ID: 933207641 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:79527181-79527203 |
| Sequence | CTAAATTTAAAAATGGACAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2856 | |||
| Summary | {0: 2, 1: 4, 2: 114, 3: 620, 4: 2116} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 933207638_933207641 | 18 | Left | 933207638 | 2:79527140-79527162 | CCATATAAAGAATGATTACAGCT | 0: 1 1: 0 2: 0 3: 23 4: 214 |
||
| Right | 933207641 | 2:79527181-79527203 | CTAAATTTAAAAATGGACAAAGG | 0: 2 1: 4 2: 114 3: 620 4: 2116 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 933207641 | Original CRISPR | CTAAATTTAAAAATGGACAA AGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||