ID: 933199741

View in Genome Browser
Species Human (GRCh38)
Location 2:79435303-79435325
Sequence CTGCACTCTGAACATTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933199741_933199742 11 Left 933199741 2:79435303-79435325 CCTGCTTAATGTTCAGAGTGCAG 0: 1
1: 0
2: 0
3: 14
4: 109
Right 933199742 2:79435337-79435359 TATTCTTGTTTTGTGTGCATTGG 0: 1
1: 0
2: 1
3: 29
4: 432
933199741_933199744 13 Left 933199741 2:79435303-79435325 CCTGCTTAATGTTCAGAGTGCAG 0: 1
1: 0
2: 0
3: 14
4: 109
Right 933199744 2:79435339-79435361 TTCTTGTTTTGTGTGCATTGGGG 0: 1
1: 0
2: 2
3: 39
4: 496
933199741_933199743 12 Left 933199741 2:79435303-79435325 CCTGCTTAATGTTCAGAGTGCAG 0: 1
1: 0
2: 0
3: 14
4: 109
Right 933199743 2:79435338-79435360 ATTCTTGTTTTGTGTGCATTGGG 0: 1
1: 0
2: 5
3: 39
4: 632

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933199741 Original CRISPR CTGCACTCTGAACATTAAGC AGG (reversed) Intronic
900790126 1:4674519-4674541 CTGACCTCTGAACCTAAAGCAGG - Intronic
905272944 1:36798670-36798692 CTGCACTTTGAACACTAGGCTGG + Exonic
906534262 1:46543117-46543139 CTGCACTCTGAAGGTAGAGCTGG - Intergenic
906771410 1:48488326-48488348 CTGAACTCTGAACATTAGCATGG + Intergenic
909888667 1:80974743-80974765 CTTCACTCTAAAGATTAAGAAGG - Intergenic
910393183 1:86765073-86765095 GTGCACACTGGTCATTAAGCAGG - Intergenic
911446268 1:97996734-97996756 CTGGAGTCAGTACATTAAGCAGG + Intergenic
912538440 1:110394304-110394326 CTGCACTCTGGTCAGCAAGCGGG + Intergenic
917123558 1:171665526-171665548 CTGAACTCTGAAGAGTAAGTAGG - Intergenic
917450233 1:175141838-175141860 CTACACTCTGAACATTAGGATGG + Intronic
921108768 1:212012062-212012084 CTGCACTGTTAACAATAGGCTGG + Intronic
921702221 1:218281512-218281534 CTGCTCTGTGAAAATTGAGCTGG - Intergenic
922483820 1:225957988-225958010 CTGCACACTGAGCCTTAAACGGG - Intergenic
1063174537 10:3539673-3539695 CAGCACTCTGAAAATCAAGCCGG + Intergenic
1063885253 10:10570931-10570953 GTGCGCTCTGAATACTAAGCTGG + Intergenic
1070773362 10:79095732-79095754 TTGCACCCTGAAGATTAACCGGG - Intronic
1074238244 10:111608234-111608256 CTGGACTCTGAACAATGAGAAGG + Intergenic
1078488249 11:11743796-11743818 CTGCACACTGATTTTTAAGCAGG + Intergenic
1079383268 11:19957592-19957614 CTGCACTCAGTACATCAAGTGGG - Intronic
1084186246 11:67473547-67473569 CTGCCCTCTTAAGATTAAGAAGG - Intergenic
1084203695 11:67578513-67578535 CAGAACTTTGAAGATTAAGCTGG + Intergenic
1085808349 11:79657459-79657481 TTCCACTCTGAACCCTAAGCAGG + Intergenic
1086627893 11:88980354-88980376 GTGGTTTCTGAACATTAAGCAGG + Intronic
1086890782 11:92255559-92255581 GGGCACTCTGAATATTAAGGAGG + Intergenic
1089644143 11:119866860-119866882 CTGCTCTCTGAACAAAAGGCTGG - Intergenic
1096220093 12:49823696-49823718 CAGCACTGTGAACCTTATGCTGG - Intronic
1097305760 12:58067357-58067379 CTGCTCTGTGGACATCAAGCAGG + Intergenic
1097933320 12:65215045-65215067 CTTCATTCTGAAAATTTAGCAGG - Intronic
1098765152 12:74478860-74478882 GTGAATTCTGAACATTTAGCAGG + Intergenic
1102559706 12:113753598-113753620 CTGCCCACTGCTCATTAAGCAGG - Intergenic
1102854571 12:116281968-116281990 CTGCACTCTAAACTCTAACCTGG + Intergenic
1106444191 13:29809928-29809950 CTGCAGTCTGAACACTATGTTGG - Intronic
1109689666 13:65869153-65869175 TTGCACTCTCTACATAAAGCTGG - Intergenic
1109884364 13:68524025-68524047 CTGCACTCGGAACAGCCAGCTGG + Intergenic
1111533648 13:89573461-89573483 CTGCAATCTGAAGATAAAACTGG + Intergenic
1117708767 14:58501372-58501394 CTGCATTCTGCAAATTTAGCTGG - Intronic
1119066273 14:71530260-71530282 CTTCACTCTTAACAGTTAGCAGG + Intronic
1126202659 15:46005200-46005222 CAGCACTCTGAACATTAAAAGGG + Intergenic
1127761175 15:62140452-62140474 CAGCACTCTGAACGCTAACCTGG - Intergenic
1130159872 15:81388139-81388161 CTGCACTCTGAGCTTTATACTGG - Intergenic
1131018763 15:89080140-89080162 CAGCACTCTGCTCATAAAGCCGG + Intergenic
1131606169 15:93904995-93905017 CAGGACTCTGAAAATTTAGCAGG + Intergenic
1134597220 16:15505431-15505453 CTTCATTCTGAACCTTAAGCAGG + Intronic
1138373787 16:56548503-56548525 TTGAAATCTGAACATTGAGCAGG - Intergenic
1139074586 16:63428668-63428690 CTCCATTCTTAACATTAAGTTGG - Intergenic
1146974217 17:37097206-37097228 CTCCAGACTGAGCATTAAGCAGG - Intronic
1147559980 17:41502806-41502828 CTGCACTCTGAAATGCAAGCAGG + Exonic
1147669357 17:42167838-42167860 CCCCAGTCTAAACATTAAGCAGG + Intronic
1149157605 17:53650891-53650913 GTGTACTCTGAACAGTAAGCAGG + Intergenic
1149589689 17:57819179-57819201 CTGCACGCAGAACATTAATTAGG - Intergenic
1152823584 17:82449778-82449800 GTGCAGTCTGAACTTTCAGCAGG - Intronic
1153998979 18:10467524-10467546 CTTTATTCTGAACATTAGGCTGG + Intronic
1156930960 18:42642765-42642787 CTACACTCTCAGCATTAACCAGG - Intergenic
1159914646 18:74177573-74177595 CTGCACTTTCAACCTTGAGCAGG - Intergenic
1168217720 19:54938765-54938787 CTCCACGTTGAACATGAAGCTGG + Intronic
925829438 2:7879631-7879653 CTGCACTCTGTACATGCCGCAGG + Intergenic
927636914 2:24823168-24823190 CTGCACTCTGGCCATGAAGCCGG - Intronic
927841743 2:26449433-26449455 CTGCCCTCTGAACCTGCAGCTGG + Intronic
929923833 2:46193303-46193325 CTGCACTCTGATCAAGAAGTGGG - Intergenic
930700387 2:54454715-54454737 CTTCACTCTGTACATATAGCAGG - Intergenic
930933894 2:56922766-56922788 CTCCCCTCTCAACATCAAGCAGG + Intergenic
933199741 2:79435303-79435325 CTGCACTCTGAACATTAAGCAGG - Intronic
933851540 2:86370809-86370831 TTGCTCTGTGAAAATTAAGCTGG - Intergenic
940204231 2:151185043-151185065 CTACACTGTGAACAATAAGCTGG - Intergenic
947417834 2:229916603-229916625 CTGCACTCTCAAGACAAAGCAGG + Intronic
1170005996 20:11669652-11669674 CTGCACTTTGAATATGAAGTAGG - Intergenic
1170135311 20:13067352-13067374 CTTCACTCTCAACTTGAAGCTGG + Intronic
1170644298 20:18182929-18182951 ATTCACTCTGAACATTCATCAGG - Intronic
1172178165 20:32985046-32985068 CTGCACACTGTGCATTCAGCAGG + Intronic
1181776189 22:25161593-25161615 CAGCACTCTGAAGATAAAGCCGG - Intronic
1183717088 22:39539783-39539805 TTGCATTCTTAACATTGAGCTGG + Intergenic
952272978 3:31850659-31850681 CCCCACTCTGCACATAAAGCTGG + Intronic
956693181 3:71896427-71896449 TTGTCCTCTGAACATTTAGCTGG - Intergenic
959611468 3:108299934-108299956 CTGGAATCTGAAAATAAAGCTGG - Intronic
964620651 3:158717437-158717459 CTGAACTCTGAAGATGAAGAAGG + Intronic
968624778 4:1622255-1622277 CTGCACTCTGACCGTCACGCTGG - Intronic
969577316 4:8043951-8043973 GTGCACTCTGAAGCTTAGGCGGG - Intronic
970359178 4:15290983-15291005 CTGCAACCTGAACAATAAGCTGG + Intergenic
971521016 4:27550522-27550544 CTGGACTCTGAGGTTTAAGCAGG - Intergenic
971918764 4:32909857-32909879 CTGCACTCTGCACAGTCAGCAGG - Intergenic
971928343 4:33044459-33044481 GTGCACTTTGATCATTAACCTGG - Intergenic
975601387 4:76103680-76103702 CTGCCTTCTGAAGATAAAGCTGG + Intronic
980378851 4:131984093-131984115 CTTCACTCTGAAGATTATCCAGG + Intergenic
982543789 4:156708586-156708608 CTGCAAACTGGACATTCAGCAGG + Intergenic
986269543 5:6218711-6218733 CAGCACTTTGAACATTTACCAGG - Intergenic
987481275 5:18461553-18461575 CTGCAATTTAAACAATAAGCTGG + Intergenic
987548305 5:19342932-19342954 TTTTACTCTGAACATAAAGCTGG + Intergenic
988330192 5:29827561-29827583 CTGTGCTCTGATCATTAATCAGG + Intergenic
990791872 5:59490452-59490474 CTCCACTTTGAAGATGAAGCTGG + Intronic
993783467 5:92098494-92098516 ATACACTCTGCACATTAAACAGG - Intergenic
997851183 5:137333961-137333983 CATCACTGTGAACATGAAGCAGG + Intronic
997991955 5:138551961-138551983 CAGCACTCTGAACAGCATGCAGG - Intergenic
1000170901 5:158702252-158702274 CTGCAATCTGAAGATTATGTGGG + Intronic
1004465279 6:15879465-15879487 TTGAACTCTGAAAAATAAGCTGG + Intergenic
1004710179 6:18162442-18162464 CTGAAATCTGAACATCAAGCAGG - Intronic
1008302262 6:49855544-49855566 CTGCAATCTGAAGAATAAGTTGG - Intronic
1013217679 6:108043854-108043876 CTGCTCGCTGAACCTTAAGCTGG + Exonic
1018282364 6:162200395-162200417 CTCCACTCTGCACTTAAAGCAGG + Intronic
1018996319 6:168713069-168713091 CTGCACACTGGACATCTAGCAGG + Intergenic
1021504302 7:21364250-21364272 CTGCAATCTGGAGATTGAGCAGG + Intergenic
1024482715 7:49881277-49881299 CAGCACTCTAAAGATTTAGCTGG - Intronic
1028131238 7:87176404-87176426 CTGAACTTTGAGAATTAAGCTGG + Intronic
1034188984 7:149199194-149199216 GTGCATTCTGAACTTTAAGAAGG - Intronic
1036665706 8:10735924-10735946 CTCCACTCTGAACAATTATCAGG + Intronic
1036742221 8:11373745-11373767 CTGCACTTTTAAAATTATGCTGG - Intergenic
1037595231 8:20349237-20349259 CTGAACTCTGAGAATTGAGCAGG - Intergenic
1040448785 8:47523470-47523492 TTGCACTCTCCACATTCAGCTGG - Intronic
1042232305 8:66570337-66570359 CTGCACTCTGTCCTTTAGGCTGG + Intronic
1042569397 8:70146222-70146244 CTGTACTTTGAAAAGTAAGCAGG - Intronic
1046481433 8:114823529-114823551 CTGGACTCAGAAAATGAAGCAGG - Intergenic
1047191838 8:122685483-122685505 ATGCATTCTGAACATGAAGGTGG - Intergenic
1052456374 9:28704416-28704438 CGGAACACAGAACATTAAGCAGG - Intergenic
1055518161 9:77053977-77053999 CTGCACTCTGAGCATTAGCTGGG + Intergenic
1055970482 9:81906980-81907002 ATGCAGTTTGAACATTCAGCAGG + Intergenic
1056737103 9:89219359-89219381 CTGCACTCTCAACACTCACCCGG + Intergenic
1057998899 9:99845669-99845691 CTGCACTTTAAAAATTAAACAGG - Intronic
1195054003 X:101125029-101125051 CTTTACTCTGAAAATGAAGCTGG - Intronic
1195427301 X:104748748-104748770 CTGCTCTCTGAATTCTAAGCTGG - Intronic
1198678152 X:139152975-139152997 CTGCACTCAGAAAAATAAGTAGG + Intronic
1199388535 X:147251649-147251671 CTTCACTCTGTACATAAAGCAGG + Intergenic
1201791196 Y:17842106-17842128 CTGCACAATGAGCATTAAGATGG - Intergenic
1201810358 Y:18063883-18063905 CTGCACAATGAGCATTAAGATGG + Intergenic
1202352810 Y:24011754-24011776 CTGCACAATGAGCATTAAGATGG - Intergenic
1202517969 Y:25658361-25658383 CTGCACAATGAGCATTAAGATGG + Intergenic