ID: 933197860

View in Genome Browser
Species Human (GRCh38)
Location 2:79412780-79412802
Sequence ATTGAGAAGGAGAAACTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 594
Summary {0: 1, 1: 0, 2: 8, 3: 49, 4: 536}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933197860 Original CRISPR ATTGAGAAGGAGAAACTGGA TGG Intronic
900979076 1:6035913-6035935 ACTGAGAAGGAGTGGCTGGAGGG + Intronic
901547724 1:9971637-9971659 ATTGGGAATGAGAATGTGGAAGG + Intronic
902103409 1:14012865-14012887 ATTGTAAAGGAGAAAATGAAAGG - Intergenic
903271047 1:22188485-22188507 TTTGTGAAGGAAGAACTGGAGGG - Intergenic
903404867 1:23087903-23087925 ATGGAGAAGGAGGAACAGGAGGG + Exonic
903614100 1:24639650-24639672 ATTGAGAATGGGAAACCAGAAGG + Intronic
903670188 1:25030931-25030953 AGTGAGAAGGAGAACTTGGTTGG - Intergenic
904164644 1:28546004-28546026 ATTAAGAATGAGATACTGGCCGG - Intergenic
905552737 1:38857192-38857214 TTTGAAAAGTAGAAACTGAATGG + Intronic
906529105 1:46512978-46513000 AGAGAGAAGGAGAAACAGAAGGG - Exonic
907619560 1:55962655-55962677 AGAGAGAAAGAGAAATTGGAAGG - Intergenic
908384385 1:63627311-63627333 ATTTAGAAAGATAAACTAGATGG + Intronic
908539958 1:65112869-65112891 ATTGAGAAGTAGGACCAGGATGG + Intergenic
908738475 1:67302384-67302406 TTTGGGAAGGAGAGACTGGAGGG + Intergenic
909103041 1:71375016-71375038 ACTGAAAAGGAAAAAATGGAGGG - Intergenic
910354330 1:86338745-86338767 ATTGAAAAGGAGAAATAAGATGG - Intergenic
910919668 1:92330103-92330125 ATGAAGAATAAGAAACTGGACGG - Intronic
910990763 1:93053554-93053576 ATTGAGAAGGTGAAAAAGGAAGG - Intergenic
912249238 1:107993644-107993666 AATGAGAGGGGGAAACTGGATGG - Intergenic
912572580 1:110635353-110635375 ATTGAGACAGAGATACTGGAAGG + Intergenic
912933203 1:113982303-113982325 GTTGGGAGGGAGAAACTGGATGG - Intergenic
913403777 1:118465072-118465094 ATTGAGAGGTAGGAAATGGAGGG - Intergenic
915011958 1:152695808-152695830 TTTGAGCAGAAGAAACTGGTGGG - Intergenic
915912662 1:159924315-159924337 AGTGGGGAGGAGAAACTGGGAGG + Intronic
916376215 1:164156232-164156254 ATTGGGAAGAAGAAAATGGTAGG + Intergenic
916704805 1:167338175-167338197 GCTGAGAAGGAGGAACAGGAGGG - Intronic
916992815 1:170263095-170263117 GTTGAGAAGGAGAAAATGGCTGG - Intergenic
917261953 1:173179361-173179383 ATTTAGAAGGTGAAAGTGAAGGG - Intergenic
917751163 1:178054863-178054885 ATTGAGCAGCAAAAAATGGATGG - Intergenic
917846385 1:179024038-179024060 ATGGAGAAGGGAAAACTGGGGGG + Intergenic
917979450 1:180259993-180260015 ATTGAGAGGGAGGGCCTGGAAGG + Intronic
918083776 1:181227988-181228010 ATGAAGAAGGAGAAATGGGATGG - Intergenic
918832951 1:189422230-189422252 ATGGAGAAGGATAAAATGTATGG + Intergenic
919364003 1:196633776-196633798 AATGAGAATGAGAAACTCCAGGG + Intergenic
919493688 1:198237435-198237457 ACTGAGAAGGAGAAGATGGTGGG - Intronic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920545953 1:206818580-206818602 ATAGAGCAGGAGAAACTGCTGGG + Intronic
920737902 1:208551792-208551814 ACTGAGAAAGAGAAACAGAAAGG + Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921903174 1:220469250-220469272 ACTGAAAAGGAGAAATTGCATGG + Intergenic
922907547 1:229185863-229185885 GTTAAGAAGCAGACACTGGATGG + Intergenic
924202845 1:241678037-241678059 TTTCAGAAGGAGAAACAGGGAGG + Intronic
1063271829 10:4517684-4517706 ATTGATAAAGAGAAAATGAAGGG - Intergenic
1063596385 10:7439652-7439674 AATGAGAAGGAGAAACTGCAAGG - Intergenic
1063862498 10:10326708-10326730 ATTGAGGTGGAGAAGCTGGTGGG - Intergenic
1064334535 10:14426689-14426711 ATTGAGAAGGAGAAAAATGGTGG - Intronic
1064479420 10:15724675-15724697 ACTGATTAGTAGAAACTGGATGG + Intergenic
1065639799 10:27770269-27770291 AGAGAGAAAGAGAAAATGGAAGG - Intergenic
1068040847 10:51822632-51822654 ACTGAACAGGAGAAACTGGTGGG - Intronic
1068800249 10:61132392-61132414 AAAGAGAAGGAGAAACTAGGAGG + Intergenic
1069633398 10:69911191-69911213 ATTGAGAAGGGGCAAGGGGAAGG - Intronic
1070144181 10:73761699-73761721 AGTGAGAAGGAGAGTCTGGTTGG + Intronic
1070737071 10:78870460-78870482 AATAAGAAGGAGAATCTGGGAGG + Intergenic
1070744565 10:78925481-78925503 AGGGAGAAGGAGAAAAAGGAGGG + Intergenic
1071265676 10:83962827-83962849 TATGAGAAGGAGAGACTGCATGG + Intergenic
1071923548 10:90378480-90378502 TTGGGGAGGGAGAAACTGGATGG - Intergenic
1072323668 10:94275182-94275204 AATGAGAAGGAGGAAAAGGAAGG - Intronic
1072842514 10:98790338-98790360 ACTCAGAAGGTGGAACTGGAGGG + Intronic
1073535508 10:104273162-104273184 ATCAAGAAGGACAAATTGGATGG - Intronic
1074790596 10:116882888-116882910 AACGGGTAGGAGAAACTGGAAGG + Intronic
1075918685 10:126191483-126191505 ACTGGGAAGGAGGAGCTGGATGG + Intronic
1076002972 10:126927020-126927042 ATTGAGAAGGAGAGACTTGTAGG + Intronic
1076143962 10:128102147-128102169 CTTGAGAAGGGGAAACTGTCTGG - Intronic
1076831868 10:132999426-132999448 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076831894 10:132999514-132999536 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076831920 10:132999602-132999624 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1077198053 11:1291402-1291424 ACTGGGAAGGAGGAACTGGCGGG - Intronic
1077587652 11:3466244-3466266 TTTGAGAAAGAGAAAAAGGAAGG - Intergenic
1077831740 11:5880049-5880071 ACTGAGAAGGAGAATCTTGGTGG + Intronic
1077849272 11:6058682-6058704 AATGAGATGGAGAAAATGGTGGG - Intergenic
1077866402 11:6224880-6224902 TTTGAGATGGAGAAAGTTGAAGG - Intronic
1077922591 11:6652881-6652903 GGAGAGAAGGAGAAAGTGGATGG - Intronic
1078690641 11:13576894-13576916 ATGGAGGATGAGGAACTGGATGG - Intergenic
1078811987 11:14777294-14777316 TTTGAGAAGGAGAAAGGGGGTGG + Intronic
1079452514 11:20609614-20609636 AGAGAGAAGGTGAGACTGGAAGG - Intronic
1079615358 11:22486108-22486130 AAGGAGAAGGAGAAAGTGCAAGG + Intergenic
1079902145 11:26199855-26199877 ATTGAGAAAGAGACAAAGGAAGG - Intergenic
1079932008 11:26575433-26575455 ATTTTGAAGTAGAAATTGGATGG + Intronic
1080017363 11:27521589-27521611 ATTGATAAGGACAAAGTTGAGGG - Intergenic
1080281954 11:30567519-30567541 TATGAGAATAAGAAACTGGAGGG - Intronic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1083451538 11:62749272-62749294 TTTGAAGATGAGAAACTGGAAGG - Intronic
1083991190 11:66246724-66246746 ATTGTGAGGAAAAAACTGGAAGG - Intergenic
1084243354 11:67837911-67837933 TTTGAGAAAGAGAAAAAGGAAGG - Intergenic
1084457473 11:69276640-69276662 CTTGAGAGGCAGAAGCTGGAGGG - Intergenic
1084829345 11:71756676-71756698 TTTGAGAAAGAGAAAAAGGAAGG + Intergenic
1085750528 11:79157040-79157062 GTTGAGAAGGAGGACCTGAAGGG + Intronic
1087756586 11:102060659-102060681 ATTTAGAAGGAGAATCTGATTGG + Intronic
1088774992 11:113074027-113074049 ATTTAGAAGGAGAAACACGTCGG + Intronic
1088940589 11:114451354-114451376 ACTGAGAAGGAGAAAGGGGAGGG - Intergenic
1089976625 11:122737803-122737825 GTTGAGCAGGAGAAACTGGAGGG + Intronic
1090069815 11:123534321-123534343 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1090259284 11:125306980-125307002 ACAGAGAAGGAGAAACGGGGAGG - Intronic
1090339086 11:125999658-125999680 AATGAGAAGGAGAAAGATGATGG - Intronic
1090982147 11:131732520-131732542 TTTCAGAAGGGGAAATTGGAAGG + Intronic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1092228628 12:6764916-6764938 AGTCAGAAAGAGAAACTGGGAGG + Intronic
1092239443 12:6828175-6828197 AATAAGAGGGAGAAACTGGGAGG - Intronic
1092413897 12:8275013-8275035 TTTGAGAAAGAGAAAAAGGAAGG - Intergenic
1093396523 12:18690059-18690081 ATTGAGAAAGTGAAGGTGGAAGG - Intronic
1094404344 12:30098966-30098988 ATTGGGAAGGAGAAACAGTGTGG - Intergenic
1095262496 12:40112869-40112891 ATTGTGAGAGAGAATCTGGAGGG - Intergenic
1096949701 12:55454668-55454690 TTTGATAAGGAGAAAGTAGATGG + Intergenic
1097629234 12:62039487-62039509 ATTGTAAAGCAGAAACTTGATGG + Intronic
1099160160 12:79231155-79231177 ATTTAGAAGCAGAAACCAGAGGG + Intronic
1100409404 12:94300028-94300050 GTTGAAAAGGAGATAATGGAAGG + Intronic
1100760230 12:97798963-97798985 AATTAGGAGGAGAAACAGGAAGG + Intergenic
1101296103 12:103425065-103425087 ACTGGGAAGTAGGAACTGGACGG + Intronic
1101296234 12:103425863-103425885 ACTGGGAAGTAGGAACTGGACGG - Intronic
1101394459 12:104332875-104332897 TTAGAGAAAAAGAAACTGGAAGG - Intronic
1101844091 12:108348724-108348746 ATAGAGAGGGAGAAAGAGGAAGG - Intergenic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1102170364 12:110837804-110837826 ATAGAGAAGAAATAACTGGAAGG - Intergenic
1102364739 12:112322518-112322540 ATTACGAAGGAGAAACAGGAAGG + Intronic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1102596945 12:114000137-114000159 GTTGGGAAGCAGAAACAGGAGGG - Intergenic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1103855116 12:123962623-123962645 ATTCAGAAGGCGGAACAGGATGG + Intronic
1103870025 12:124084771-124084793 GCTGAGAAGGAGAAGCTGGTAGG + Intronic
1104379143 12:128291705-128291727 AGTGAGCAGGGGAAACAGGATGG - Intronic
1105309010 13:19189871-19189893 AATGAGAAGGGGAAAAAGGAAGG - Intergenic
1105528594 13:21198276-21198298 AATGAGAAGGGGAAAAAGGAAGG + Intergenic
1105985858 13:25566522-25566544 ATGGAAAAGGAGAAAGTGGCAGG + Intronic
1106778115 13:33027904-33027926 ATTGTGAAGGATAAAGGGGAAGG + Intronic
1106960803 13:34995154-34995176 ATTAAAAAGGAAAAACTGGCTGG + Intronic
1107148555 13:37086200-37086222 GGTGAGAAGGAGAAAGAGGAGGG + Intergenic
1107292871 13:38876927-38876949 CTTGAGAAGGCAAAACTGGTGGG - Intronic
1108575796 13:51789317-51789339 ATTGAGAAGGAGAAACTCCAAGG + Intronic
1109365391 13:61349272-61349294 TTTGAGAAGGAGAAAATGAGTGG - Intergenic
1109374800 13:61478244-61478266 ATTAAGAAAGAGAAACAGCAAGG - Intergenic
1112169236 13:96952384-96952406 ATTTAGAGGGATAAACTAGATGG + Intergenic
1115453535 14:33575880-33575902 CCTGAGAAAGAGAAAATGGAAGG + Intronic
1116727798 14:48584199-48584221 AGTGGGAAGTAGAAACAGGATGG + Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117730800 14:58719991-58720013 ATGGAGAAGGCAAAAATGGAAGG + Intergenic
1119166186 14:72495832-72495854 ACAGGGAAGGAGAAACTGGCTGG - Intronic
1119891757 14:78188080-78188102 TTAGAGATGGAGAAACAGGATGG + Intergenic
1120006993 14:79369669-79369691 ATTGAAAAAGAGAAAATTGAGGG - Intronic
1120025486 14:79578927-79578949 ATTGAGAGGAAGAAAGTAGAGGG - Intronic
1121123766 14:91392982-91393004 CTGGGGAAGGAGAAACTGCAAGG + Intronic
1121272414 14:92646833-92646855 ATTAAGGAAAAGAAACTGGAAGG - Intronic
1121919087 14:97863930-97863952 ACTGAGGAGGAGAATCAGGATGG + Intergenic
1122034263 14:98936023-98936045 AGTGAGAAGGAGAAACATGCAGG + Intergenic
1122098253 14:99386986-99387008 ATGGACAAGGGGAGACTGGAAGG + Intergenic
1122775797 14:104116592-104116614 AAAGAGAAAGTGAAACTGGAGGG - Intergenic
1123416071 15:20096335-20096357 CCTGAGAAGGAGGATCTGGATGG - Intergenic
1123525411 15:21103444-21103466 CCTGAGAAGGAGGATCTGGATGG - Intergenic
1125030999 15:35076026-35076048 ATTGAGATGGAGAAGATGGATGG - Intergenic
1125731220 15:41893734-41893756 TCTGAGAAGAAGAATCTGGAAGG - Intronic
1126240226 15:46433410-46433432 ATTTAGGAGGAAAAATTGGAAGG + Intergenic
1126475835 15:49064070-49064092 AGAAAGAAGGAGAAACTTGATGG - Intergenic
1127107855 15:55636371-55636393 AAGGAGAAGGAAACACTGGAAGG - Intronic
1128299674 15:66558074-66558096 ATTGAAAGGGAGGAAATGGATGG - Intronic
1129300437 15:74622455-74622477 ATTGGGCATGAGAATCTGGAGGG - Intronic
1129651809 15:77496439-77496461 ATGGAAAAGGAGAAACTGGATGG - Intergenic
1130794422 15:87193794-87193816 AATGAGAAGAGGAAACAGGAAGG - Intergenic
1131368943 15:91863688-91863710 ATTGAGGAGAAGAAACTTAAAGG + Intronic
1133313838 16:4869765-4869787 ATCTAGATGGAGAAACTGGAGGG + Intronic
1133355074 16:5130185-5130207 TTTGAGAAAGAGAAAAAGGAAGG - Intergenic
1134462446 16:14441368-14441390 GTTGAAATGGAGAAACTTGAAGG + Intronic
1135681874 16:24464338-24464360 CTTGAGGAGGTGAAACTAGAAGG - Intergenic
1136051921 16:27657224-27657246 ATTGAGAAGGAAAAAGTGGGAGG + Intronic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1140337432 16:74121214-74121236 AGTGAGTAGGAGAAACTTGTTGG - Intergenic
1140583321 16:76256685-76256707 TTTGAGAAAGAGAAAGTGAATGG + Intergenic
1141263073 16:82471333-82471355 AAGGAGAAGGAGAAACAGAAGGG - Intergenic
1141624894 16:85255982-85256004 ATTGAGAAGTAGGCACTGGCCGG - Intergenic
1143332960 17:6151228-6151250 AGAGAGAAGCAGAGACTGGAAGG - Intergenic
1143340077 17:6203892-6203914 AGTGAGTAGGAGAGAATGGACGG - Intergenic
1143434894 17:6916069-6916091 ATTCAGAAGGAGATTCAGGAGGG + Intronic
1143476468 17:7206239-7206261 ATTGAGATGGAGTAGCTGGGTGG - Intronic
1143882518 17:10040527-10040549 AATGTGAGGGAGAAACTAGAGGG + Intronic
1144001127 17:11056176-11056198 AAAGAGAAGGAGAAACAGAAAGG - Intergenic
1144328544 17:14204639-14204661 TTTGTGAAGGATACACTGGAGGG - Intronic
1144971153 17:19110791-19110813 GTTCAGTAGGAGAGACTGGAAGG - Intergenic
1144991455 17:19236954-19236976 GTTCAGTAGGAGAGACTGGAAGG - Intronic
1147681921 17:42254715-42254737 AGAGGGAAGGACAAACTGGAAGG + Intronic
1148201432 17:45752528-45752550 ACTGAAAAGGAGAGAATGGAAGG - Intergenic
1148530237 17:48383211-48383233 TTTGAGAAGGAGGAAGTGAATGG + Intronic
1148963699 17:51416406-51416428 ATTGAGATGGAAAAATGGGATGG + Intergenic
1149423718 17:56534743-56534765 ACTGGGAAGTATAAACTGGAGGG - Intergenic
1150937667 17:69654811-69654833 AATGAAAAAGAGAAACTGGTGGG - Intergenic
1151029518 17:70720339-70720361 ATTGGTAAGGTCAAACTGGATGG + Intergenic
1151720906 17:75855463-75855485 GTTGCGCAGGAGGAACTGGAAGG - Exonic
1154436449 18:14346156-14346178 ACTGAGGAGGACACACTGGAAGG - Intergenic
1155039899 18:22056088-22056110 TTTGAGAATGAGAAACTATATGG - Intergenic
1155872668 18:31046675-31046697 ATTAACAAGGAGATACTGGAAGG - Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1159371041 18:67528138-67528160 AGACAGAGGGAGAAACTGGAGGG + Intergenic
1159548721 18:69872613-69872635 ACTGAGAAGAAGGAATTGGAGGG - Intronic
1159756059 18:72367594-72367616 AGAGAGAAGGAGAAAGTGGAAGG + Intergenic
1159834625 18:73324116-73324138 ACTGAGAAGGAGGAAGAGGAAGG - Intergenic
1160151715 18:76400127-76400149 ATTCAGAGTGAGCAACTGGAAGG + Intronic
1160251684 18:77209063-77209085 AAAGAGAAAGTGAAACTGGAAGG - Intergenic
1162205233 19:9050795-9050817 ATTGAAGAGGTGAAACTGGGAGG - Intergenic
1163094923 19:15050242-15050264 ATTGTGAGGGAGGAAGTGGAAGG - Intronic
1163398165 19:17076047-17076069 ACGGTGAAGGAGAAAGTGGATGG + Intronic
1165814494 19:38633261-38633283 ACTGAGAAGGAGCCACCGGAGGG + Intronic
1165913541 19:39244331-39244353 ATGGAGAAGGAGAAGGTGAAGGG + Intronic
1166937958 19:46346322-46346344 AATGTGAAGGGTAAACTGGAGGG + Intergenic
1166979549 19:46624429-46624451 AGAGAGAAAGAGAAACAGGAAGG - Intronic
1167262515 19:48467197-48467219 AGGGAGATGGAGAAGCTGGAGGG - Intronic
1167695163 19:51010814-51010836 TGTGAGCAGGAGAAAGTGGAAGG - Intergenic
1168236668 19:55068026-55068048 AGAGAGAAGGAGACACAGGAGGG - Intronic
925536041 2:4917777-4917799 AGGGAGAAGGAGAAACAGAAAGG - Intergenic
925542491 2:4980689-4980711 ACTGATAAGGAGGAGCTGGAGGG + Intergenic
925651639 2:6096396-6096418 AATGAGATGGAGAAACTAGACGG + Intergenic
927288733 2:21383681-21383703 ATTGAGCCGGAGAGACTGCAGGG - Intergenic
927441267 2:23119673-23119695 CTTGTGAAGGAGAAGCTGGCAGG - Intergenic
928879432 2:36081319-36081341 ATTTGGAGGGAGAAAATGGAGGG - Intergenic
929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG + Intergenic
929985564 2:46728300-46728322 ATTCAGTAGGAGAGACAGGATGG + Intronic
930293273 2:49522402-49522424 ACTGACAATGAGATACTGGAGGG + Intergenic
930642337 2:53866360-53866382 AATGAGAAGGACAAAGTGAATGG + Intronic
930659395 2:54038944-54038966 ACTGAGAAGGAGATATTTGAGGG + Intronic
930672681 2:54167992-54168014 ATTGGGATGGAGAAATGGGATGG - Intronic
930978190 2:57489936-57489958 ATTGAGGTGGAGAAAATGAAGGG + Intergenic
931238210 2:60429629-60429651 ATTGAGATGGAGAAACCTTAAGG + Intergenic
931369280 2:61647130-61647152 ATTGAGTAAAAGAAACTGGGAGG + Intergenic
932253633 2:70265858-70265880 ATTTGGTAGGAGTAACTGGAAGG - Intronic
932489131 2:72107877-72107899 ATTCAGAAAAAGAAACAGGAAGG - Intergenic
933197860 2:79412780-79412802 ATTGAGAAGGAGAAACTGGATGG + Intronic
933596175 2:84285448-84285470 CTAGAGAAGGAGAAACCAGATGG + Intergenic
933912741 2:86957719-86957741 ATTGTGAAGGTGAAGATGGATGG + Exonic
934010254 2:87812171-87812193 ATTGTGAAGGTGAAGATGGATGG - Exonic
934500017 2:94851742-94851764 ATTGAAAAGGAGAACTTTGAAGG + Intergenic
934652389 2:96099942-96099964 GGTGAGAAGGAGAAAGAGGAAGG + Intergenic
935082522 2:99812203-99812225 ATGGAGAGGGAGAAAATGTAGGG - Intronic
935773818 2:106452891-106452913 ATTGTGAAGGTGAAGATGGATGG - Exonic
935906245 2:107843022-107843044 ATTGTGAAGGTGAAGATGGATGG + Exonic
935992712 2:108735545-108735567 ATTGTGAAGGTGAAGATGGATGG + Exonic
936128028 2:109808187-109808209 ATTGTGAAGGTGAAGATGGATGG + Exonic
936216669 2:110563298-110563320 ATTGTGAAGGTGAAGATGGATGG - Exonic
936425808 2:112417879-112417901 ATTGTGAAGGTGAAGATGGATGG - Exonic
936533772 2:113295081-113295103 ACTGAGAAAGAGAAACAGAAAGG + Intergenic
936691865 2:114899436-114899458 ATTGAGAAGGGGCACATGGAGGG - Intronic
938394105 2:130929348-130929370 ATGGAGGAAGAGAAACTGGATGG - Intronic
938900460 2:135794884-135794906 AGTGAGTAGGGGAAACTGGCAGG + Intronic
939108976 2:137983884-137983906 ATTAAGAAGCAGCAAATGGAAGG - Intronic
939751890 2:146058299-146058321 AATTAGAATGAGAAACAGGAGGG - Intergenic
940712967 2:157184540-157184562 ATGGATAAGGAGAAACAGCAAGG - Intergenic
941084553 2:161101802-161101824 AATGTGATGGAGAAAATGGATGG - Intergenic
941186447 2:162326001-162326023 AGTGAGAGGCTGAAACTGGATGG + Intronic
941484765 2:166066388-166066410 ATTGAGATGGAGAAATTGAGGGG - Intronic
942137330 2:172939846-172939868 ATGGAGCTGGAAAAACTGGATGG - Intronic
942194244 2:173501776-173501798 AGTGAAAATGGGAAACTGGAGGG + Intergenic
942494562 2:176526237-176526259 ATTGGGAAGAAGAAATTGCAAGG - Intergenic
942580075 2:177408705-177408727 ATTGAGAGAGAGAAACGGAAAGG - Intronic
942763483 2:179427516-179427538 CTTGAGAAGCAGAAACTCTAAGG + Intergenic
943148534 2:184078587-184078609 ATTAAGAAGTAGATACTGCATGG + Intergenic
943199927 2:184809324-184809346 AATGAGTAGGAGAAAGTGAATGG + Intronic
943444207 2:187963284-187963306 CTTGAGAAGGAAAAACTGAATGG + Intergenic
943759132 2:191589533-191589555 ATTGTGAAGGAGAAGCTTGAAGG - Intergenic
944253332 2:197599499-197599521 TGTGAGAAGGAGAAAGAGGAAGG + Intronic
944343259 2:198629666-198629688 ATAGAAATGGAGAAAGTGGACGG - Intergenic
944401519 2:199332074-199332096 ATTGAGAATGTGCAAATGGAGGG + Intronic
944670384 2:201989449-201989471 ACTGTGGAGGATAAACTGGAAGG + Intergenic
944687140 2:202127543-202127565 ATGGAGAAGGGGACACTAGAAGG + Intronic
945401141 2:209384859-209384881 ATTGATAAAAAGAAACTAGAGGG - Intergenic
945435344 2:209811020-209811042 TTTAAGAAGGAGAAATGGGATGG + Intronic
945590699 2:211726714-211726736 ATTGTGGAGGATTAACTGGAAGG - Intronic
945719230 2:213397974-213397996 ATTAAGAAGGAGAACATGGAAGG - Intronic
946494922 2:220186497-220186519 ATGGAGATGGAGAAAATGAATGG + Intergenic
947830238 2:233134397-233134419 ATGGAGAAGGAGGAGCTGGGAGG + Intronic
1168873079 20:1147516-1147538 ATTGAGGAGGAGAAAGGGGATGG - Intronic
1168957761 20:1846490-1846512 AATGGGAAGGAAAAAGTGGATGG + Intergenic
1169069357 20:2713424-2713446 ATAGAGAGGGAGACACTAGAGGG + Intronic
1169317636 20:4606526-4606548 ATTGAGAAGGAATGAATGGAAGG + Intergenic
1169453959 20:5735984-5736006 GTTGAGAGGGAGAAATTGGCTGG + Intergenic
1169463695 20:5819156-5819178 ATTAAGAAGTAGACACTGGCGGG - Intronic
1169540435 20:6593758-6593780 ATTGAGAAAGGGAGACTGGTAGG + Intergenic
1169979075 20:11363416-11363438 AAGGAGAAGGAGAGAATGGAAGG - Intergenic
1170786077 20:19468847-19468869 TTTGAAAAGAAGAAACTGGAAGG + Intronic
1170851368 20:20007575-20007597 AGTGAGAAAGATAAAATGGACGG - Intergenic
1172694680 20:36814378-36814400 ATTTAGAAGGACAAGCTGCAAGG + Intronic
1173286693 20:41678472-41678494 AGTGAGAAGTAGAAAATGGGTGG + Intergenic
1173310987 20:41895628-41895650 ACTGAGAGGGAGAAAGGGGAGGG + Intergenic
1174017920 20:47503453-47503475 TCTGAGAAGGGGAAACTGTAGGG - Intronic
1175007924 20:55705384-55705406 ATTGAGAGGGAGAAAGTTTAAGG - Intergenic
1175281249 20:57805369-57805391 ATTGAGAAGGTGACATTTGATGG - Intergenic
1175452084 20:59077886-59077908 AAGGAGAAGGAGAAAAAGGAGGG + Intergenic
1175594158 20:60217216-60217238 AGTGAGAAGGACAACCTGGGGGG + Intergenic
1175791011 20:61739706-61739728 GTTCAGAAGGTAAAACTGGAAGG + Intronic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1176031125 20:63012574-63012596 TTTAAGAAGGAAAAACAGGATGG - Intergenic
1177797687 21:25795831-25795853 CTTGGCAAGGAGAAACTGTATGG + Intergenic
1178075117 21:29008456-29008478 ATTGAAAAGAAGACAATGGAGGG - Exonic
1178139300 21:29664100-29664122 ACAGAGCAGGAGAAACTGGTTGG + Intronic
1178165696 21:29973603-29973625 ATTGAGAAGGAGGAAGGGGAGGG - Intergenic
1179182291 21:39055722-39055744 ATTTTGCAGGAGAAACAGGAAGG + Intergenic
1179778663 21:43685300-43685322 ATGGGGGAGGAGACACTGGATGG - Intronic
1181042684 22:20199780-20199802 AGTGAGTAGGTGAAAATGGATGG - Intergenic
1182543619 22:31059665-31059687 CCTGAGAAGGAGGATCTGGATGG + Intergenic
1182672084 22:32004886-32004908 ATTGAGAAGCAGACACTGGCTGG - Intergenic
1184174540 22:42780328-42780350 CTTGAGAAGTAAAAACAGGAAGG - Intergenic
1184848077 22:47101426-47101448 AGAGAGACGGAGAAGCTGGAAGG - Intronic
1184882461 22:47318118-47318140 ATTGAAAAAAAGAAACTAGAAGG - Intergenic
949376206 3:3392985-3393007 ACTGTGAAGGAAAAACTGCAAGG - Intergenic
950163500 3:10776953-10776975 GGTGAGCAGGAGAAACTGGCAGG - Intergenic
950590856 3:13935009-13935031 CCTGAGAAGGAGGAACTGGCCGG + Intergenic
951044145 3:18019643-18019665 GGAGAGAAGGAGAAACTAGATGG + Intronic
951623783 3:24636864-24636886 ATTAAACATGAGAAACTGGATGG - Intergenic
952436947 3:33280975-33280997 ATTGGGAAGCAGAAGATGGAGGG + Intronic
953121409 3:40046177-40046199 AATGAGAAGAAGGAACTAGAAGG + Intronic
953569429 3:44059318-44059340 AATGAGAATGAGTAACTTGATGG + Intergenic
953685488 3:45074890-45074912 ACTGAGAAGGAGAAGCCAGAGGG + Intergenic
954783862 3:53079240-53079262 AATGAGAAGGAGGAAGAGGAAGG + Intronic
955243238 3:57199851-57199873 ATTGAAAAGGAGCAAGTTGAGGG + Exonic
955902668 3:63774093-63774115 TATAAGAAGGAGAAACTGGCCGG + Intergenic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956833966 3:73080551-73080573 AATGAGAAGTAGAAGGTGGAGGG - Intergenic
957058925 3:75465836-75465858 TTTGAGAAAGAGAAAAAGGAAGG - Intergenic
957867017 3:86038952-86038974 ATTTAGAAGGAGAATCTGGAAGG + Intronic
957874362 3:86126676-86126698 GTTGAGAGGAAGAAACTGAATGG + Intergenic
958196527 3:90247971-90247993 ATTGAGGAGGGTAAACAGGAAGG + Intergenic
958419717 3:93916608-93916630 ATTGAGGAGGGTAAACAGGAAGG + Intronic
958896867 3:99839111-99839133 ATTGAGCAGGGGATACAGGATGG - Intronic
959023673 3:101216023-101216045 ATGGTCAAGGAGAACCTGGAGGG - Intergenic
959072777 3:101718400-101718422 AATGATTAGGAAAAACTGGATGG - Intergenic
959234016 3:103694370-103694392 ATTGAGCAGGAGAATTAGGAAGG + Intergenic
959291781 3:104484583-104484605 ATTTGGAAGGAGTAAGTGGATGG + Intergenic
959504520 3:107142991-107143013 GTTGAGAAGGAGAAAATAGCAGG + Intergenic
960144164 3:114181601-114181623 ATTGAGATGGAGTTTCTGGAAGG - Intronic
960547539 3:118933811-118933833 ATTGAGAAGCAGGAAGTAGAAGG - Intronic
960549833 3:118962801-118962823 AATAAGAAGGAATAACTGGAAGG + Intronic
960788827 3:121403858-121403880 ATTGAGAAGGAATAGCTAGAAGG - Intronic
960806950 3:121593207-121593229 ATTTAGCAGGGGAAACTGAATGG - Exonic
961480915 3:127180132-127180154 ATTCAGAAGGAAACACTCGAAGG + Intergenic
961597246 3:128028217-128028239 ATTGAGAGAGAGACTCTGGAGGG + Intergenic
961599204 3:128046096-128046118 CTTGAGAAGGAGAAAGGGGAGGG - Intergenic
961891447 3:130133634-130133656 TTTGAGAAAGAGAAAAAGGAAGG - Intergenic
962787032 3:138778154-138778176 ATTTAAAAGGAGAAACCGAAAGG + Intronic
963076769 3:141354498-141354520 ACTGAAATGGAGAAATTGGATGG + Intronic
964311355 3:155396623-155396645 ACTGAGAAGGAGGAAGAGGAGGG + Intronic
964774464 3:160260369-160260391 ATAGAGAAGACGAAACTTGATGG + Intronic
966291032 3:178359975-178359997 ATTAAGAATGAAAACCTGGAGGG - Intergenic
966532095 3:180992605-180992627 AATGTGAAGGAGCAACAGGAAGG - Intergenic
967067849 3:185937018-185937040 ATTGTGAAGGAGAAATTGGCGGG - Intronic
967508786 3:190286029-190286051 ATTGAGAAAGACAAAATGGTTGG - Intergenic
967938173 3:194746019-194746041 AAACAGAAAGAGAAACTGGAAGG + Intergenic
968323187 3:197789844-197789866 ATAAAGTAGGACAAACTGGAAGG - Intergenic
968344954 3:197995091-197995113 ATTGAGCAGGAGGAAGAGGAGGG - Intronic
969002842 4:3996060-3996082 TTTGAGAAAGAGAAAAAGGAAGG - Intergenic
969214998 4:5714387-5714409 GTTGAGAAGTAGAAAATGGGTGG - Intronic
969751186 4:9112458-9112480 TTTGAGAAAGAGAAAAAGGAAGG + Intergenic
969811092 4:9648751-9648773 TTTGAGAAAGAGAAAAAGGAAGG + Intergenic
970125047 4:12799766-12799788 ACTCTAAAGGAGAAACTGGAAGG - Intergenic
970150755 4:13087298-13087320 ATTGAGCAGGGGAAACTGCTAGG + Intergenic
970228826 4:13887919-13887941 AGGGAGAAGGAGGAAATGGATGG - Intergenic
970432653 4:16002918-16002940 ATTGAAAAGGAGGAAGAGGAGGG + Intronic
970810758 4:20091191-20091213 ATTGAGACTGAGAATTTGGAGGG + Intergenic
971040805 4:22749957-22749979 TTTAAGAAGGAGAAATTGGCCGG - Intergenic
971162190 4:24144695-24144717 ATAGAAAAGGGGAAAGTGGAGGG - Intergenic
971296506 4:25398362-25398384 ACTGAGAAGGTGAAGTTGGAAGG + Intronic
971478664 4:27095264-27095286 ATGGAGAAGGAGAGGCTGGTGGG - Intergenic
971648496 4:29239579-29239601 ACTGAGAAGGTGGAAGTGGAAGG - Intergenic
974231431 4:59120550-59120572 ATAGTGAAGGGGAAACTGAAAGG + Intergenic
974451914 4:62074486-62074508 TTTGTGAAGGAGAAATTGGTTGG + Intronic
974552896 4:63403122-63403144 ATTGATATGGACAAACTGGTAGG + Intergenic
975090495 4:70396921-70396943 ATTGAAAATAAGAAACTAGAAGG + Intergenic
975392810 4:73838910-73838932 GCTGTGAAGGAGTAACTGGAAGG - Intronic
975617102 4:76257455-76257477 AGAGAGAAGGGGACACTGGAAGG - Intronic
975684058 4:76902341-76902363 ACTTAGAAGGAGCAGCTGGAGGG + Intergenic
975838694 4:78451790-78451812 ATGGAACAGGAGAACCTGGAGGG + Intronic
976305562 4:83556007-83556029 ATTGATAAGGACAAACTGTTAGG - Intronic
976324892 4:83759959-83759981 ATTTGGAAGGAGGAAGTGGAGGG + Intergenic
976520045 4:86016326-86016348 AAAGAGTAGGAGAGACTGGAGGG - Intronic
977463954 4:97359556-97359578 AATGAGAAGGGGACACTTGAGGG - Intronic
978725271 4:111962235-111962257 ATTGAGAAGGGGAAGATGGTGGG - Intergenic
979222873 4:118248944-118248966 AATGAGAAGGAGAAGCTAGAAGG - Intronic
979438038 4:120717964-120717986 ATTGAGAAAGGGAAACTTGTAGG + Intronic
980029564 4:127811550-127811572 ATTGAGAAGCAAAATTTGGAAGG + Exonic
980114102 4:128662869-128662891 TTTGAGAAGGAGCAGCAGGAGGG - Intergenic
980430572 4:132688616-132688638 ATAGAGAAGGAAAAACTTTATGG - Intergenic
980640988 4:135579181-135579203 AATGAAAATGAAAAACTGGAAGG - Intergenic
982012047 4:151114977-151114999 ATTGAGGAGGAGAAATTGTCAGG - Intronic
982070750 4:151692482-151692504 AATCAGAAGGAGAAAATGGCAGG + Intronic
982157119 4:152534896-152534918 ATTGAGGGGGAGAAAGTGGGAGG - Intronic
982322429 4:154093045-154093067 TTTGAGAAAAAGAAAATGGAAGG - Intergenic
982536073 4:156607693-156607715 AAAGGGAAGGAAAAACTGGAGGG + Intergenic
983990737 4:174116492-174116514 ATTGAGAAGGAAAAATTACAAGG - Intergenic
984348852 4:178566258-178566280 AGAGAGAAGGAGAAATTGAAAGG - Intergenic
984503940 4:180593154-180593176 ATTGAGGCCGAGAAACTGGTGGG + Intergenic
984528084 4:180881271-180881293 ATTGAGAAAGAGAAAAGGGATGG + Intergenic
984918885 4:184746873-184746895 CCTGAGAAAGAGAAAATGGAAGG + Intergenic
986095520 5:4550213-4550235 ATTCAGAAAGAGACACTGGAAGG + Intergenic
986797333 5:11224740-11224762 AGTAAGTGGGAGAAACTGGAGGG - Intronic
986952434 5:13105809-13105831 GCAGAGAAGTAGAAACTGGAAGG + Intergenic
987939237 5:24511346-24511368 ACTGAGAAGGACACACAGGAAGG - Exonic
988015531 5:25553221-25553243 ATTGGCAAAGAGAGACTGGATGG - Intergenic
988022333 5:25637072-25637094 ATTGGGAGGGAGTAAGTGGAGGG + Intergenic
988454024 5:31371572-31371594 ATTGAGTATCAGACACTGGATGG - Intergenic
988498353 5:31763584-31763606 ATTGAGAAGAAGAGACTGAGAGG + Intronic
988505648 5:31820215-31820237 ATTAAGAAGGGGACACTGTATGG - Intronic
988883350 5:35529495-35529517 AATGAGAAGGGAAAAGTGGAAGG - Intergenic
989089119 5:37711004-37711026 ATTCAGAGGGAGAGACTGAATGG + Intronic
989237049 5:39160128-39160150 ATTGAGTAATAAAAACTGGAAGG - Intronic
990262286 5:54036416-54036438 ATGTAGAAGTAGAAATTGGATGG - Intronic
990469244 5:56098560-56098582 ATTGTAAAGGAGAAAGTGTACGG - Intergenic
990608827 5:57437393-57437415 ATTGAGAAGAAGAAACTTTTGGG - Intergenic
991416493 5:66397880-66397902 CATGAGAAGGAGAAACGGGAGGG + Intergenic
992002046 5:72445303-72445325 ACTGAGGAGGAGCAACAGGAAGG + Intronic
994145624 5:96391877-96391899 AATCAGAAGCAGAAACTGGCAGG - Exonic
994377612 5:99032916-99032938 ATTGATTAGGAGAAAATGGAGGG - Intergenic
994995419 5:107056372-107056394 ATAGTGAAGAATAAACTGGAAGG + Intergenic
995070438 5:107914785-107914807 ATTGAGTAAGACAAAGTGGAAGG + Intronic
995397216 5:111699666-111699688 ACAGAGAAGGAGGAACTGGTGGG - Intronic
995616622 5:113971894-113971916 ATTGAGAAGGTAAGACTTGAAGG - Intergenic
995757847 5:115528955-115528977 ATAGAGAATTAGTAACTGGAAGG + Intronic
995837357 5:116411964-116411986 ATTGTGTAAGAGTAACTGGAAGG + Intronic
996051732 5:118942379-118942401 GCTGAGAAGGAAAAACTGTATGG + Intronic
996905020 5:128589408-128589430 ATTGAGGATGAAAAACTGGTTGG - Intronic
997028672 5:130096826-130096848 AAGGAGGAGGAGAATCTGGAAGG + Intronic
997453333 5:134000696-134000718 ATGGAGAAAGAGAGCCTGGATGG + Intronic
998335753 5:141370935-141370957 ATTCAGAAGGAGAACCTGGATGG + Exonic
998939349 5:147263764-147263786 AGAGAGAAAGAGAAAATGGAAGG + Intronic
999212877 5:149905580-149905602 ATTGAGAGGGTGAAGCTGGCAGG - Intronic
999390880 5:151188818-151188840 ATTCAGTAGGAAAAACTGGATGG - Intronic
999403299 5:151284196-151284218 TTTGAGAGGCAGAACCTGGAGGG + Exonic
999914367 5:156241555-156241577 TTAAAGAAGGAAAAACTGGATGG - Intronic
1000152148 5:158513834-158513856 AACGAGGAGGAGAAACAGGAGGG + Intergenic
1000216479 5:159162348-159162370 TTTGAAAAAGAGAAACTGAAAGG + Intronic
1000279451 5:159769535-159769557 ATTAGGAAGGAGAATCTGGGTGG + Intergenic
1000783553 5:165514233-165514255 ATTAAGAAGTGGAAACTGGCAGG - Intergenic
1001749359 5:174117144-174117166 ATGGAGAAAGTGAAGCTGGAAGG - Intronic
1001881478 5:175248182-175248204 TTTGAGAAGGAGAGACGGGCAGG + Intergenic
1002692603 5:181060596-181060618 TTTAAAAAGGAGAAACAGGAAGG + Exonic
1002883804 6:1275970-1275992 AGCGAGAAGGAGAGAGTGGAAGG + Intergenic
1003739956 6:8925065-8925087 ATTGAGAAGGAAAAAAATGAAGG - Intergenic
1004000623 6:11593812-11593834 ATTAAGAAGGAGAAATGGGCCGG - Intergenic
1004149123 6:13098329-13098351 AGAGAGAAGGAAAAACAGGAAGG - Intronic
1005033021 6:21529082-21529104 ATTGAAAAGGAGAAAGAAGAAGG - Intergenic
1005098081 6:22140600-22140622 GTAGAGAAGGAAAATCTGGATGG + Intergenic
1005819688 6:29587766-29587788 AATGAGAAGGAGCTGCTGGATGG + Exonic
1006000183 6:30958525-30958547 AAGGAGAAGGAAAAACTGGAAGG - Intergenic
1006387083 6:33737244-33737266 AGTGCGAAGGAGACACTGCAAGG + Intronic
1006761285 6:36463881-36463903 ATTGAGAGGGAAAAAGGGGAAGG + Intronic
1007009139 6:38397983-38398005 ATGGAGCAGGAGAAACTGCATGG + Intronic
1007143362 6:39600621-39600643 ATAGAGAAGGAGAAAGTGACTGG - Intronic
1007342773 6:41202043-41202065 ATTGAGCAGGAGGAAGTGGAGGG - Intergenic
1007761480 6:44135941-44135963 ATGGACCAGGAGAACCTGGAAGG - Intronic
1007765717 6:44158705-44158727 ACTGAGAAGGAGAAAAGGGAAGG + Intergenic
1008030964 6:46693490-46693512 ATTGATACTGAGGAACTGGAAGG + Exonic
1008055163 6:46938424-46938446 AATGAGAATGAGAAACTTGGGGG + Intronic
1009056785 6:58345908-58345930 ACTGAGGAGGAGAAAGAGGAGGG - Intergenic
1009440249 6:63669464-63669486 TTTGAGAAAGATAAACTAGAAGG - Intronic
1009572877 6:65411663-65411685 ATAGAGATGGAGAAAATCGATGG - Intronic
1009834196 6:68976740-68976762 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1010766182 6:79778937-79778959 AATGAGAAGGAGAATATGAAGGG + Intergenic
1011401972 6:86973158-86973180 ATTTAAAAGGAGAAGGTGGAGGG - Intronic
1011441689 6:87393802-87393824 ATCGATAAGGAGTAACAGGATGG - Intronic
1011589963 6:88962907-88962929 ATTGAGACTGGGAATCTGGAGGG - Intronic
1012236814 6:96827915-96827937 ATAGACAAGAAGAAACTGGGTGG + Intronic
1012396980 6:98809890-98809912 ATTGAGATGTGGAAACTGTAGGG - Intergenic
1012445837 6:99306360-99306382 ATCCAGATGGAGCAACTGGATGG + Intronic
1014080820 6:117283970-117283992 ATTGGGGAGAAAAAACTGGAAGG + Intergenic
1014708108 6:124773290-124773312 AATGGGAAGGAGAAAGAGGAGGG + Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1016767544 6:147811743-147811765 ACTGAGAATGAGTCACTGGAAGG + Intergenic
1018190610 6:161306424-161306446 AACGGGAAGGAGAAAATGGAGGG + Intergenic
1018279813 6:162173035-162173057 ATGGGGAAGGAGAAACTGGGGGG + Intronic
1018824973 6:167402045-167402067 CTGGAGAAGGAGGAACCGGAGGG + Intergenic
1020207156 7:6127708-6127730 ATTGTGAAGAATAAAGTGGAAGG - Intronic
1020321787 7:6944181-6944203 TTTGAGAAAGAGAAAAAGGAAGG - Intergenic
1021280147 7:18707121-18707143 AAAGAGAGGGAGGAACTGGAAGG + Intronic
1021715459 7:23458033-23458055 ATTCAGATGGGGAAGCTGGATGG - Intronic
1022291784 7:29011759-29011781 ATTCAGTAGGAGAAACCAGAGGG + Intronic
1022312542 7:29210763-29210785 ACTGAGAAGGTGACACTTGATGG + Intronic
1022570816 7:31452314-31452336 ATTGAGGAGGAGTATCTGAAAGG + Intergenic
1022704564 7:32790235-32790257 TTTGAGAGGGAGAAACTGCTGGG + Intergenic
1022797064 7:33740256-33740278 ATAGAGAAAGAAAAACGGGAAGG + Intergenic
1022890050 7:34687934-34687956 ATTTAAAAGCAGAAACTGGAAGG + Intronic
1022999786 7:35796873-35796895 GTTGAGAAGGAAAAACTGATAGG + Intergenic
1023489865 7:40727800-40727822 ATTAAGAGGGAAAAACTGAAAGG - Intronic
1024084927 7:45884989-45885011 CTTGAGATGGAGAAGCTGGAAGG + Intergenic
1024483437 7:49889293-49889315 ATTGTGAAGGTTAAACTTGACGG + Intronic
1024490201 7:49973697-49973719 TTGGAAATGGAGAAACTGGAAGG + Intronic
1024770071 7:52712353-52712375 ATTAAGAAGGAGAGGATGGAGGG + Intergenic
1026350341 7:69510072-69510094 CTTGAGAAGGATAAAAAGGAGGG + Intergenic
1027239452 7:76317896-76317918 ATTCAGATGGAGAAACTGAAGGG + Intergenic
1029042363 7:97590282-97590304 AATGAAAAGGAGAAATTGAAAGG - Intergenic
1029382507 7:100222876-100222898 AGTGAGATGGAGAATCAGGACGG - Intronic
1029580262 7:101432499-101432521 ATTGAGATGGGGACACTGGGAGG + Intronic
1030478780 7:110075274-110075296 ATTGATAATGAAAAAGTGGATGG + Intergenic
1030803773 7:113888284-113888306 AATGTAGAGGAGAAACTGGACGG + Intronic
1031058849 7:117026365-117026387 ATTGACTAGGAAAAAATGGAAGG - Intronic
1031620671 7:123930619-123930641 ATTGGACAGGTGAAACTGGATGG + Intronic
1032254154 7:130283852-130283874 CTAGAGAAGGAGAAAAAGGATGG + Intronic
1032458988 7:132095401-132095423 ATTCAGAAGCAGAGGCTGGAAGG - Intergenic
1032459126 7:132096276-132096298 ATTGAGAAGGATACCATGGAAGG + Intergenic
1032779258 7:135150309-135150331 AGTGAGAGAGAGAAACTGGCAGG - Intronic
1033655176 7:143368422-143368444 AATGAGAACCAGGAACTGGAAGG + Intergenic
1033890078 7:146001262-146001284 CTTAAGTAGGAGAAACTAGAAGG - Intergenic
1034551907 7:151826130-151826152 ATGGAGAAAGAGAGAATGGATGG - Intronic
1035051238 7:156000130-156000152 ACTGTGAATGAGAAACTGGCGGG - Intergenic
1035232727 7:157476125-157476147 CTGGAGAATGAGAAACAGGATGG + Intergenic
1037094668 8:14970741-14970763 ATTGAAAAGGAGAATCTAGCAGG - Intronic
1037384556 8:18324292-18324314 ATTCAGAAGGAGAGACGGAAAGG - Intergenic
1038351380 8:26779319-26779341 ATGGAGAAGGAAAATTTGGAAGG - Intronic
1039092258 8:33844679-33844701 ATTGAGAAGGAGAACCTCTGAGG - Intergenic
1039691451 8:39869113-39869135 ATTAAGAAAGACAAATTGGAGGG + Intergenic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1040974285 8:53172674-53172696 AGAGAGAAAGAAAAACTGGAAGG + Intergenic
1041127821 8:54662869-54662891 ATTCAGTAGGAGAGACTGGATGG + Intergenic
1041733126 8:61083153-61083175 TTTGAGAAGGAAAAAATGAAGGG + Intronic
1042147075 8:65740898-65740920 ATGGAGCAGGTGAAACTGGAGGG - Intronic
1042284137 8:67088974-67088996 TTTGAGAAGGTGGGACTGGAAGG + Intronic
1042593187 8:70418099-70418121 ATTAAGAAGTAGAAATGGGAGGG - Intergenic
1043277616 8:78419571-78419593 AAGGAGAAAGAGAAACTGAAAGG - Intergenic
1043781792 8:84345625-84345647 AATGAGAGGGAGATGCTGGAGGG - Intronic
1043796672 8:84550234-84550256 AAGGAAAAGGAGAAAGTGGAGGG - Intronic
1043925413 8:86030944-86030966 ATTGAGAAAGATAAATTAGATGG - Intronic
1044213567 8:89580491-89580513 ATTAAGAAGTGGAAACTGGCTGG - Intergenic
1044857595 8:96492766-96492788 AGTAAGAAAAAGAAACTGGAAGG + Intergenic
1044890336 8:96828432-96828454 ATTGACTAGGAGACACTGGCTGG - Intronic
1045058322 8:98389191-98389213 ATGGAGAAGGTGAAACAGGCTGG - Intergenic
1045555845 8:103213741-103213763 AGTCAGAAGGAGGAACTGGGTGG - Intronic
1045939245 8:107718640-107718662 ATAGAGAAGAAGGAACTGGAAGG + Intergenic
1046362842 8:113184908-113184930 AAGGAGAAAGAGTAACTGGAAGG - Intronic
1046421167 8:113984717-113984739 ATTGAGCAGGAGGAGCAGGAGGG + Intergenic
1046939088 8:119913936-119913958 ATTTAGAAGGAAAAGCAGGAGGG - Intronic
1047467286 8:125129243-125129265 ATTGAGAAGGAGCCACTGGAGGG + Intronic
1047551370 8:125876092-125876114 TTTAAGAAGGAGAAATTGCAAGG - Intergenic
1049100766 8:140577593-140577615 CTTGAGGAGGAGCAGCTGGAGGG + Intronic
1049614175 8:143569064-143569086 CCTGGGAGGGAGAAACTGGAGGG + Intronic
1049614204 8:143569149-143569171 CATGGGAAGGAGAAACTAGAGGG + Intronic
1049614236 8:143569230-143569252 CATGAGAGGGAGAAACAGGAGGG + Intronic
1052386500 9:27829467-27829489 ATTCCCAAGGAGAATCTGGAAGG + Intergenic
1052434859 9:28413489-28413511 ACTGAGAGGGAGAAGTTGGAGGG - Intronic
1052470442 9:28887733-28887755 ATTGTGAAAGAGAAACAGAAAGG + Intergenic
1052520463 9:29541490-29541512 AGAGAGAAGGAGAAAAGGGAGGG - Intergenic
1052754991 9:32531840-32531862 ATCAAAAAGCAGAAACTGGAGGG - Intergenic
1053044725 9:34906047-34906069 GTTGAGAAGGAAAGACAGGAAGG + Intergenic
1053111594 9:35465224-35465246 ATTGAGAAGGAAAGATTGCATGG + Intergenic
1053352708 9:37424136-37424158 ACTGAGCAGGAGAAGGTGGAAGG + Intronic
1053657156 9:40228784-40228806 ATTGAAAAGGAGAACTTTGAAGG - Intronic
1053907519 9:42858078-42858100 ATTGAAAAGGAGAACTTTGAAGG - Intergenic
1054527440 9:66147442-66147464 ATTGAAAAGGAGAACTTTGAAGG + Intronic
1054676906 9:67864817-67864839 ATTGAAAAGGAGAATTTTGAAGG - Intronic
1054837503 9:69693378-69693400 ATTGTGCTGGGGAAACTGGATGG - Intergenic
1055164201 9:73171728-73171750 ATAGAGAATGAGAAATTGCAAGG - Intergenic
1055194558 9:73572804-73572826 AGTGGGAAGGAGAGAGTGGAGGG + Intergenic
1055716616 9:79125193-79125215 ATAGAGAAAGAGAAGCTTGATGG + Intergenic
1055737482 9:79347227-79347249 ATTGAGGAGGAGAGAGGGGATGG - Intergenic
1055798608 9:80005128-80005150 CTTGGGAAGAAGCAACTGGATGG + Intergenic
1056446303 9:86669501-86669523 ATTGGAAGGGAGAAACTTGAGGG + Intergenic
1058110369 9:101026298-101026320 AGCCAGAAGGAAAAACTGGAAGG + Intergenic
1058139678 9:101344155-101344177 ATTGAGAAAGAAAAAAAGGAGGG - Intergenic
1058762354 9:108147344-108147366 ATTAAGAAAGAGAAATTGGGAGG + Intergenic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1060146906 9:121260866-121260888 TGTAAGAAGGAGAAAGTGGAAGG + Intronic
1060379574 9:123154480-123154502 AATGAGAAGGATAAAACGGATGG + Intronic
1060472576 9:123960854-123960876 TTTGTGAAGGAAAAAATGGAAGG + Intergenic
1060553818 9:124498369-124498391 TTTGAGAAGGGGAAGCAGGAAGG + Intronic
1061865742 9:133491023-133491045 AGTGAGAAGGAGAAGCTGGAGGG + Intergenic
1062182162 9:135196496-135196518 AATGGGAAGGAGAAATGGGAAGG - Intergenic
1185937874 X:4279541-4279563 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic
1186145360 X:6619149-6619171 ATTAAGAAGCAGACACTGCATGG + Intergenic
1186607546 X:11107809-11107831 AGTCAGAAGCAGACACTGGAAGG - Intergenic
1186663318 X:11691919-11691941 TTCCAGAAGGAAAAACTGGAAGG - Intergenic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1187416138 X:19094900-19094922 AAAAAGAAGGAGAAAGTGGACGG - Intronic
1187940387 X:24375396-24375418 AATGCGAAGGAGGAATTGGAGGG + Intergenic
1188103240 X:26116792-26116814 TGTGACAAGAAGAAACTGGATGG - Intergenic
1188266728 X:28086087-28086109 AGTGAGATGAAGAGACTGGAGGG + Intergenic
1188691977 X:33140532-33140554 ACTGAGAATCAGAAAATGGAGGG - Intronic
1189131455 X:38502365-38502387 ATTGAGTGGGAGAAACAGGGTGG - Intronic
1189299769 X:39944047-39944069 TTCTAGAAGGAGACACTGGAGGG + Intergenic
1190726092 X:53191868-53191890 CTTGAGGAGGATAAACTGGAGGG + Intronic
1190799076 X:53771822-53771844 CTTAAGAAGGAAAAAGTGGAAGG + Intergenic
1191627121 X:63281447-63281469 ATTGGGAAGGACTAATTGGAAGG - Intergenic
1192534791 X:71917951-71917973 CTTGAGAAGGTTAAACTGCATGG + Intergenic
1192535732 X:71925862-71925884 ATTGTGATGGAGAACATGGATGG - Intergenic
1193805830 X:85993266-85993288 ATTGAGATAGGGAAACTGAATGG - Intronic
1194469063 X:94269892-94269914 ATTAAGCAAGAGAAACTGAAGGG + Intergenic
1194877842 X:99211195-99211217 ACTGAGAATGAGAATATGGAAGG - Intergenic
1195210480 X:102649591-102649613 ATTAAGAAGTGGACACTGGATGG - Intergenic
1195560019 X:106272415-106272437 ATTGAGAAGGAGCCACTGAATGG + Intergenic
1195561943 X:106293924-106293946 ATTGAGAAGGAGCCACTGAATGG - Intergenic
1195722054 X:107876963-107876985 AGTGAGAGAGAGAAGCTGGATGG + Intronic
1196142058 X:112274279-112274301 ATTGAGTTCGAGAAGCTGGAGGG + Intergenic
1196345624 X:114653645-114653667 ATGAACAAGGAGAAACAGGAGGG - Intronic
1196817771 X:119678596-119678618 AATGAGAAGGAGAAGCAGAAAGG - Intronic
1197903090 X:131394296-131394318 ATAGAGAAGGGGAGGCTGGATGG - Intronic
1198025218 X:132699016-132699038 ATAGATTTGGAGAAACTGGAGGG - Intronic
1199387131 X:147236079-147236101 GTTAAGAAGGAGCAACTGAAGGG + Intergenic
1199535366 X:148896517-148896539 ACTGAGAAGGAGAATCTTGCTGG - Intronic
1201721396 Y:17101688-17101710 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic
1202115245 Y:21465551-21465573 ACTAAGAAGGAGAAAGAGGATGG + Intergenic
1202161648 Y:21941027-21941049 GTCAAGAAGGAGAAACAGGATGG - Intergenic
1202229708 Y:22645346-22645368 GTCAAGAAGGAGAAACAGGATGG + Intergenic
1202313448 Y:23550819-23550841 GTCAAGAAGGAGAAACAGGATGG - Intergenic
1202557355 Y:26119776-26119798 GTCAAGAAGGAGAAACAGGATGG + Intergenic