ID: 933207641

View in Genome Browser
Species Human (GRCh38)
Location 2:79527181-79527203
Sequence CTAAATTTAAAAATGGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2856
Summary {0: 2, 1: 4, 2: 114, 3: 620, 4: 2116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933207638_933207641 18 Left 933207638 2:79527140-79527162 CCATATAAAGAATGATTACAGCT 0: 1
1: 0
2: 0
3: 23
4: 214
Right 933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG 0: 2
1: 4
2: 114
3: 620
4: 2116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933207641 Original CRISPR CTAAATTTAAAAATGGACAA AGG Intronic
Too many off-targets to display for this crispr