAGGG - Intergenic
1114654765 14:24309646-24309668 GCTAGGTTCCAGGAGGAACAGGG - Intronic
1115185521 14:30683770-30683792 CCTACTTCTCAGGAGGTACAGGG - Intronic
1115366493 14:32563324-32563346 TCTCCTTTGCAGGAGGAAACTGG - Intronic
1116648369 14:47559392-47559414 TGCGCTTTGCAGGAGGAACATGG - Intronic
1119272143 14:73316414-73316436 CTTCCTTTCCTGGAGGAACAGGG + Exonic
1120183669 14:81370384-81370406 CTTTCTTTGCAGGTGGAATATGG - Intronic
1121698263 14:95930449-95930471 CCAACTTTTCTGGAGGAAAATGG - Intergenic
1121743602 14:96270633-96270655 CCTACTTTTCAGGAGCTTCAGGG + Intergenic
1123121724 14:105919840-105919862 CCTGCATTGCTGGAGGGACAGGG - Intronic
1123404429 15:20011491-20011513 CCTGCATTGCTGGAGGGACAGGG - Intergenic
1123513762 15:21018138-21018160 CCTGCATTGCTGGAGGGACAGGG - Intergenic
1124054032 15:26225087-26225109 CCTTCCTTGCATGAGGGACAGGG - Intergenic
1124106025 15:26738750-26738772 CTCACTTTCCAGGAGGACCAGGG + Intronic
1124247834 15:28085796-28085818 TGTACTTAGCAGGAAGAACAGGG - Intronic
1125279083 15:38025500-38025522 TTTACTTAGCAGGAGGAATAGGG + Intergenic
1126870123 15:52978504-52978526 CCTTCTTTGCATGTGGAACCTGG + Intergenic
1127357792 15:58217511-58217533 CCTGCTTTGGAGGTGGGACATGG - Intronic
1129008495 15:72395218-72395240 CCTACTTATCAGTGGGAACATGG - Intergenic
1129229932 15:74191431-74191453 CCTCCTTTGCAGGAAGAAGCTGG - Exonic
1134363793 16:13557602-13557624 GCCACTTCTCAGGAGGAACATGG + Intergenic
1135871825 16:26158281-26158303 CCTACTTTTCAAGAGGAGCCGGG - Intergenic
1137232937 16:46585306-46585328 CGTACCTAGCAGGAGGAATAGGG - Intronic
1140767059 16:78169750-78169772 CGTTGTTTGCAGGAGGAAAAGGG + Intronic
1142119559 16:88379300-88379322 CCTGCTTTCCAGGAGGAAACTGG - Intergenic
1142802077 17:2352554-2352576 CCTAGTTTGCTTGAGGTACAGGG - Intronic
1143114775 17:4576325-4576347 CCTGCTTTGGAGGAGGAAGATGG + Intergenic
1143287608 17:5801911-5801933 CCAGCTCTTCAGGAGGAACATGG + Intronic
1144102718 17:11957392-11957414 TATACTTAGCAGGAGGAATAGGG - Intronic
1146234664 17:31146950-31146972 CCTTTTTTGAAGGAGGAACTGGG + Intronic
1146479818 17:33196174-33196196 CCTATTTTGCAAGTGGAACTTGG + Intronic
1146560445 17:33864415-33864437 CCTATTTGGCAGGTGAAACAGGG + Intronic
1148184785 17:45634240-45634262 CCTGTTTTGGAGGAGGAAAAGGG + Intergenic
1150436233 17:65156436-65156458 TCACCTGTGCAGGAGGAACAAGG - Intronic
1153754421 18:8265435-8265457 CCAACCTTGCAGCAGGAAGAAGG + Intronic
1156025137 18:32645025-32645047 TGTATTTTGCAGGAGGAATAAGG + Intergenic
1156174522 18:34527500-34527522 CCTTCTCTGTAGGAGGCACAGGG - Intronic
1157003287 18:43552277-43552299 CACACTTGGCAGGAGGGACAGGG - Intergenic
1158909488 18:62046109-62046131 TGTACTTAGCAGGAGGAATAAGG - Intronic
1160799203 19:960015-960037 CCTCCAGTGCAGGAGGGACATGG + Intronic
1161085669 19:2333829-2333851 CCCACTTCGCAGGAGGGAGAAGG - Intronic
1161503913 19:4633762-4633784 ACATCTTTGCAGGAGGCACAGGG - Intergenic
1165808712 19:38597374-38597396 CCTATTCTCCAGGAAGAACATGG - Exonic
1167234117 19:48303531-48303553 CCATCTGTGCTGGAGGAACAAGG - Intronic
1167360882 19:49029800-49029822 CCCACTCTGGAGGAGGAAAAGGG - Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
926223328 2:10950395-10950417 CCTACATGGCAGGAGAAAGAGGG - Intergenic
926672246 2:15587422-15587444 CTTACATGGCAGGAGGTACAAGG - Intergenic
927218847 2:20688086-20688108 CCTACTTTGTATTAGGAACCTGG + Intronic
929479949 2:42296184-42296206 CCTACTCTGAAGGAAGTACATGG - Intronic
930277958 2:49335744-49335766 CCTGCTCTGCTGGAGGAACAGGG + Intergenic
931765545 2:65452888-65452910 CCTACTTTGCAGAGGCAACGAGG - Intergenic
932358096 2:71083294-71083316 CCTTCTTTGGGGGAGGGACAGGG - Intergenic
932370435 2:71182861-71182883 CCTTCTTTGGGGGAGGGACAGGG - Exonic
932750909 2:74371166-74371188 TCTCCTTTGCAGGAGGAGGAGGG - Exonic
932970665 2:76537218-76537240 TCTCCTTAGCAGGAGGAATAGGG - Intergenic
933194349 2:79371626-79371648 CCTACTTTGCAGGAGGAACATGG + Intronic
937497886 2:122443443-122443465 CATACTTTGTAGGAGGAACCTGG - Intergenic
938027790 2:127965352-127965374 GCTACTTTGGAGGCAGAACAGGG + Intronic
941266596 2:163370595-163370617 GATACTTTGCAGAAGGATCAAGG - Intergenic
943395664 2:187329542-187329564 CCAATTTTGAAGGAGGAACCTGG + Intergenic
943753899 2:191538430-191538452 CCTACTGTGGATGAGGTACAGGG - Intergenic
945660755 2:212682430-212682452 CCTAGATGGCAGGAGAAACATGG + Intergenic
947284241 2:228493975-228493997 ACTCCTTTACAGGAGGAATAAGG - Intergenic
948700441 2:239756444-239756466 CCTCCTTCGCAGGAGACACACGG + Intergenic
1168946554 20:1764558-1764580 CCTACTTAGCCTGAGGCACAGGG - Intergenic
1170617612 20:17967068-17967090 CCAATTTTGCTGGAGGATCAGGG + Intronic
1172701421 20:36855775-36855797 CCCATTTTACAGGAGGAAGACGG + Intronic
1173554728 20:43957973-43957995 CCAATTTTGGAGGAGGGACATGG - Intronic
1174298785 20:49567840-49567862 CCTTCTTGGCAGGGGGAGCACGG + Intronic
1175381258 20:58565995-58566017 CTTCCTTTGCAGGAGGGGCAGGG + Intergenic
1176075990 20:63248417-63248439 CCTGCATTGCAGGAGGCACGAGG + Intronic
1179809199 21:43859447-43859469 CCCACTTTGCAGGAGGAGATGGG + Intergenic
1180164627 21:46017799-46017821 TGTACTTGGCAGGAGGAATAGGG + Intergenic
1181852913 22:25762756-25762778 CTTACTATGCACCAGGAACATGG - Intronic
1184683192 22:46084015-46084037 CCTCCTTAGCAAGAGGAATATGG + Intronic
1184951330 22:47844521-47844543 CCTCCTGTGCAGGAGGGACAGGG + Intergenic
949312103 3:2711502-2711524 CCTACTTTTCTGAAGGAAGAAGG + Intronic
949716728 3:6940712-6940734 TCTATTTTGTAGAAGGAACAAGG + Intronic
952395075 3:32914067-32914089 CCTTCTTTGCATGAGGGACGTGG - Intergenic
952639199 3:35571255-35571277 CATGCTTTGCAGGGAGAACAAGG + Intergenic
953467966 3:43141014-43141036 TGTACTTAGCAGGAGGAATAGGG - Intergenic
953864538 3:46572878-46572900 CCTTCTTTGCTGGGGGAAGAGGG + Intronic
957254016 3:77813423-77813445 ACTACTCTGCAGGAGGAGGAAGG + Intergenic
957297408 3:78350726-78350748 CCTACTTTAAAGGAAGAACAGGG + Intergenic
965124802 3:164612404-164612426 CCTTTTTTGCAGGAAGAAAAAGG - Intergenic
967853553 3:194099941-194099963 CCTACTGTTCAGGTGTAACATGG - Intergenic
968762411 4:2449533-2449555 CCTGCATTGGAGGAGAAACAGGG - Intronic
968969557 4:3786520-3786542 CCCACTTTCCAGGAGGGACCTGG - Intergenic
969046581 4:4340878-4340900 CCTACTTGGCAGCAGCCACATGG - Intergenic
969116529 4:4873784-4873806 CCTTCATTCCAGGAGGAACAGGG + Intergenic
971201634 4:24514614-24514636 ATTACTTTGCAGGGGGAAAATGG - Intergenic
973042567 4:45489675-45489697 CCTACTATACATGAGGAATATGG + Intergenic
973794755 4:54413255-54413277 TGTACTTAGCAGGAGGAACAGGG + Intergenic
975033121 4:69648662-69648684 CTTATTTTGCTGTAGGAACATGG - Intronic
976203702 4:82604378-82604400 CCTCCTTGGCAGGAACAACAGGG - Intergenic
976468970 4:85404913-85404935 GCTGCTTTGGAGGAGGAACAAGG - Intergenic
977656123 4:99522740-99522762 CCTTGTTTGCAGGAGGCATAAGG - Intronic
978312564 4:107401237-107401259 CCTAATTTGCAGCATGCACATGG - Intergenic
979808948 4:125011744-125011766 CCCACTCTGCAGGAATAACAGGG + Intergenic
983020658 4:162671710-162671732 CCCAATTTGAGGGAGGAACATGG + Intergenic
985126704 4:186701750-186701772 CCTACTTTATATGAGGAAAAGGG + Intronic
985239519 4:187915440-187915462 TGTACTTTGCAGGAAGAACATGG + Intergenic
986312035 5:6557934-6557956 CCTAGTTGACAGTAGGAACAAGG - Intergenic
986369425 5:7065164-7065186 TCCACTTTGTGGGAGGAACACGG + Intergenic
987186944 5:15431136-15431158 CATACTTAGCAGGAAGAATAGGG + Intergenic
989415226 5:41167388-41167410 CCTACTTTTGAGAAGGAAAATGG - Intronic
989533364 5:42534852-42534874 CCATCCTTGCAGGAGCAACATGG + Intronic
990618071 5:57528320-57528342 ACTACATTTTAGGAGGAACAAGG - Intergenic
994709708 5:103252479-103252501 TGTACTTTGCAGGAGGAATAGGG + Intergenic
994997321 5:107080173-107080195 CTTACTTTGAGGGAGGAAGATGG - Intergenic
995708243 5:115007688-115007710 CTTACTTTGGAAGAGGAAGAAGG + Intergenic
995892304 5:116968086-116968108 TGTACTTTGCAGGAGGCATAAGG + Intergenic
997435011 5:133867683-133867705 CCTACTTTGCAGATGGGAAATGG + Intergenic
1001078926 5:168652609-168652631 CCTGCTTTGCAGGTGGAACCTGG + Intergenic
1001213163 5:169829908-169829930 TCTACTTTCCAGGAAGAACAGGG - Intronic
1003203161 6:3981906-3981928 AATACTTTGCAGTAGGAAAATGG - Intergenic
1005118501 6:22364616-22364638 GCTGCTTTGCAGGGGGATCAAGG - Intergenic
1005620103 6:27612163-27612185 CCTTCTTTGTAGGATGAAAAGGG - Intergenic
1006471882 6:34234257-34234279 CCTACTCTGTAGCAGGAACTGGG - Intergenic
1007038045 6:38696054-38696076 TGTACTTAGCAGGAGGAATAAGG + Intronic
1007243956 6:40446782-40446804 TCTAGTTTGAAGGAGAAACAAGG - Intronic
1008168238 6:48167644-48167666 TATACTTAGCAGGAAGAACACGG - Intergenic
1009048880 6:58256912-58256934 CCTAATATACAGGGGGAACAAGG - Intergenic
1011693991 6:89895604-89895626 CATCCTTTGCAGTAGGAACCTGG + Exonic
1012043062 6:94234670-94234692 TGTACTTAGCGGGAGGAACAGGG - Intergenic
1012861356 6:104563585-104563607 CCCACTATGCAGCAGGAATATGG + Intergenic
1012919749 6:105209285-105209307 ACTACTTTGTATGATGAACAAGG + Intergenic
1013394150 6:109717650-109717672 TGTACCTTGAAGGAGGAACAAGG + Intronic
1015195116 6:130517164-130517186 CCTACTATGTATCAGGAACAGGG - Intergenic
1015511835 6:134045417-134045439 GCTTCTTTCCAGGAGGAACCTGG + Intronic
1016530468 6:145053658-145053680 CCTACTGTCCAGTTGGAACATGG + Intergenic
1017099162 6:150832221-150832243 CTTACTTTGGAGAAGGAAGAAGG - Intronic
1017756087 6:157530969-157530991 CCTACTTTGCAAAAGAAAGAAGG + Intronic
1018894761 6:168006022-168006044 CCTTCAGTGCAGGAGGAAGAGGG + Intronic
1019608227 7:1920945-1920967 CGAGCTTTGCAGGAGGAGCAGGG - Intronic
1020820796 7:12964825-12964847 TCCATGTTGCAGGAGGAACAAGG + Intergenic
1024135077 7:46398545-46398567 CCAACTTTGCAGCAGGAATATGG - Intergenic
1025823630 7:64993734-64993756 CCTAACTTGAAGGAGGACCATGG + Intronic
1025918510 7:65887695-65887717 CTAACTTTGAAGGAGGAGCAAGG - Intronic
1027986952 7:85305174-85305196 CCTATTTGGAAGAAGGAACAGGG - Intergenic
1029159400 7:98541002-98541024 CCCACTTTGCAGGATGACCCTGG + Intergenic
1029259783 7:99294006-99294028 CCTCATTTGCAGGAGGAAGCTGG + Intergenic
1030625534 7:111842120-111842142 TGTACTTAGCAGGAGGAATAGGG - Intronic
1031192436 7:118570986-118571008 CTTACTTGGCAGGAGGAGAAAGG + Intergenic
1031999298 7:128254385-128254407 ACTGCTATGCAGGAGGAAGAGGG - Exonic
1032331407 7:130984099-130984121 CCTATTTTGCAGGAGGAAAATGG - Intergenic
1034278435 7:149834879-149834901 GGCTCTTTGCAGGAGGAACAGGG - Intergenic
1035361624 7:158317342-158317364 ATTACTTTGCAGGAGCTACAAGG + Intronic
1035373395 7:158393038-158393060 CCTTCTCTGCAGCAGGCACAGGG - Intronic
1035546647 8:486876-486898 CCTATTGTGCATGAGGAACAAGG + Intergenic
1035672955 8:1434093-1434115 GCTGCTTTGCAGGTGGAGCATGG + Intergenic
1035985883 8:4431403-4431425 CTTAGATTGAAGGAGGAACAAGG + Intronic
1041171099 8:55142426-55142448 CCTGCTTTTCAGGAGGACCTGGG - Intronic
1041282604 8:56226448-56226470 CCTACTTTGTAGGTGCAAGATGG + Intergenic
1041506817 8:58608447-58608469 CCTACTTGGGAGGAGGACCACGG - Intronic
1043803689 8:84643889-84643911 CCTGCATTTCAGGAGGATCATGG - Intronic
1044529872 8:93294797-93294819 CCTTATTTGCAGGAGCAGCATGG + Intergenic
1046522508 8:115343453-115343475 CCTTTTTTGCAGAAGGAAAATGG - Intergenic
1047654569 8:126962996-126963018 CATACTTTGCTGGAGGAAAGGGG - Intergenic
1047938680 8:129806657-129806679 CCTAATTTGGAGGTGGAACTTGG + Intergenic
1048875178 8:138831569-138831591 CATGCTTTGCAGGATGAGCAGGG + Intronic
1049308771 8:141922333-141922355 CATACTTCGCAGGAGGAGCATGG + Intergenic
1049818668 8:144621000-144621022 CCTGCTTTGCAGGAGGCACATGG + Intergenic
1049848869 8:144820191-144820213 CCTCCTTTGCAGGTGAGACACGG - Intergenic
1050689948 9:8215137-8215159 TCTCCTTTGCAGGAGGAAACTGG - Intergenic
1051259787 9:15251916-15251938 CCTACTATGCACCAGGCACAGGG + Intronic
1051848173 9:21476511-21476533 CCTACTTTGTAGTAAGGACATGG - Intergenic
1051899533 9:22024304-22024326 TCTACTTTGTTGGAGGACCAAGG + Intronic
1052518713 9:29514989-29515011 CCTGCTCTGCAGGTGGAACCTGG + Intergenic
1056308349 9:85313686-85313708 TCTATTTTGCAGGAGGAATAAGG - Intergenic
1058291695 9:103249973-103249995 TATACTTTACAGGAGGAATAGGG + Intergenic
1058873315 9:109220972-109220994 CCTACTTTGCAGGAGAAGCTTGG + Intronic
1059647736 9:116283956-116283978 CCTACTTCTCAGGTGGAAAAAGG - Intronic
1059901285 9:118928939-118928961 GCTGCTTTGCAGGAGAAAGAAGG + Intergenic
1060184252 9:121554204-121554226 CCAACTTTGCAGGAGGAGGCAGG + Intergenic
1060725480 9:126003137-126003159 CCGACTTTTCAGGAGGTGCAGGG + Intergenic
1060788935 9:126472494-126472516 CCTATTTTAAAGGAGGAAAAAGG - Intronic
1187236924 X:17476310-17476332 ACTACTTTCCAGGAGGAAAAGGG - Intronic
1187551197 X:20307210-20307232 GCTACCTTTGAGGAGGAACAAGG + Intergenic
1187554459 X:20338707-20338729 CCTGGGTTGGAGGAGGAACAGGG + Intergenic
1188875587 X:35426462-35426484 CCAAATTTGGAGGAGGAACCTGG + Intergenic
1188934626 X:36158730-36158752 CTTATATTGCAGGAGGATCATGG + Intergenic
1190576675 X:51846364-51846386 CCTACTTTGAAGATGGAAGATGG + Intronic
1194869737 X:99114352-99114374 ATTAGTTTGCAGGAGGAAAAAGG - Intergenic
1195005167 X:100678574-100678596 CCTCCTTCCCATGAGGAACAAGG - Exonic
1200924533 Y:8642526-8642548 CCCACTTGGTATGAGGAACAAGG - Intergenic