ID: 933199178

View in Genome Browser
Species Human (GRCh38)
Location 2:79429022-79429044
Sequence AACAATGAGGTGCCTCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933199178_933199181 -3 Left 933199178 2:79429022-79429044 CCAGCTGGAGGCACCTCATTGTT 0: 1
1: 0
2: 2
3: 15
4: 119
Right 933199181 2:79429042-79429064 GTTGCAGGCTACATTTATTCAGG 0: 1
1: 0
2: 0
3: 9
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933199178 Original CRISPR AACAATGAGGTGCCTCCAGC TGG (reversed) Intronic
902285681 1:15407076-15407098 AACTGTGTGGTCCCTCCAGCTGG - Intergenic
903290884 1:22313545-22313567 ACCAAAGAGGTGCCTCAGGCTGG + Intergenic
904172576 1:28601827-28601849 AACACCAAGGGGCCTCCAGCTGG - Intronic
905894001 1:41533630-41533652 GGGAATGAGGTGCCTCCAGAAGG - Intronic
908859071 1:68463022-68463044 AGAAATGTGGTCCCTCCAGCCGG - Intergenic
911515259 1:98860368-98860390 AAAAAAAAGGTGCCTCCAACTGG + Intergenic
912932970 1:113980891-113980913 AAGAATTAGATGCCTCCAGCAGG - Intronic
918547333 1:185700007-185700029 TCCACTGAGTTGCCTCCAGCAGG - Intergenic
921886719 1:220314475-220314497 AAAATTCAGGTGCCTCCTGCAGG - Intergenic
1063331190 10:5161199-5161221 AAGAATGAGGTCCCTACAGTTGG + Intergenic
1063822245 10:9849839-9849861 AAAAATTAAGGGCCTCCAGCAGG - Intergenic
1065799797 10:29341790-29341812 AAGGATGAGGGGCCTCCATCTGG - Intergenic
1066191737 10:33062225-33062247 AACAGGCAGGTGCTTCCAGCGGG + Intergenic
1071928180 10:90435599-90435621 AACAAGGTGGTGCCTCCAGAAGG + Intergenic
1073616110 10:104997851-104997873 ATCAATGAAGTGTCTCCATCTGG + Intronic
1074313172 10:112339961-112339983 ACAAATGAGATGCCTCCAGAGGG - Intergenic
1074415224 10:113261584-113261606 AACAATTAGATCCCTCCATCTGG - Intergenic
1076462072 10:130654598-130654620 AAGACGGAGGCGCCTCCAGCTGG - Intergenic
1079135241 11:17772783-17772805 ACCAGTGAGGTTCCTCTAGCAGG - Intronic
1079933233 11:26590697-26590719 AACAATGACAAGCCTCTAGCTGG + Intronic
1082129791 11:48474151-48474173 AAGAATGAGGTCACTGCAGCTGG - Intergenic
1082563314 11:54645051-54645073 AAGAATGAGGTCACTGCAGCTGG - Intergenic
1088357466 11:108958999-108959021 TACCAAGTGGTGCCTCCAGCCGG - Intergenic
1093378324 12:18458683-18458705 AGCAAAGATTTGCCTCCAGCTGG + Intronic
1098126138 12:67295755-67295777 AACAATCAAGTGCCTTCAGGTGG + Intronic
1099693680 12:85992925-85992947 ACCCCAGAGGTGCCTCCAGCAGG + Intronic
1100509763 12:95258241-95258263 AAGAATGAGATGGCTCCACCTGG - Intronic
1102633097 12:114299369-114299391 GACAATTAAGTGCCTCCTGCAGG + Intergenic
1105594461 13:21823681-21823703 AACAATCAGGACCTTCCAGCAGG - Intergenic
1106876386 13:34078361-34078383 ATCAATGAGGTGGCACCTGCTGG + Intergenic
1110004494 13:70249379-70249401 TACAATGAGCTTCCTCCAGAAGG - Intergenic
1110442413 13:75539916-75539938 AACACTGCTGTGCATCCAGCTGG + Intronic
1112313220 13:98338373-98338395 TTCAATGAGGTGCCTAGAGCAGG - Intronic
1112380032 13:98880157-98880179 AACAAAGAGCTGCATCCTGCCGG + Intronic
1116124900 14:40771850-40771872 AACAATGTTGTGTCTCCAGATGG + Intergenic
1118893278 14:69926304-69926326 ATCAATCAGCTGCCACCAGCTGG + Intronic
1119178471 14:72587418-72587440 GACAATGAGGTGGGTCCAGGGGG + Intergenic
1119478900 14:74947708-74947730 AACATTCAAGTGCCTCCTGCGGG + Intronic
1120702073 14:87708927-87708949 AAGAATGAGGTAGCTCCATCTGG + Intergenic
1124789831 15:32717672-32717694 AGGAATGAGGGGCCGCCAGCCGG + Intergenic
1128557077 15:68639164-68639186 CACAAGGAGGTGCCTCCTTCAGG - Intronic
1129723026 15:77888284-77888306 AACATTGAGTTGCCTCCAATAGG + Intergenic
1129728290 15:77915266-77915288 AACAATGTGGAGCCTGCACCAGG - Intergenic
1130993803 15:88892921-88892943 ACCACAGAGGTGCCACCAGCTGG + Intronic
1132486053 16:191924-191946 GACAATGAGCTGTCTCCAGGAGG + Intronic
1137038907 16:35591802-35591824 AACAATGGGGTCCCTGCTGCTGG + Intergenic
1141850605 16:86642733-86642755 GCCAATAATGTGCCTCCAGCAGG - Intergenic
1143444531 17:6999628-6999650 AACTATGAGGAGCTCCCAGCAGG + Intronic
1144240298 17:13304134-13304156 AACAATGTAGTTCCTCCTGCAGG + Intergenic
1144443658 17:15306865-15306887 AGCAGAGAGGTGCCTCCAGTTGG + Intronic
1145202391 17:20958032-20958054 AATAATGAGGTGCCTCGGGGAGG - Intergenic
1146793489 17:35765883-35765905 AATAAAGAGGTGCCTTCAGCTGG - Intronic
1148321921 17:46761809-46761831 AACAATGAGATGCCACAAGTTGG - Intergenic
1152394741 17:80025583-80025605 AGCAAGGAGGTGCTCCCAGCAGG - Intronic
1152660585 17:81540139-81540161 AACAACTAGGTGCCTCCAGCCGG - Exonic
1160732356 19:647013-647035 AACGGAGAGGAGCCTCCAGCAGG - Intergenic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1163027442 19:14520499-14520521 AACTATCAGGAGCATCCAGCAGG + Intronic
1164774441 19:30842110-30842132 CACACTGGGGTGCCTCCAGGTGG + Intergenic
925442505 2:3900590-3900612 AACATGGAGGTGCCTACACCAGG - Intergenic
927706590 2:25299986-25300008 AAGAATGGGGTACCTGCAGCTGG + Intronic
929315747 2:40476345-40476367 ATGAATGAATTGCCTCCAGCAGG - Intronic
930542541 2:52724850-52724872 AAGAAAGAGGTGTCTCCTGCTGG - Intergenic
931914478 2:66938354-66938376 AACACTGAACCGCCTCCAGCTGG - Intergenic
932084648 2:68747294-68747316 AACAATGAAGTGTCCCAAGCAGG + Intronic
933199178 2:79429022-79429044 AACAATGAGGTGCCTCCAGCTGG - Intronic
933650974 2:84850086-84850108 AACACTGATGTACCTCCAACGGG + Intronic
937040517 2:118817139-118817161 AAAAGAGAGGGGCCTCCAGCAGG + Intergenic
937337899 2:121072933-121072955 AACCACGTGGTGCCTCCTGCAGG + Intergenic
944447933 2:199810483-199810505 AAGAAAGAGGTGCCTCCAACAGG - Intronic
946498547 2:220220886-220220908 AACAAAGATCTGTCTCCAGCAGG + Intergenic
946997490 2:225411630-225411652 AGCAATCAGGTGCCTCCAGGGGG - Intronic
948496353 2:238352320-238352342 TTGAATGAGGGGCCTCCAGCTGG + Intronic
1169342886 20:4809785-4809807 AGGAATGAGGTGCGTTCAGCTGG + Intronic
1169433053 20:5556757-5556779 AACAATGTGGGGCATCCAGTAGG - Intronic
1171989634 20:31685861-31685883 GAAAATGAGGTGCCCCCAGAGGG - Intronic
1172012345 20:31852911-31852933 AACAAAGAGGCCCCTCCACCTGG - Intronic
1176993429 21:15524968-15524990 AACAATGAGGTGGCAGCAGGGGG - Intergenic
1177819257 21:26013019-26013041 AACAAAAAGGTGCACCCAGCTGG + Intronic
1181237484 22:21456440-21456462 AACAATGAGTTGCCTCCTGCAGG + Intergenic
1183807084 22:40220509-40220531 AACTATTCAGTGCCTCCAGCAGG - Intronic
951755980 3:26091764-26091786 AACAATGAGTGGCCCCTAGCTGG - Intergenic
953955503 3:47228666-47228688 AACCATGATGGGCCTCCAGCAGG - Exonic
954198903 3:49012716-49012738 GACCAGGAGCTGCCTCCAGCAGG - Exonic
957090386 3:75724098-75724120 AACAAGGAAGGGCCTCCAACCGG + Intronic
958507701 3:95002039-95002061 ACAAATGAGGTGCAACCAGCAGG + Intergenic
959863618 3:111242573-111242595 AAAAAGGAGCTGCCTCCTGCAGG - Intronic
960171835 3:114471503-114471525 AACAAGGTGGTGGGTCCAGCAGG + Intronic
961813051 3:129532764-129532786 AACAAGCAGGTGCCTACTGCGGG + Exonic
961979481 3:131061891-131061913 AAGAATGAGGGGCCTCAAGAAGG - Intronic
964443205 3:156733163-156733185 AACAGTGAGGTGGCTCCAGGGGG - Intergenic
968357952 3:198122902-198122924 AACAACCAGGGGCCTCCAGGTGG - Intergenic
969486011 4:7472749-7472771 CATAATGAGGCCCCTCCAGCGGG - Intronic
970429614 4:15976825-15976847 AGGAATGACTTGCCTCCAGCTGG + Intronic
971892098 4:32538010-32538032 AGCAATGAGTTTTCTCCAGCTGG - Intergenic
972455943 4:39255325-39255347 AACCATGCTGCGCCTCCAGCTGG - Intronic
974699933 4:65428713-65428735 AAAAATTAGTTGCTTCCAGCAGG + Intronic
975730569 4:77333673-77333695 AACAATTAGGCCCCACCAGCTGG - Intronic
976829604 4:89299551-89299573 AAAAATGAGGTGACTGCATCAGG - Intronic
978491344 4:109314965-109314987 ACCCCAGAGGTGCCTCCAGCAGG + Intergenic
979605914 4:122638897-122638919 ATCAAAGAGCTGGCTCCAGCTGG + Intergenic
980970975 4:139566934-139566956 AAAAGTAATGTGCCTCCAGCTGG - Intronic
982945048 4:161611606-161611628 ACCAATGAGTTGCCTCCATCAGG + Intronic
987299085 5:16580962-16580984 AGCAATGTGGTGCATTCAGCGGG - Intronic
996533422 5:124550392-124550414 AGGAATGGGGTGCTTCCAGCTGG - Intergenic
996669769 5:126103648-126103670 AACAGTGTGTTGCTTCCAGCAGG + Intergenic
999309888 5:150545159-150545181 AACAAGGACTTGCCTCCAGTGGG - Intronic
1000908461 5:166992696-166992718 AAGAATCAGGAGCCTCCAGGGGG + Intergenic
1004645203 6:17553877-17553899 ATCAAAGAGGTGCCTTCATCTGG + Intronic
1013167579 6:107607404-107607426 AACACTGGTGCGCCTCCAGCTGG + Intronic
1015585261 6:134769843-134769865 AACAAAGATGTGCATCCACCAGG - Intergenic
1020204552 7:6104932-6104954 GACAATGACGTGCCTCCATCCGG - Exonic
1020763159 7:12291865-12291887 ACCCCGGAGGTGCCTCCAGCTGG + Intergenic
1021687707 7:23203236-23203258 AACAATGAGGTGGCAGCAGCTGG + Intergenic
1025958217 7:66198910-66198932 AACTGTGAGGTGCTTCCCGCAGG + Intergenic
1026230562 7:68479615-68479637 AACTATGAGGTAACTCCAACTGG + Intergenic
1027997455 7:85442922-85442944 AACAATGCGGAGCCTCCAGTGGG - Intergenic
1030135498 7:106243404-106243426 AACACTGAGGTGCTTTCAGCAGG + Intergenic
1034540640 7:151755931-151755953 CACCATGAGGTTCCTCCAGGAGG + Intronic
1037628487 8:20629774-20629796 AACAAGGAGGTGGCCTCAGCTGG - Intergenic
1040904954 8:52458728-52458750 CAGAATGAGGTGCCTGGAGCAGG - Intronic
1049557279 8:143289393-143289415 ACCCAGGAGGGGCCTCCAGCAGG - Intergenic
1053503769 9:38622368-38622390 CACAAGGAGCTGCATCCAGCAGG - Intergenic
1061991328 9:134160355-134160377 AACGATGAAGTTCCTGCAGCAGG - Intergenic
1186045254 X:5529503-5529525 AAAAATGAGGTGCTTCAAGTTGG + Intergenic
1188003279 X:25001576-25001598 CAGAATGAGGTCCCTCCAGCTGG + Intergenic
1188247867 X:27856131-27856153 AACATTGAGTTGCATCCAGATGG + Intergenic
1188847067 X:35085725-35085747 AAGATTGAGGAGCCTCCATCTGG + Intergenic
1190855612 X:54291357-54291379 AACAATAAGTTGTCTCTAGCTGG + Intronic
1192797302 X:74434566-74434588 CAGAATGAGGTGCCTACAGATGG + Intronic
1194211775 X:91079306-91079328 GAAAATGAGGAGCCTCCAGCAGG - Intergenic
1195259065 X:103115283-103115305 AACAATGGCGAGCCTCTAGCCGG + Intergenic
1195349942 X:103986250-103986272 ATCACTGTGGTGTCTCCAGCAGG + Intergenic
1195351978 X:104004893-104004915 ATCACTGTGGTGTCTCCAGCAGG - Intergenic
1195357501 X:104052589-104052611 ATCACTGTGGTGTCTCCAGCAGG - Intergenic
1200935827 Y:8737485-8737507 AAGAATGAGCTGCCTTCTGCTGG + Intergenic
1200961860 Y:9003250-9003272 AAGAATGAGGTGCCTTGTGCTGG - Intergenic