ID: 933204396

View in Genome Browser
Species Human (GRCh38)
Location 2:79488796-79488818
Sequence CAGGAGAGGCTTTCTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 1, 2: 2, 3: 66, 4: 469}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933204396_933204402 1 Left 933204396 2:79488796-79488818 CCCTCCTCAGAAAGCCTCTCCTG 0: 1
1: 1
2: 2
3: 66
4: 469
Right 933204402 2:79488820-79488842 CTGTCCTTTCACTAGATTTTGGG 0: 1
1: 0
2: 1
3: 14
4: 211
933204396_933204401 0 Left 933204396 2:79488796-79488818 CCCTCCTCAGAAAGCCTCTCCTG 0: 1
1: 1
2: 2
3: 66
4: 469
Right 933204401 2:79488819-79488841 TCTGTCCTTTCACTAGATTTTGG 0: 1
1: 0
2: 1
3: 28
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933204396 Original CRISPR CAGGAGAGGCTTTCTGAGGA GGG (reversed) Intronic
900555581 1:3278774-3278796 CAGCAGAGGTTTTCTGAGTTTGG - Intronic
902255851 1:15188190-15188212 GGGGAGAGGCTGCCTGAGGAGGG - Intronic
902510857 1:16966247-16966269 CAGGTGAGGCTGTCCAAGGAGGG - Intronic
903188718 1:21644298-21644320 CTGGAAAGCCTTTCTGAAGAGGG - Intronic
903574531 1:24330686-24330708 CAGGAAAGGCTTTCTGGAGCAGG - Intronic
904078493 1:27857431-27857453 CAGGGGAGGCTTCCTTGGGAAGG + Intergenic
904633433 1:31860827-31860849 GAGAAGAGCCGTTCTGAGGATGG - Intergenic
904676008 1:32199697-32199719 CAGGAGTGGCTTCCTGGGGTTGG - Intergenic
904751948 1:32746384-32746406 CAGGGGAGGCTTTCTGGAGGAGG + Intronic
905294945 1:36948348-36948370 CAGGAGGTGCTTTCTCAGCATGG - Intronic
905393778 1:37654327-37654349 GGGGAGAGGCTTCCTGAGGCAGG - Intergenic
906186271 1:43864390-43864412 CAGGAGAGGCTTCCTAGAGATGG + Intronic
906646929 1:47481999-47482021 CGGGAGAGGCTTCCAAAGGATGG + Intergenic
906726662 1:48049168-48049190 GAGGAAAAGCTGTCTGAGGAGGG + Intergenic
906787290 1:48627069-48627091 GAGGAGAGTCTTTTTGTGGAAGG - Intronic
906942259 1:50265586-50265608 CAGGAAAGGCTTTCTAGAGAAGG - Intergenic
907126256 1:52053795-52053817 CAGGAGAAGCTTTTTGGAGAAGG - Intronic
907133866 1:52120944-52120966 CAGGAAAGTCTTTTTGAGGAAGG - Intergenic
907250240 1:53133300-53133322 CAGGGAAGGCTTCCTGAGGGAGG + Intronic
908384269 1:63626130-63626152 CAGGGGAGGCCATTTGAGGATGG + Intronic
908550690 1:65206041-65206063 CAAGACAGACCTTCTGAGGAAGG - Intronic
908927386 1:69272291-69272313 CAGGAAAGGCTTTGTGGAGAAGG + Intergenic
908982822 1:69979026-69979048 AAGGAGAGCCTGTCTAAGGATGG - Intronic
909949079 1:81697834-81697856 CAGGAAATGCACTCTGAGGAGGG - Intronic
910237019 1:85047478-85047500 CAGGAGAGGCTACCCGACGAAGG + Intronic
911631880 1:100192730-100192752 CAGGAAAGGAAGTCTGAGGATGG - Exonic
912363424 1:109113601-109113623 CAGGAGTGGCCTTCGTAGGAGGG + Intronic
912480945 1:109981821-109981843 CATGTGAGGCTATCTTAGGATGG + Intergenic
912761526 1:112371528-112371550 GAGGACAGGCTATCTGATGAGGG - Intergenic
913321105 1:117589122-117589144 CTGGAAAGCCTTGCTGAGGATGG + Intergenic
915064875 1:153216632-153216654 CAGGAAAGGCTCTCAGAGGGTGG + Intergenic
915870458 1:159554659-159554681 CAGGAGAGACTTCATGGGGATGG + Intergenic
916025613 1:160830867-160830889 CAGTCCAGGCTTTCAGAGGAGGG + Intronic
916599941 1:166282999-166283021 CAGAAGAGGCATTTTGAGGAAGG - Intergenic
916920536 1:169461403-169461425 CAGGAGTGGCTTCCTGAAGATGG - Intergenic
917790251 1:178494817-178494839 CAGGAGAGGCTGTCATAGCATGG + Intergenic
917805237 1:178607192-178607214 CAGGAATGGCTTTCTGTAGAAGG - Intergenic
919758995 1:201085221-201085243 CAGGGGAGGCGCTATGAGGATGG + Intronic
919791821 1:201296146-201296168 CAGGAGAGGCTGTGGGAAGAGGG + Intronic
921322372 1:213954385-213954407 AAGGAGCTACTTTCTGAGGAAGG - Intergenic
922107223 1:222523095-222523117 CAGGAAAGACTTACAGAGGAAGG - Intronic
922559802 1:226561058-226561080 CAGGAAAGGCTTTCGGAAGAGGG - Intronic
922605030 1:226884948-226884970 CACTATAAGCTTTCTGAGGATGG - Intronic
923390214 1:233507475-233507497 CAGCAGAGGAATTCTGTGGAAGG - Intergenic
923458258 1:234185170-234185192 CAGGAAAGGCATTCTGGGGTGGG + Intronic
924462807 1:244274459-244274481 TAAGGGAGGCTTCCTGAGGATGG - Intergenic
924786986 1:247208094-247208116 CTGGAGGCTCTTTCTGAGGATGG - Intergenic
1063051813 10:2457744-2457766 GAGGAGAGGCACCCTGAGGAGGG + Intergenic
1063934722 10:11065875-11065897 CAGGGTAGGCTTTCTCCGGAAGG + Intronic
1063951056 10:11223783-11223805 CAGGAGAGGATATCGGAGGATGG + Intronic
1064331878 10:14401768-14401790 CAGGGCAGGCTTCCTGAGGGAGG - Intronic
1064856773 10:19777439-19777461 GAGGAGAGGCTTCCTGGAGAAGG - Intronic
1065975630 10:30839531-30839553 CATGAGGAGCTTTCTGATGATGG - Intronic
1067043451 10:42970610-42970632 CTGCAGAGGCTTCCTGGGGAGGG + Intergenic
1067746128 10:48937968-48937990 CAGGCGAGGCTTCCTGGGTAGGG - Intronic
1069596619 10:69676168-69676190 CAGGAGAAGATTTCTGTGGAGGG + Intergenic
1069865228 10:71498266-71498288 CAGGAGAAGCTTTGGGAGCAAGG - Intronic
1070515630 10:77203416-77203438 CAGGGGAGGCTTTCTGGAGGAGG - Intronic
1070773562 10:79096918-79096940 CAGGAAGGCCTTTCTGAGGAGGG + Intronic
1070782076 10:79143478-79143500 CAAGGGAGGCTTTCTGGAGAAGG - Intronic
1071009407 10:80920171-80920193 CTAGAGAGTCTTCCTGAGGAAGG + Intergenic
1071547640 10:86540371-86540393 CAGGACAGGGATTCTGAGGTTGG + Intergenic
1072090544 10:92122748-92122770 CAGGAAAGGCTTTCTGTAGGTGG + Intronic
1072315025 10:94193791-94193813 CAGAAGTGGATTTCAGAGGAAGG - Intronic
1072756151 10:98022475-98022497 CAGAAAAGGCTCTCTGAAGATGG + Intronic
1073022970 10:100462198-100462220 TAGGGGAGGTTTTCTGAAGAAGG - Intergenic
1073217840 10:101846344-101846366 CAGGAGAGGCTGCCAGAGGAGGG + Exonic
1073241249 10:102059902-102059924 CTCCAGAGGCTTTCTGAGAAAGG + Intergenic
1074232724 10:111553847-111553869 CAGGAGAAGCTGACTGAGGGAGG - Intergenic
1074413249 10:113245623-113245645 GAGGAGAGGCTGACTGAGGAGGG + Intergenic
1074851008 10:117439694-117439716 CAGGAAAGGCTTCCTGAGGGAGG + Intergenic
1075549676 10:123383017-123383039 CAGGGGAGGCTTCCTGAAGCAGG + Intergenic
1075714381 10:124547687-124547709 CAGGAGAAGCAGTCTGAGGGAGG + Intronic
1076197018 10:128526150-128526172 CAGGAGAGGGTGGCTTAGGACGG - Intergenic
1076607746 10:131700499-131700521 AAGGAAAGGGTCTCTGAGGATGG + Intergenic
1077100058 11:818733-818755 AACGAGAGGCTTTCTCAGGTTGG - Intergenic
1077611251 11:3644353-3644375 AAGGAGACGCTCTCTGAGGTCGG + Intergenic
1078107271 11:8366197-8366219 CAGGGGAGGCTTCCTGGAGAAGG + Intergenic
1078129866 11:8604625-8604647 TAGGAAAAGCTCTCTGAGGAGGG + Intergenic
1078865538 11:15293908-15293930 CAGGGTAGGCTTTCTCTGGAAGG - Intergenic
1079277613 11:19056399-19056421 CAGTGGAGGTTTTCTGAGCATGG - Exonic
1081489283 11:43554871-43554893 CAAGAGAACCTATCTGAGGAGGG + Intergenic
1081847020 11:46248031-46248053 CAGGAGAGGGTTTCTGACTTTGG + Intergenic
1083554209 11:63613538-63613560 CAGCAGAGGGATTCAGAGGATGG - Intronic
1084160933 11:67349721-67349743 AAGGAGAAGCTTCCTGAGGAAGG - Intronic
1084431480 11:69113859-69113881 CAGGGGAGGCCTCCTGAAGAGGG - Intergenic
1084950945 11:72665206-72665228 GAGGAGAGGCTTCCTGGGGTTGG - Intronic
1085077909 11:73608339-73608361 CAGGAGAAGTTGTCTCAGGATGG + Intergenic
1085688498 11:78647200-78647222 CAGGAGAGGCTTCTAGAGGAAGG - Intergenic
1087074757 11:94118902-94118924 CAGGTCAGGCTTTCTGGGAAAGG + Intergenic
1088173145 11:107018973-107018995 GAGGAGACGCTTTCAGGGGAAGG + Intergenic
1088318425 11:108530705-108530727 CAGGAGCAGGTTTCTGAGAATGG + Intronic
1088706538 11:112469009-112469031 TAGGGGAGGCTCTCTGAGAAAGG - Intergenic
1089287885 11:117419497-117419519 CAGGAGGAGGTTTCTGAGGAGGG - Intergenic
1089538989 11:119178590-119178612 CAGGAGAGCCTCTTTGTGGAAGG + Intronic
1090247555 11:125227309-125227331 GAGGAAAGGCGTTCTGTGGATGG - Intronic
1091191424 11:133698649-133698671 CAGGGGAGCCTGTCTGAGAATGG - Intergenic
1091356667 11:134942832-134942854 CGGAAGAGGCTTTGTGAGCATGG - Intergenic
1091840288 12:3615666-3615688 CAGGAGAGGCTTCCTGGAGGAGG - Intronic
1091860037 12:3773001-3773023 CAGGAAAGCCTTTCTGGAGAAGG + Intergenic
1092098012 12:5860223-5860245 AGGAAGAGGCTTCCTGAGGAAGG - Intronic
1092447013 12:8567335-8567357 AAGGACAGGCTTGCTGGGGAGGG - Intergenic
1092756708 12:11770324-11770346 CAGGATGGGCATTCAGAGGAAGG + Intronic
1094388973 12:29928094-29928116 CAGGAAGGGCTTCCTGAGAAAGG + Intergenic
1096061656 12:48705782-48705804 CAGGAAGGGATTCCTGAGGATGG + Exonic
1096524297 12:52201337-52201359 CAGCTGGGGCTTCCTGAGGATGG - Intergenic
1096575055 12:52547630-52547652 CCGAGGAGGCTTTCTAAGGAGGG + Intronic
1096582758 12:52598958-52598980 CTGGAGATGCTGTCTGGGGACGG - Exonic
1097172488 12:57125031-57125053 CAGGAGGGCTTTTCTGAGGAGGG + Intronic
1098155548 12:67594083-67594105 AAGGAGAGTTTTTCTGAGCAGGG - Intergenic
1098290070 12:68949880-68949902 GATGAGAGGCTGTCTGAGAATGG - Intronic
1098905697 12:76159978-76160000 CATAAGAGGCTTCCTGAGGGAGG - Intergenic
1099105300 12:78488588-78488610 CAGGAAAGGCCTTGTTAGGATGG - Intergenic
1099945190 12:89235845-89235867 CAGAGGAGGCTTCCTGAAGAAGG - Intergenic
1102923542 12:116810239-116810261 CAGCAGAGACTTCCTGAAGAAGG + Intronic
1103863630 12:124034039-124034061 CAGGAGAGGCTTTCTACAGAAGG + Intronic
1103997854 12:124841738-124841760 CAGGAGGGCCTCTCAGAGGAGGG - Intronic
1104126977 12:125857056-125857078 CACTTGAGGCTTACTGAGGAGGG - Intergenic
1104591400 12:130086997-130087019 CAGAAGCAGCTTCCTGAGGATGG - Intergenic
1104612757 12:130242875-130242897 CAGAAGAGGCCTCCTGGGGAAGG - Intergenic
1104976782 12:132555721-132555743 CAGGAGGGGCCATGTGAGGACGG - Intronic
1105469423 13:20679479-20679501 AAGGAGAGGCTTCCCAAGGATGG + Intronic
1106124056 13:26885658-26885680 CATGATAAGCTTTCTAAGGAGGG - Intergenic
1107045148 13:35985701-35985723 CAGGAGAGACTGGCTGGGGATGG + Intronic
1107425369 13:40287711-40287733 CAGGAGTGGCTGTCTGAACATGG - Intergenic
1108056082 13:46486771-46486793 ATGGAGATGCTTTCTGAAGATGG + Intergenic
1108520298 13:51241054-51241076 CAGAAAAGGCTTTCTGAGCCAGG - Intronic
1109004354 13:56852430-56852452 TAGATGAGGCTTTCTGGGGAGGG + Intergenic
1109140678 13:58711315-58711337 CAGGAGAATTTTACTGAGGAGGG + Intergenic
1109444252 13:62412575-62412597 CAGGAAAGGATTTCTTATGAGGG + Intergenic
1110278016 13:73661291-73661313 CAGGAGAGGCGTTGTGGGGCAGG - Intergenic
1111551137 13:89814354-89814376 CAGGTGAGGCTATGTGAAGATGG + Intergenic
1111771272 13:92599290-92599312 CAGGAAAGGCTTTTGCAGGAAGG + Intronic
1112354475 13:98662326-98662348 CAGGAGAGGTTTTCTGGGCTGGG - Intergenic
1112699959 13:101996326-101996348 ATGGAGAAACTTTCTGAGGAGGG + Intronic
1112746936 13:102537022-102537044 CTGTAGAGGGTTTCTGAGAAAGG - Intergenic
1114539480 14:23444000-23444022 GAGGGGAGGGTTTCTGGGGAAGG + Intergenic
1115477145 14:33826252-33826274 CAGGTAAAGCTTTCAGAGGAAGG + Intergenic
1117475087 14:56085970-56085992 CAGGATAGGCTTTCCTAAGATGG - Intergenic
1117590761 14:57265804-57265826 CAGGATAGACATTCTGAGTAAGG - Intronic
1118359182 14:65041709-65041731 CGGGGGAGGCTTTCTGAAGGTGG - Intronic
1119519066 14:75272187-75272209 CAGGAGGGGCTTCCTGGAGAAGG + Intergenic
1119955764 14:78797134-78797156 CAGGGGAACCTTTCTGAGGGGGG + Intronic
1120087322 14:80288057-80288079 CAAGAGAGGCCTTAAGAGGAAGG + Intronic
1120445428 14:84588980-84589002 CAGGGAAGGCTTTATGGGGAGGG + Intergenic
1120874500 14:89363172-89363194 CTGGAGGGGCTTCCTGAGCAGGG - Intronic
1121423533 14:93832376-93832398 CAGGAGAGGCTTCCTGGAGGAGG + Intergenic
1121642359 14:95494322-95494344 CAGGAGAGGCTCATAGAGGAAGG + Intergenic
1121746527 14:96299268-96299290 CAGGAAAGGCTTTCTGGAGGTGG - Intronic
1121919911 14:97870880-97870902 CAGGGGAGGCTTCCTAGGGAAGG + Intergenic
1122500245 14:102193239-102193261 ACGGACAGGCTGTCTGAGGAAGG - Intronic
1122600164 14:102917420-102917442 CAGGGGAGGCTTCCTGAAAAAGG - Intergenic
1122956681 14:105074582-105074604 CAGGGGAGGGTCTCTGAGGAGGG - Intergenic
1123775400 15:23574529-23574551 CAGGAGAGGAAATCTGAGGGGGG + Intronic
1123985337 15:25641021-25641043 AAGGAGAGGCTTTCCAAGGACGG - Intergenic
1124004974 15:25788147-25788169 CAGGAGGGATTTTGTGAGGAAGG - Intronic
1124367190 15:29080465-29080487 CAGCAGAGGCATTGTGAGGAAGG + Intronic
1124521318 15:30408382-30408404 CAGGTGAGGTTTTCCGAGGGAGG - Exonic
1124537344 15:30557835-30557857 CAGGTGAGGTTTTCCGAGGGAGG + Exonic
1124761311 15:32449752-32449774 CAGGTGAGGTTTTCCGAGGGAGG - Exonic
1124777323 15:32599311-32599333 CAGGTGAGGTTTTCCGAGGGAGG + Exonic
1124880512 15:33638241-33638263 AAGGAGAGGATTTCTGTGGGTGG + Intronic
1126049452 15:44673182-44673204 CAGGAGGTGCTGGCTGAGGAGGG - Intronic
1126112227 15:45182082-45182104 CAGGAGAGGCTTGAGCAGGAAGG - Intronic
1126138766 15:45418972-45418994 CAGAGAAGGCTTTCTGAGAAAGG + Intronic
1127698563 15:61475036-61475058 CAGGAAAGACTTCCTGAGGGAGG + Intergenic
1128536437 15:68494182-68494204 CAGAGGAAGCATTCTGAGGAAGG - Intergenic
1128708694 15:69856224-69856246 CAGGAAAGCTTTCCTGAGGAAGG - Intergenic
1129195984 15:73966870-73966892 CACGAGAGGCTTTGTGGTGATGG + Intergenic
1129625642 15:77195844-77195866 GAGGGGAGGCTTCCTCAGGATGG - Intronic
1129677586 15:77640734-77640756 CAGGAGAGGCTTCCTGGGGGAGG + Intronic
1129740889 15:77989073-77989095 CAGGGAAGGCCTTCTGAGGAGGG + Intronic
1129777623 15:78247041-78247063 CAGGAGTGGCTTCCTGGTGAAGG + Intergenic
1130256989 15:82330375-82330397 CAGGGAAGGCCTTCCGAGGAGGG + Intergenic
1130597959 15:85259613-85259635 CAGGGAAGGCCTTCCGAGGAGGG - Intergenic
1130939505 15:88495940-88495962 AAGGAGAGGCTCTCTGGAGAGGG + Intergenic
1131537626 15:93250970-93250992 GAGGATAGGTTTCCTGAGGATGG + Intergenic
1132029148 15:98426530-98426552 CAGGAGGGGACTTCCGAGGAGGG - Intergenic
1133051963 16:3122016-3122038 AAAGAGTGGCTTGCTGAGGACGG + Intergenic
1133235668 16:4386334-4386356 CAGGAGACGCTTTCAGGGGATGG + Intronic
1133594427 16:7277352-7277374 CAGGAAAGGTTTTCTAAAGAAGG - Intronic
1134015668 16:10886435-10886457 CAGGAGAACCCATCTGAGGATGG - Intronic
1134162199 16:11900616-11900638 CAGCAGGGACTATCTGAGGAAGG - Intronic
1134173259 16:11985758-11985780 CAGCAGAGGCTTCCTGAGGCAGG + Intronic
1134779536 16:16883220-16883242 GAGGAAAGGCTGTGTGAGGATGG + Intergenic
1135075537 16:19390204-19390226 CTGAAGATGTTTTCTGAGGAAGG - Intergenic
1136066237 16:27760868-27760890 CAGGAGGGCTTCTCTGAGGAAGG + Intronic
1137761959 16:50948282-50948304 CAAGAGAGGCTCTCTCAGGTGGG - Intergenic
1137772063 16:51024367-51024389 CAGGGGTGGGTTTCTGAGGTTGG - Intergenic
1138335118 16:56246786-56246808 GAGGAGAGGCATTCTGGGAAAGG - Intronic
1139391434 16:66608358-66608380 CAGCAGAGGCGCTGTGAGGAAGG - Exonic
1139755766 16:69142416-69142438 CTGGAGACGTTGTCTGAGGAGGG - Intronic
1140083923 16:71777293-71777315 CAGGAGAGGCTACCAGAGGGTGG + Intronic
1142090183 16:88205936-88205958 CAGTGGAGGGTTTCAGAGGAAGG + Intergenic
1142467896 17:146533-146555 CAGGGGAGGGTTTGTTAGGAAGG - Intergenic
1142827388 17:2522298-2522320 CAGGAGAGGCTGTCGGGGGTCGG + Intergenic
1143258641 17:5582650-5582672 GAGGTGAGGCTTGCTGAGGCAGG - Exonic
1143879064 17:10015830-10015852 CAGGGGAGGCTTCCTGGAGAAGG - Intronic
1143950181 17:10626193-10626215 TAAGAGAGGCTCTCTGAGGATGG + Intergenic
1144069148 17:11651920-11651942 CAGGAGAGGGATTCACAGGAGGG + Intronic
1144262750 17:13538776-13538798 CAGGAGAGCCTATCTGGAGAAGG + Intronic
1144354724 17:14434424-14434446 TAGGAGATGCATCCTGAGGAAGG + Intergenic
1144852786 17:18252379-18252401 CAGCAGAGGCCTCCTGAGGGAGG - Intronic
1144870842 17:18369784-18369806 CAGGCAAAGCTTTCTCAGGATGG + Intergenic
1145899190 17:28478939-28478961 CAGGGAAGGCCTCCTGAGGAGGG + Intronic
1146005876 17:29160368-29160390 CAGGAGAGGCCTCCTGGTGAAGG - Intronic
1147049960 17:37786822-37786844 CAGGGAAAGCTTTCTGAAGATGG + Intergenic
1147250090 17:39147979-39148001 GAGGTGGGGCTCTCTGAGGAGGG + Intronic
1147429470 17:40362794-40362816 CAGGAGACGCGTTGTGGGGACGG - Intronic
1148347311 17:46912122-46912144 CAGGAGAGGAGGTGTGAGGAAGG - Intergenic
1150999740 17:70360999-70361021 CAGGAGATGCTTTTTGGGAATGG + Intergenic
1151658578 17:75507137-75507159 GAGGAAAGGGTTTCTGAGGGAGG + Intronic
1152365593 17:79854568-79854590 CAGGGAAGGCTCACTGAGGAAGG + Intergenic
1152381089 17:79942551-79942573 CAGGCCAGGCCTTCTGAGGAAGG - Intronic
1153618441 18:6954589-6954611 CGGAAGAGGCTGGCTGAGGAGGG + Intronic
1153948655 18:10038655-10038677 CAGGGAAGGCTTCCTGGGGAAGG + Intergenic
1156525697 18:37765511-37765533 CAGGAGTGGCCTTCTGAAGCAGG + Intergenic
1156964822 18:43078417-43078439 CAGGAAAGGCTTTCTTATAAAGG - Intronic
1157446669 18:47751457-47751479 CAGGGAAGGCTTTCTGGGGAGGG - Intergenic
1157594899 18:48858552-48858574 CAAGGGAGGCTTTGTGAAGAAGG + Intronic
1158709190 18:59822123-59822145 GAGAACAAGCTTTCTGAGGAAGG + Intergenic
1160053388 18:75456955-75456977 CAGGAGATGCTTTCAGGGGCAGG - Intergenic
1161238951 19:3211251-3211273 CAGGAGAAGCTTGTTCAGGAGGG + Intergenic
1161726649 19:5933246-5933268 AAAGAGAGGCTGTCTGAGCAGGG - Intronic
1161861601 19:6802024-6802046 TAGGAGAGGCATTATGAGGACGG - Intronic
1163648525 19:18503787-18503809 CAGGGAAGGCTCCCTGAGGAGGG - Intronic
1164503822 19:28841640-28841662 CAGGAAAGGCTTTTTGAAGAAGG - Intergenic
1164596927 19:29536291-29536313 CAGGAGAGGCTTCCTGTAGGTGG + Intronic
1164602796 19:29574677-29574699 CATGTGAGGCTCCCTGAGGAGGG + Intergenic
1164981690 19:32619240-32619262 GAGGTGAGGCTTCCAGAGGAAGG - Exonic
1165020873 19:32922957-32922979 CAGAAGGGGCTTTCGGAGGAAGG + Intronic
1165090026 19:33381410-33381432 CAGGAGAAGCTGTCCCAGGAGGG + Exonic
1165321691 19:35089324-35089346 CAGGTCAGGCATTCTGAGGGTGG - Intergenic
1166353005 19:42209472-42209494 CAGGAAAGGCTTCCTGAAGGAGG + Intronic
1167000339 19:46742030-46742052 GAGGGGAAGCTTTTTGAGGATGG - Intronic
1167769703 19:51507469-51507491 CAGGAGAGGCCTTCTGGAGGAGG - Intergenic
925153982 2:1636331-1636353 CAGGTAAGGCTGTCTGATGATGG + Intronic
926434548 2:12824697-12824719 CAGGAGAGACACTTTGAGGAGGG - Intergenic
926582826 2:14649728-14649750 GGAGAGAGGATTTCTGAGGATGG - Intronic
926615394 2:14992015-14992037 CAGGGAAGGCTTTCTGAAGGTGG + Intergenic
926699979 2:15797215-15797237 ACAGAGAGGTTTTCTGAGGAGGG + Intergenic
926701912 2:15809649-15809671 CTGGAGCCGCGTTCTGAGGAGGG - Intergenic
927292666 2:21420075-21420097 CAGGAGAGGCTGTGTGTGTAGGG - Intergenic
927713311 2:25339047-25339069 AAGGAGAGGCAGTGTGAGGAGGG - Intronic
927948596 2:27152469-27152491 CAGGAGGAGCCATCTGAGGAGGG - Intronic
928327964 2:30335041-30335063 AAAGAGAGGCTCTCTGTGGAAGG + Intergenic
928333574 2:30376631-30376653 CAGGAAAGACTTTCTGGAGAAGG - Intergenic
929455510 2:42062032-42062054 TAGGAGAGGCTTTCTGGAGCTGG - Intergenic
929763662 2:44826456-44826478 CAGTGGCGGCTTTCTGAGAAGGG + Intergenic
929867664 2:45732019-45732041 CAGGAAAGACTTTCTAAGGGTGG - Intronic
931089942 2:58874998-58875020 AAGCATAGGCTTTCTGAGGTGGG + Intergenic
931425239 2:62164782-62164804 CAAGAAAGGCTTTCTGAGCATGG - Intergenic
932455252 2:71845413-71845435 CAGGAAGGGCCTTCTGAGGAGGG + Intergenic
932487501 2:72093507-72093529 AAGGAGAAGCTTGCTGGGGAAGG - Intergenic
932571689 2:72941653-72941675 CAGGAGAGGCCTCCTAGGGAGGG - Intergenic
932697462 2:73968672-73968694 CAGCAGAAGCTTCCTGAAGATGG - Intergenic
933022271 2:77208628-77208650 GAGGTGAGGTTTTCTGAGGATGG + Intronic
933204396 2:79488796-79488818 CAGGAGAGGCTTTCTGAGGAGGG - Intronic
933391432 2:81673829-81673851 CAGGAGAGACAGTCTGAAGAGGG - Intergenic
933698018 2:85234876-85234898 CAGGAGAGGGTTGCTGGGGATGG + Intronic
933769517 2:85734216-85734238 CAGGACAGGCTGCCTGAGGTTGG + Intergenic
934476315 2:94595876-94595898 CAGGAGAGGCTTGGTCTGGAAGG + Intronic
936706398 2:115079924-115079946 AAGGAGAGGCTTTGTGATGATGG + Intronic
937272237 2:120660418-120660440 CAGGAGAGAATCTCTGAGGTGGG + Intergenic
937280661 2:120715377-120715399 CAGGAGAGGGGATCTGAGGCTGG - Intergenic
937863938 2:126733714-126733736 CAGGACAGGCATTCTGGGGCAGG + Intergenic
938380560 2:130834166-130834188 CAGGGGAGCCGTTGTGAGGAGGG - Intergenic
938470445 2:131554946-131554968 CAGTAGCGGTTTTCTGAGGAGGG - Intergenic
941995448 2:171597480-171597502 GACTAGAGGATTTCTGAGGATGG - Intergenic
942255609 2:174094150-174094172 CAGTAGAGTCTTTCTGAGACTGG + Intronic
942311772 2:174663161-174663183 CAGCTGAGGCTTTGTGAGCAAGG + Intronic
942932644 2:181514008-181514030 CTGGAGAGGTTTGCTGAGAATGG + Intronic
944636706 2:201681926-201681948 CAGGAAATGCTTACTGAGTAAGG - Intronic
944995975 2:205294144-205294166 CAGTAGAGTCTTTCTAAGGGAGG + Intronic
946313193 2:218894214-218894236 CAGGAGAGGTGTTCAGAGGGTGG + Intronic
946531546 2:220576112-220576134 CATGAAAGGCTCTCTCAGGAAGG + Intergenic
948281276 2:236749657-236749679 CAGGAAAGGATTCCTGAGGAAGG + Intergenic
948371049 2:237489167-237489189 CAGGTGAGGCTGTAGGAGGATGG - Intronic
948462733 2:238138187-238138209 CAGCAGAGGCTTTCCGAGCTTGG - Intergenic
948511198 2:238466426-238466448 CTTGAGAAGCTTCCTGAGGAGGG + Intergenic
948805195 2:240450910-240450932 CTGGGGAGGCTTCCTGAGGGAGG + Exonic
949021166 2:241742263-241742285 CATGTGAGGGATTCTGAGGAAGG - Intronic
1169106787 20:3003029-3003051 CAGGTGGGTCTCTCTGAGGAAGG - Intronic
1169743069 20:8916110-8916132 CAGAATAAGCTTTCTGAGGCTGG + Intronic
1169783444 20:9333315-9333337 AGGGAGAGCCTCTCTGAGGAGGG + Intronic
1170443547 20:16402223-16402245 CAGGAATGGCTTCCTGAAGAAGG - Intronic
1171035924 20:21713013-21713035 CAGGAGGGGCCCTATGAGGAAGG + Intronic
1172385700 20:34532604-34532626 CAGTTGAAGCTTCCTGAGGATGG - Intronic
1173616509 20:44406679-44406701 CAGGAGATGCTTTCGAAAGAGGG - Intronic
1173927027 20:46788312-46788334 CTGGAGAAACTTTCTGAAGAAGG - Intergenic
1174258540 20:49277382-49277404 CAGGGGGTGCTTGCTGAGGACGG + Intronic
1174399063 20:50266152-50266174 GAAGGGAGGCTTTCTGAGGCTGG + Intergenic
1174617015 20:51843471-51843493 CAGGAGGGCTTCTCTGAGGAAGG + Intergenic
1175278343 20:57787139-57787161 CAGGAAAGGCAGTCTGAGGTGGG - Intergenic
1175456064 20:59115401-59115423 AAGGAGATTCTTTCTGAGGAGGG - Intergenic
1176177218 20:63734418-63734440 CAGGAGAGGGCTGCGGAGGAGGG + Intronic
1177848711 21:26321471-26321493 CAGGAGAGGCTTTATTGAGAAGG + Intergenic
1178281664 21:31288434-31288456 CAGGAGAGGATGTATCAGGAAGG - Intronic
1179511546 21:41877167-41877189 TAGAAGGGGCTGTCTGAGGAGGG - Intronic
1180869606 22:19138761-19138783 GAGCAGAGGCTTTCTGAGTCTGG - Intronic
1181482248 22:23207671-23207693 GAGGAGAGGCCTTCTAAGCAGGG + Intronic
1181817786 22:25451663-25451685 CAGGAGTGGTTTCCTGAGGCTGG - Intergenic
1181953656 22:26572599-26572621 CAGGGAAGGCTTCCTGAAGAAGG - Intronic
1182050438 22:27308982-27309004 CAGGTTTGGGTTTCTGAGGAAGG + Intergenic
1182619545 22:31611362-31611384 CAGGAGACCATTTCTCAGGAAGG + Intronic
1182760934 22:32721859-32721881 CAGGGAAGGCTTTCTGAGAAGGG + Intronic
1182905704 22:33934382-33934404 AAAGACAGTCTTTCTGAGGAAGG + Intergenic
1183131786 22:35844105-35844127 CAGGAAAGGCTTTCTGGAGTAGG - Intronic
1183303081 22:37068036-37068058 CAGGGGAGGCTTCCAGGGGAGGG - Intronic
1183341208 22:37282937-37282959 GAGGAGATGCTGTCTGATGAGGG + Intronic
1183379219 22:37482556-37482578 CAGGGAAGGCTTCCTGGGGAAGG - Intronic
1183380688 22:37489185-37489207 CCAGAGAGGCTTTCCCAGGATGG - Intergenic
1183749329 22:39710857-39710879 CAGGAGCGGTTTTCTGTGTAAGG - Intergenic
1184029888 22:41886339-41886361 CAGGGTGGGCTTTCTGGGGAAGG + Intronic
1184122472 22:42461183-42461205 CAGAAAAGCCCTTCTGAGGAGGG + Intergenic
1185366262 22:50438312-50438334 CGGCAGAGGCTTTGTGGGGATGG - Intronic
950030172 3:9846973-9846995 CAGGAGGGACTTTCTTAAGAAGG + Intronic
950160892 3:10760221-10760243 TGGGAGAGGCTGCCTGAGGAAGG - Intergenic
950388091 3:12675552-12675574 AAGAAGAGGCATTCTGGGGATGG - Intergenic
950577346 3:13840193-13840215 CAGGAGAGGCCTCCTGGAGAAGG - Intronic
952153781 3:30620980-30621002 TAGGAGTGGGTTTCTAAGGATGG + Intronic
953702923 3:45210605-45210627 CAGAAGTGTCTTTCTGAGGAAGG - Intergenic
954647307 3:52139542-52139564 CAGGGGAGGCTTCCTGGAGAAGG - Intronic
955886532 3:63605216-63605238 CAGGAAAGACTATCTGGGGAGGG + Intronic
956377838 3:68634735-68634757 AGAGAGAGCCTTTCTGAGGAAGG - Intergenic
959908134 3:111732772-111732794 CACCAGAGTGTTTCTGAGGAGGG + Intronic
960855822 3:122101120-122101142 GAGGAGAGGGAGTCTGAGGAGGG + Intronic
961018447 3:123484706-123484728 CCTGATAGGCTTTCTCAGGATGG + Intergenic
961669991 3:128522087-128522109 GAGGAGAGGCTTCCTGAGAATGG + Intergenic
962102688 3:132359178-132359200 CAGGAAAGGCTTTCTGCAGAAGG + Intronic
963084463 3:141423975-141423997 CAGGAGAGGCTTCTTTAGGAAGG + Intronic
964409064 3:156379453-156379475 CAGGGAAGGCTTTCTTGGGAAGG + Intronic
964570081 3:158101498-158101520 CAGGAGAGGCTTAAAAAGGAAGG + Intronic
964835173 3:160930066-160930088 CAAGGGAGAGTTTCTGAGGAAGG - Intronic
966667030 3:182482738-182482760 AAGGAGAGGTTTTCTGAGTTAGG - Intergenic
967751196 3:193118261-193118283 CTGGAGAGGCTATGTGTGGAAGG + Intergenic
967937936 3:194744049-194744071 CAGGCAAGGCTTCCTGAGAATGG - Intergenic
969148609 4:5146541-5146563 CAGGTGGGTCTTCCTGAGGATGG + Intronic
969228909 4:5816348-5816370 CAGGGAAGGATTTCTGAGCACGG - Intronic
969895218 4:10297634-10297656 CAGGAGAGGCTTCCTAAGGACGG + Intergenic
970419756 4:15894585-15894607 CAGGAGAGGCTTCCTGGTGTTGG - Intergenic
972226172 4:37015408-37015430 CAAGTGAGTTTTTCTGAGGAAGG - Intergenic
972886666 4:43499871-43499893 CAAGAGAGGCTTTCTCAGCTGGG + Intergenic
973858658 4:55039034-55039056 AAAGAGAGGCTATATGAGGAAGG - Intergenic
975325089 4:73050190-73050212 AAGGCTAGGCTTTCTGAGCATGG + Intergenic
977962392 4:103100719-103100741 CAGGTGGGAATTTCTGAGGAGGG + Intergenic
978597318 4:110392313-110392335 CAGGGGAGACATTCTGAAGATGG + Intronic
979738855 4:124125172-124125194 CAGGAGAGGTTTTCTGAGGAAGG + Intergenic
980078175 4:128315991-128316013 CAGAAGAGGCTTTCAGTGGGAGG + Intergenic
980086462 4:128395491-128395513 AAGGTGAGGATTTCTGAGAAGGG - Intergenic
981155084 4:141425565-141425587 CAGGAGAGACTATCTTAGGCAGG + Intergenic
981772721 4:148328558-148328580 CAGGAGAGGTCTTTTGAGGGGGG - Intronic
982035219 4:151339307-151339329 CAGGAGATGCTTCCTAAGGAAGG - Intergenic
982065585 4:151651632-151651654 CAGGAGAAGCCTGGTGAGGAGGG + Intronic
982791169 4:159593231-159593253 CAGGAGAGGCATTCTGTTGGGGG - Intergenic
985476431 5:81880-81902 CAGGGGAGGCTTCCTGGGGAAGG + Intergenic
985720093 5:1484443-1484465 CAGGACAGGCGGTCTGAGAAGGG + Intronic
985770003 5:1803657-1803679 CAGAAAAGGGTTTCTGAGGATGG - Intronic
986018871 5:3782233-3782255 AAGGACCGGATTTCTGAGGAAGG - Intergenic
986169904 5:5306895-5306917 TGGGTGTGGCTTTCTGAGGATGG + Intronic
987526257 5:19053707-19053729 CAGGAGCAGCCTTCTGAAGAAGG + Intergenic
992883094 5:81130157-81130179 CTGGTGGTGCTTTCTGAGGAGGG + Intronic
994999419 5:107108249-107108271 GAGAAGAGTTTTTCTGAGGATGG - Intergenic
995067486 5:107878779-107878801 CACGAGAGGCTCTGTGAGGATGG - Intronic
995206339 5:109485549-109485571 CAAGGGAGGCTTCCTGAAGAAGG + Intergenic
995359942 5:111284547-111284569 CAAGAGAGACTATCTGAGGCTGG - Intronic
995871481 5:116748156-116748178 CAGGAGAGGCCTTGGGAGGGAGG - Intergenic
995956168 5:117778964-117778986 CTGGAAATGCTTTCTTAGGAAGG + Intergenic
997013719 5:129905972-129905994 CAGCAGGGGCTTTCAGAGGAGGG - Intronic
997475698 5:134141181-134141203 CAGGAGAGTCCTTCTAAGTAGGG - Intronic
997768142 5:136525818-136525840 CAGGAGAAGCTTTGAGATGAAGG - Intergenic
997847683 5:137302970-137302992 CATGAGAATCCTTCTGAGGAAGG + Intronic
998016099 5:138733638-138733660 CAGGAAAGGCATTTTGAGGAAGG + Intronic
998265504 5:140664928-140664950 GAGGAGAGGCCCGCTGAGGATGG + Exonic
998567590 5:143229889-143229911 TAGGCGAGGCTTTCTGAGTATGG + Intergenic
999231499 5:150064836-150064858 CAGGGGAGGGTTCCTGAGGCAGG - Intronic
999307606 5:150530259-150530281 CAGGAGAGCCTTTAAGAGAATGG - Intronic
1000267847 5:159655267-159655289 CAGGAAAGGCTTCCTGGAGAAGG + Intergenic
1001985024 5:176066557-176066579 CATGCGGGTCTTTCTGAGGACGG + Intronic
1002231843 5:177771578-177771600 CATGCGGGTCTTTCTGAGGACGG - Intronic
1002373750 5:178774296-178774318 CATGTGAGGTTTTATGAGGACGG + Intergenic
1002765535 6:235568-235590 ATGAAGAGGATTTCTGAGGAGGG - Intergenic
1003009013 6:2409112-2409134 CAGAGGAGGATTTGTGAGGAGGG + Intergenic
1003016416 6:2471438-2471460 CACGTGGGGCATTCTGAGGATGG + Intergenic
1003317615 6:5026385-5026407 CAGGAGAGGCTCTGGGAGGCGGG - Intergenic
1004391061 6:15210207-15210229 CAGAAGAGCCATTCTGAGGAAGG + Intergenic
1004986966 6:21093344-21093366 CTGGAAAGGCTTCCTGAGAAAGG - Intronic
1006562672 6:34927212-34927234 CAGGAGAGGCTTTCTTGGTGGGG + Intronic
1006646063 6:35515055-35515077 CAGGCAAGGCTGCCTGAGGAAGG + Intergenic
1006866855 6:37215715-37215737 CAGGGGAGGCTTTCTGGAGTAGG + Intronic
1007166890 6:39834931-39834953 CAGGGAAGGCTTTCTGGAGAAGG - Intronic
1007611251 6:43150730-43150752 CACCTGAGGCATTCTGAGGACGG + Intronic
1008787702 6:55189401-55189423 CATGAGAGGCAGTCTGAAGATGG + Intronic
1009445065 6:63732979-63733001 CAGGAAAGGCATTATGAAGAAGG + Intronic
1010503528 6:76629402-76629424 TATGTGAGGATTTCTGAGGAAGG + Intergenic
1010588387 6:77682836-77682858 CAGAAAAGGCATTCAGAGGAAGG + Intergenic
1011100613 6:83716614-83716636 CAGGAAAGTCTGTCTGAAGAAGG + Intergenic
1011266279 6:85522957-85522979 CAGGGAAGCCTTTCTTAGGAAGG - Intronic
1012944161 6:105448314-105448336 CTGGGGAGGCTCTCTGAGGAGGG - Intergenic
1012944617 6:105451941-105451963 GAGGAGTGGCTATCTGGGGAGGG + Intergenic
1015505013 6:133975765-133975787 AAGTAGAGGCTTTCTCTGGAGGG + Intronic
1015974408 6:138774569-138774591 AAGAAGAGGCTTTCTGGGAAAGG - Intronic
1016193321 6:141298193-141298215 CAGGAGAGACTTTCAGCAGAAGG - Intergenic
1016391161 6:143577418-143577440 CAGGAGAGGCTTTGTGAGAAGGG + Intronic
1017066119 6:150530872-150530894 CAGGAAAGGCTTTCCGAAGAAGG + Intergenic
1018208614 6:161459063-161459085 CAGCAGACACTCTCTGAGGAAGG - Intronic
1018787804 6:167121776-167121798 CAGGAGAGGCTTTGTTTGGAAGG + Intergenic
1019524031 7:1472755-1472777 CAGGGGAGGCTTCCTGGGGAGGG + Intronic
1020044686 7:5032091-5032113 CAGCAGAGCCCTCCTGAGGAAGG - Intronic
1020290040 7:6716113-6716135 CAGCAGAGCCCTCCTGAGGAAGG - Intergenic
1020762984 7:12290565-12290587 GAGGACAGGCTTGCTGGGGAGGG + Intergenic
1021098145 7:16556431-16556453 CAGGAAAGGCTTTGTGAAAAAGG + Intronic
1022203776 7:28143231-28143253 CAGGAAGGGCTTCCTGAGCAGGG - Intronic
1022489118 7:30803112-30803134 CAGGAAAGGCTTCTTGAAGAAGG - Intronic
1023825643 7:44007113-44007135 CAGCAGAGCCCTCCTGAGGAAGG + Intronic
1023965958 7:44963190-44963212 CGGCAGAGGCTTCCTGGGGAGGG - Intronic
1023997226 7:45167680-45167702 CAGGAGAGGCTTCCCAAGGCAGG - Intronic
1024569388 7:50711262-50711284 CAGGAGAGGGTTTCAGGGGGTGG - Intronic
1024598485 7:50960012-50960034 CTGGAGTGGCTTTCAGAGGAAGG + Intergenic
1026089195 7:67285889-67285911 CAGCAGAGCCCTCCTGAGGAAGG + Intergenic
1026518429 7:71093560-71093582 TTGGAAAGGCTTTCTGAGTAGGG + Intergenic
1026725056 7:72864461-72864483 CAGCAGAGCCCTCCTGAGGAAGG - Intergenic
1026747188 7:73022657-73022679 CAGCAGAGCCCTCCTGAGGAAGG - Intergenic
1026750838 7:73050800-73050822 CAGCAGAGCCCTCCTGAGGAAGG - Intergenic
1026754487 7:73078910-73078932 CAGCAGAGCCCTCCTGAGGAAGG - Intergenic
1026758139 7:73106943-73106965 CAGCAGAGCCCTCCTGAGGAAGG - Intergenic
1026844352 7:73689598-73689620 AAGGAGAGGGTTTCTGAGTGAGG + Intronic
1026974510 7:74489238-74489260 GAGGTGAGGGTATCTGAGGATGG - Intronic
1027033292 7:74907228-74907250 CAGCAGAGCCCTCCTGAGGAAGG - Intergenic
1027089266 7:75286541-75286563 CAGCAGAGCCCTCCTGAGGAAGG + Intergenic
1027092909 7:75314469-75314491 CAGCAGAGCCCTCCTGAGGAAGG + Intergenic
1027096552 7:75342436-75342458 CAGCAGAGCCCTCCTGAGGAAGG + Intergenic
1027118785 7:75501207-75501229 CAGCAGAGCCCTCCTGAGGAAGG + Intergenic
1027273011 7:76534252-76534274 CAGCAGAGCCCTCCTGAGGAAGG - Intergenic
1027322795 7:77025244-77025266 CAGCAGAGCCCTCCTGAGGAAGG - Intergenic
1027326460 7:77053336-77053358 CAGCAGAGCCCTCCTGAGGAAGG - Intergenic
1028936040 7:96465281-96465303 CAGAAGAGGCTTTCAGGGAAAGG - Intergenic
1029259723 7:99293583-99293605 CAGGAGAGACTCTCTGAGAAGGG - Intergenic
1029397661 7:100319410-100319432 CAGCAGAGCCCTCCTGAGGAAGG + Intronic
1029538630 7:101170337-101170359 GTGGAGAGGGGTTCTGAGGAGGG - Intergenic
1029709540 7:102292095-102292117 CTGGGCAGGTTTTCTGAGGATGG + Intronic
1029718702 7:102348810-102348832 CAGCAGAGCCCTCCTGAGGAAGG - Intergenic
1029753913 7:102560445-102560467 CAGCAGAGCCCTCCTGAGGAAGG + Intronic
1029771863 7:102659535-102659557 CAGCAGAGCCCTCCTGAGGAAGG + Intronic
1031452416 7:121938146-121938168 ATGGAGAGGATTTCTGAGGTGGG - Intronic
1032036607 7:128526077-128526099 CAGGTGAGGCTGGCTGATGATGG - Intergenic
1032192255 7:129771832-129771854 AAGGAGAGGCTTGGTGGGGAAGG + Intergenic
1032360272 7:131248973-131248995 CAGGAGAGGGTTTCTTGGGGTGG - Intronic
1032530828 7:132618246-132618268 GAGGAAAAGCTTCCTGAGGAAGG - Intronic
1033088723 7:138365810-138365832 GAAGAGAGGCTTTGTGATGAAGG - Intergenic
1033753730 7:144380128-144380150 CAAGAGAGGCCTTCTGTGGATGG + Exonic
1034544271 7:151779583-151779605 CAGGGCAGGCTTTCTGAGCGGGG - Intronic
1034950047 7:155290880-155290902 CAGGAGAAGCCGTGTGAGGACGG - Intergenic
1035412315 7:158654751-158654773 TAGGAGAAGCTTTGTGAGGCTGG - Intronic
1037381900 8:18294127-18294149 CAGGAGATTCTTCCTGAGAAGGG - Intergenic
1037504274 8:19515107-19515129 CAGGAAAGGCACTCTGAGGCTGG - Intronic
1038443402 8:27586836-27586858 CAGCTGAGGCCTTCTGAGGCTGG + Intergenic
1038655294 8:29445201-29445223 CAGAACAGGTTCTCTGAGGAAGG - Intergenic
1038997985 8:32946275-32946297 CAGGAGAGGCTTCCCCATGAGGG - Intergenic
1039032796 8:33328175-33328197 CAGGACAGGCTGTCCGAGGAGGG + Intergenic
1040604562 8:48918846-48918868 CAGGAGAGACATTCTGGAGAAGG + Exonic
1041188576 8:55328835-55328857 AAGGACAGGTTCTCTGAGGAGGG - Intronic
1041635843 8:60142937-60142959 AAGGAGATTCTTTCTGATGAAGG + Intergenic
1041688443 8:60665968-60665990 CATGAGAGGCTCTCAGAGGAAGG - Intergenic
1042876482 8:73444937-73444959 TAGGAGAAGCCTTCAGAGGAAGG + Intronic
1044257069 8:90076648-90076670 AAGAAAAGGCTTTCTGTGGAAGG - Intronic
1044510412 8:93070925-93070947 CAGAAGAGCCCTTCTGAAGAAGG - Intergenic
1047223657 8:122938890-122938912 CAGTAGAGGTGTTTTGAGGATGG + Intronic
1047401724 8:124553828-124553850 TTGGTGAGGCTTTCTGAAGATGG - Intronic
1047726564 8:127689042-127689064 CAGGAGAGGCTTCCTGGAGGAGG - Intergenic
1047793073 8:128225151-128225173 CAAGGAAGGCTTTCTGAGGCAGG - Intergenic
1049002409 8:139834448-139834470 CAGAGCTGGCTTTCTGAGGAAGG + Intronic
1049043514 8:140130613-140130635 CAGGAGTGGCTTTTAGATGAAGG - Intronic
1051559136 9:18420667-18420689 CAGGAGAGGGTTTGAGAGGGAGG + Intergenic
1051559225 9:18421577-18421599 CAGGAGAGGGTTTGAGAGGGAGG - Intergenic
1052381326 9:27774064-27774086 AAGGAGATGCTTTTTGAGAAAGG - Intergenic
1052853722 9:33394046-33394068 CAGGAGAGGCTTGGTCTGGAAGG - Intronic
1053109482 9:35445359-35445381 CAGGATAAGCTTTCTGCAGATGG - Intergenic
1053681749 9:40490200-40490222 CAGGAGAGGCTTGGTCTGGAAGG - Intergenic
1053931742 9:43118529-43118551 CAGGAGAGGCTTGGTCTGGAAGG - Intergenic
1054281965 9:63134734-63134756 CAGGAGAGGCTTGGTCTGGAAGG + Intergenic
1054294841 9:63325717-63325739 CAGGAGAGGCTTGGTCTGGAAGG - Intergenic
1054392861 9:64630204-64630226 CAGGAGAGGCTTGGTCTGGAAGG - Intergenic
1054427511 9:65135413-65135435 CAGGAGAGGCTTGGTCTGGAAGG - Intergenic
1054502866 9:65886127-65886149 CAGGAGAGGCTTGGTCTGGAAGG + Intronic
1054862810 9:69970675-69970697 CAGCAGAGGCTTTCTGACTGTGG + Intergenic
1056420079 9:86415885-86415907 TAGGACAGCCTCTCTGAGGAGGG + Intergenic
1056580485 9:87885738-87885760 CATCAGAGACTTGCTGAGGACGG - Exonic
1056789915 9:89618593-89618615 CAGGAGAAGCGGTGTGAGGAGGG - Intergenic
1056854863 9:90117826-90117848 CTGGAAAGGCTTTTTCAGGAAGG - Intergenic
1057852332 9:98575232-98575254 CAGGAAAGGCTTCCTGAAGGAGG + Intronic
1057962866 9:99473699-99473721 CAGGACAGACATTCTGAAGATGG - Intergenic
1058475393 9:105327771-105327793 CAGGATAGGTGTCCTGAGGAAGG - Intronic
1058897832 9:109415316-109415338 CAGGAGAGGCTTCCTGGAGCAGG + Intronic
1059652109 9:116324661-116324683 GAGTAAAGGCTTTCAGAGGAGGG + Intronic
1059744057 9:117183045-117183067 CAAGAAGGCCTTTCTGAGGAAGG - Intronic
1060662672 9:125413668-125413690 CAGGCGTGGCTTGCAGAGGATGG + Intergenic
1060765525 9:126293005-126293027 CAGGATAGGCGATCTGAGAAGGG + Intergenic
1061085284 9:128394451-128394473 CAGGAGAGCATTTCAGAGCAAGG - Intergenic
1061508318 9:131045329-131045351 CAGGGGAGGCTGTCTGAAGCAGG + Intronic
1061527722 9:131181109-131181131 CAGGGAAGGCCTTCTCAGGAAGG + Intronic
1062056645 9:134472468-134472490 CAGGAGAGGCTTTCTGGGCGGGG + Intergenic
1062236853 9:135514492-135514514 AAGGAGAGGGTCTCAGAGGAGGG + Intergenic
1062348798 9:136128683-136128705 CAGGAGAGTCTGTCTTGGGAAGG + Intergenic
1203773364 EBV:60318-60340 CAGGAGGCGCCTTCTGAGGGTGG + Intergenic
1185615315 X:1418552-1418574 GAGGAGAGGCATTCAGAGGTTGG + Intronic
1186605241 X:11083045-11083067 CAGCAGAGGTTTTCTGTGAAGGG + Intergenic
1187796939 X:23014170-23014192 TAGGAGAGGGTATCTGAAGAGGG - Intergenic
1188611621 X:32106527-32106549 AAGGAGAGGCTGTCTGAGTAGGG + Intronic
1189082296 X:37987613-37987635 AAGGAAAGGCTTTATTAGGAGGG + Intronic
1190502558 X:51094268-51094290 CAGTAGAGGCTGTCAGAGGAAGG - Intergenic
1190937780 X:55012288-55012310 TTGGAGAGGCTTTGTGAGTAAGG - Intronic
1191287846 X:58757035-58757057 CAGAAAAGGCTTTGTGAGGATGG + Intergenic
1191322793 X:59223001-59223023 CAGAAACGGCTTTGTGAGGATGG + Intergenic
1191392195 X:60150958-60150980 CAGAAAAGGCTTTGTGAGGATGG + Intergenic
1191403268 X:60299394-60299416 CAGAAAAGACTTTTTGAGGATGG + Intergenic
1191404348 X:60313794-60313816 CAGAAGCGACTTTGTGAGGATGG + Intergenic
1191421422 X:60542437-60542459 CAGAAGCGACTTTGTGAGGATGG + Intergenic
1191479894 X:61325400-61325422 CAGAAACGGCTTTGTGAGGATGG + Intergenic
1191490385 X:61466169-61466191 CAGAAGCGACTTTGTGAGGATGG + Intergenic
1191536528 X:62083028-62083050 CAGAAGCGACTTTGTGAGGATGG + Intergenic
1191563154 X:62489055-62489077 CAGAAAAGACTTTGTGAGGATGG - Intergenic
1192433620 X:71128829-71128851 AAGGACTGGCCTTCTGAGGAAGG - Intronic
1193540043 X:82759952-82759974 CAGGGAAGGCTTTCTGAAGGAGG - Intergenic
1193577781 X:83224632-83224654 CTGGAGAGACTTTCTGTGGAGGG - Intergenic
1195616959 X:106920198-106920220 CAGGAGAGGCCTTGTGGGGAGGG - Intronic
1195967924 X:110445872-110445894 GAAGAGAGGCCTTCTAAGGAAGG - Intronic
1196728302 X:118917031-118917053 CAGGAGAGGCTGCCTGGAGAAGG + Intergenic
1197887576 X:131234616-131234638 GAGGAGAAGGTGTCTGAGGAGGG - Intergenic
1198164227 X:134037871-134037893 TAGGAGAGGCTTCATGAAGAAGG + Intergenic
1198397979 X:136242060-136242082 CAGTAGAGGCTTTGTAAGGATGG - Intronic
1198523213 X:137473675-137473697 GAGGAAAGACTTTCTGAGAAGGG + Intergenic
1198747741 X:139907334-139907356 CAGGAGAAGCTTCTTTAGGAAGG - Intronic
1200180969 X:154150500-154150522 GAGGGGAGACTGTCTGAGGATGG + Intronic
1200186612 X:154187614-154187636 GAGGGGAGACTGTCTGAGGATGG + Intergenic
1200192264 X:154224752-154224774 GAGGGGAGACTGTCTGAGGATGG + Intronic
1200198019 X:154262556-154262578 GAGGGGAGACTGTCTGAGGATGG + Intronic
1200223645 X:154404714-154404736 CAGGTGAGGCTGTCCCAGGATGG + Intronic
1200951664 Y:8904048-8904070 CAGAGGAGGCTTACTGCGGAAGG + Intergenic