ID: 933209126

View in Genome Browser
Species Human (GRCh38)
Location 2:79545683-79545705
Sequence GGAAATCACTGACACCTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933209126_933209132 10 Left 933209126 2:79545683-79545705 CCCACTAGGTGTCAGTGATTTCC 0: 1
1: 0
2: 0
3: 14
4: 182
Right 933209132 2:79545716-79545738 ACTCTCGATTTAGGCAAATCAGG 0: 1
1: 0
2: 8
3: 5
4: 63
933209126_933209131 1 Left 933209126 2:79545683-79545705 CCCACTAGGTGTCAGTGATTTCC 0: 1
1: 0
2: 0
3: 14
4: 182
Right 933209131 2:79545707-79545729 AGGTTGATAACTCTCGATTTAGG 0: 1
1: 0
2: 0
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933209126 Original CRISPR GGAAATCACTGACACCTAGT GGG (reversed) Intronic
902385904 1:16075707-16075729 CAAAATCACTGGCACGTAGTAGG + Intergenic
906078535 1:43068986-43069008 GGTAATCACTGACAACAAGCCGG + Intergenic
906654489 1:47537675-47537697 GCAAAGCACTGACACCAGGTTGG + Intergenic
909351692 1:74660803-74660825 GGAAATCACTGACAGCCATTAGG - Intronic
909548765 1:76875834-76875856 GCAAAGTACTGTCACCTAGTTGG + Intronic
909881865 1:80889797-80889819 ACAAATTACTGGCACCTAGTAGG + Intergenic
916285513 1:163100875-163100897 GCAAAGTACTGTCACCTAGTTGG - Intergenic
917817822 1:178727777-178727799 GGAACTAACTGGCACCAAGTAGG - Intronic
918937920 1:190948315-190948337 TTATATGACTGACACCTAGTAGG - Intergenic
920546535 1:206823017-206823039 GAAAATCACTGGAACCTAGGAGG - Intronic
922780872 1:228251243-228251265 GCAAAGTATTGACACCTAGTTGG + Intronic
924840587 1:247706467-247706489 GCAAAGTACTGTCACCTAGTTGG + Intergenic
1064555839 10:16546327-16546349 GGAAATCACAGAAATGTAGTAGG - Intergenic
1068029887 10:51693196-51693218 GGAAATCACTTAAACCCAGGAGG + Intronic
1068130800 10:52892930-52892952 GGGAATCATTGAAAACTAGTTGG + Intergenic
1068587375 10:58814374-58814396 TGAACTGTCTGACACCTAGTAGG + Intronic
1069192132 10:65505016-65505038 GAAAATTATTGTCACCTAGTTGG + Intergenic
1069790643 10:71018220-71018242 GCAAAGTACTGTCACCTAGTTGG + Intergenic
1072101122 10:92230169-92230191 GGAAGTGCCTGACACTTAGTAGG - Intronic
1072468011 10:95685282-95685304 GGAAATAACTGAAACGTGGTAGG + Intronic
1072609894 10:97011116-97011138 GGCATGCACTCACACCTAGTGGG + Exonic
1073995695 10:109313426-109313448 GCAAAGTACTGTCACCTAGTTGG + Intergenic
1076196305 10:128520725-128520747 GGTCATCACTGGCACCTAGCAGG + Intergenic
1077063939 11:630445-630467 GGGAATCACTTAAACCTGGTAGG - Intergenic
1080269716 11:30438149-30438171 GGTCATCTCTGACACATAGTAGG - Intronic
1080859058 11:36137253-36137275 GGACATCTCTGACACCTGCTGGG + Intronic
1081222232 11:40476017-40476039 GGGTATTACTGGCACCTAGTGGG - Intronic
1081378473 11:42387262-42387284 GCAAAGTACTGTCACCTAGTTGG - Intergenic
1081609252 11:44549223-44549245 GCAAAGTACTGTCACCTAGTTGG - Intergenic
1081784262 11:45735506-45735528 CGAAATCACTGCCACCTATCTGG + Intergenic
1085700537 11:78741852-78741874 GCAAATCACTGTCACCGACTTGG + Intronic
1085928956 11:81057724-81057746 GGCAAACACTGACATCAAGTAGG - Intergenic
1086376628 11:86207224-86207246 GGAAATCATTGAAACTTAGGAGG + Intergenic
1086555352 11:88103981-88104003 GGAAATCACTGAAACTCACTGGG - Intergenic
1087516212 11:99165699-99165721 GGAAAGCACTGAAACAAAGTGGG - Intronic
1091138440 11:133214908-133214930 GGCAATCTCTGACCCCTCGTTGG + Intronic
1093964720 12:25312263-25312285 GCAAAGTACTGTCACCTAGTTGG - Intergenic
1097760587 12:63459690-63459712 GGAAATCACCAACTCCTAGCAGG + Intergenic
1098863833 12:75739847-75739869 GCAAATGACTGGCACATAGTAGG - Intergenic
1099353479 12:81604143-81604165 GGAAATCACTGATTTCCAGTGGG + Intronic
1099366105 12:81766720-81766742 GAAAAGTATTGACACCTAGTTGG - Intergenic
1102512858 12:113427621-113427643 GGAAATGCCTGGCACATAGTAGG + Intronic
1103757947 12:123224645-123224667 GGACATCACTGGCATTTAGTGGG + Intronic
1107010595 13:35666429-35666451 GAAAATAAGTGACACATAGTAGG + Intronic
1107276315 13:38684014-38684036 GGAAATACCTAATACCTAGTAGG - Intergenic
1110859146 13:80328530-80328552 GGAAACGACTGGCATCTAGTGGG - Intergenic
1112230939 13:97588831-97588853 GCAAAGTACTGTCACCTAGTTGG + Intergenic
1112304888 13:98265055-98265077 GAACACCACTGGCACCTAGTTGG - Intronic
1119079253 14:71676444-71676466 GAAAATGCCTGGCACCTAGTAGG - Intronic
1123507029 15:20953028-20953050 GGAAAGCACTGACACCTCTTTGG + Intergenic
1123564257 15:21526775-21526797 GGAAAGCACTGACACCTCTTTGG + Intergenic
1123600510 15:21964057-21964079 GGAAAGCACTGACACCTCTTTGG + Intergenic
1126280113 15:46937884-46937906 GGAAATCACTGATACATGCTTGG - Intergenic
1128163995 15:65445176-65445198 GGACTTCATTGACACCAAGTGGG - Exonic
1130696339 15:86135415-86135437 CTAAAACACTGACACATAGTTGG + Intergenic
1130770788 15:86921542-86921564 GGAAATTCCAGACACCTAGCTGG - Intronic
1131296349 15:91152987-91153009 GGGAATCTCTGCCTCCTAGTTGG + Intronic
1202972617 15_KI270727v1_random:253880-253902 GGAAAGCACTGACACCTCTTTGG + Intergenic
1136083072 16:27865423-27865445 GGGATTCACTGCCACCTGGTGGG + Intronic
1139020942 16:62748571-62748593 GAAATTTACTGATACCTAGTTGG + Intergenic
1140273926 16:73491781-73491803 GGGTGTCACTGACATCTAGTAGG + Intergenic
1140814591 16:78609576-78609598 GGGAATCACTGTCTCCTAGGAGG - Intronic
1142166972 16:88596548-88596570 GAGAATCACTGACACCCAGGAGG + Intronic
1145088646 17:19967402-19967424 GGAAAGCACTGACACTTATAAGG - Intronic
1147435415 17:40409996-40410018 GAGAATCACTGAAACCTAGGAGG + Intronic
1150646666 17:66982880-66982902 GGCAATCCCTGGCACCTAATAGG - Intronic
1151863961 17:76787431-76787453 TGAAATCACTCACATCTGGTCGG - Intergenic
1151943720 17:77307925-77307947 GGAGATCAGGGACACCCAGTGGG - Intronic
1153685054 18:7537225-7537247 GTAAAGTACTGTCACCTAGTTGG + Intergenic
1154286460 18:13061810-13061832 GGGTATTACTGACACCCAGTGGG - Intronic
1156606550 18:38673084-38673106 GCAAAGTACTGTCACCTAGTTGG - Intergenic
1156776096 18:40790920-40790942 GGGAATCACTTAAACCTAGGAGG - Intergenic
1162339699 19:10085267-10085289 GGGAACCACTGGCATCTAGTGGG + Intergenic
1168480289 19:56714607-56714629 TGAAATCACGGGCACCTAGTGGG + Intergenic
926617363 2:15010462-15010484 GGATATCCCTGACACCTAAGGGG - Intergenic
928175810 2:29033668-29033690 GGGTATCGCTGAGACCTAGTTGG + Intronic
930295024 2:49544042-49544064 GCAAACTACTGTCACCTAGTTGG + Intergenic
930319379 2:49835157-49835179 GGAAATCACAGACTTCCAGTTGG - Intergenic
932287355 2:70547451-70547473 GGAAATCACTTAAACCTGGGAGG + Intronic
933209126 2:79545683-79545705 GGAAATCACTGACACCTAGTGGG - Intronic
936833940 2:116683997-116684019 GGAAATCACTGACAACAAACAGG + Intergenic
937236842 2:120436359-120436381 GGACATCCCTGGCAGCTAGTAGG + Intergenic
937601743 2:123745052-123745074 GGAAATCACTTAAACCTGGGAGG - Intergenic
937899266 2:127005146-127005168 GGAAATTCCAGACACCTAGCTGG + Intergenic
939658328 2:144855114-144855136 GGACATTACTGGCATCTAGTGGG + Intergenic
939753318 2:146076124-146076146 GGAACTCACTCACACCTACATGG + Intergenic
941421819 2:165291919-165291941 GCATCTCACTGACACCTGGTGGG - Intronic
941668205 2:168262434-168262456 GCAAAGTACTGTCACCTAGTTGG - Intergenic
943517403 2:188905920-188905942 GCAAAGTACTGTCACCTAGTTGG + Intergenic
944651850 2:201838267-201838289 GGGTATCACTGGCATCTAGTGGG + Intronic
944664563 2:201949271-201949293 GGCAATGCCTGACACTTAGTGGG - Intergenic
945088090 2:206154395-206154417 GGAAGTTACTGACATCTAGTGGG + Intronic
945205316 2:207325223-207325245 GAAAATCACTCAAACCTAGGAGG + Intergenic
946821401 2:223633631-223633653 TGAAGTGACTGACACATAGTAGG - Intergenic
947940189 2:234047380-234047402 GGAACTCAAGGACACCTAGTGGG + Intergenic
948266957 2:236642106-236642128 GGAAATGACCCACTCCTAGTGGG - Intergenic
948491996 2:238319887-238319909 AAGAATCACGGACACCTAGTAGG + Intergenic
948782476 2:240330231-240330253 GAAAATCACTCACACCTGGCAGG - Intergenic
1171386522 20:24773040-24773062 GGAAATCACTGAAAGCAACTTGG - Intergenic
1175085175 20:56452282-56452304 GGAATTCTCTGACACCTCCTTGG - Exonic
1177864234 21:26493703-26493725 GGAAGTTTCTGACACCTTGTAGG + Intronic
1181871683 22:25904073-25904095 GGAAATGAATGCAACCTAGTGGG - Intronic
1182963762 22:34502545-34502567 GGAAGTGGCTGACACATAGTAGG + Intergenic
1184365143 22:44046415-44046437 GGATATCACTGACCACCAGTGGG + Intronic
1184603373 22:45557029-45557051 GCAAAGTACTGTCACCTAGTTGG + Intronic
1184639746 22:45864141-45864163 GGATGTCACTGACATTTAGTGGG + Intergenic
950872347 3:16240653-16240675 GGAAATTACTGAAACATAGGTGG - Intergenic
951011485 3:17686810-17686832 GAGAATTACTGACATCTAGTGGG + Intronic
954063057 3:48085038-48085060 TGAAATCACTGATACTTACTTGG + Intronic
956256030 3:67284039-67284061 GGAAGTCACTGATATCTAGCTGG + Intergenic
961545962 3:127633418-127633440 TGAAATAACTGAGGCCTAGTGGG - Intronic
961973315 3:130993579-130993601 GGATGTTACTGGCACCTAGTGGG - Intronic
964068675 3:152605884-152605906 GGAAATCACAGACACCTGGGAGG + Intergenic
964241371 3:154599063-154599085 GAAAATCACTTAAACCCAGTAGG - Intergenic
964938784 3:162128601-162128623 GGAAGTGACAGACACCTTGTAGG + Intergenic
965723724 3:171690303-171690325 GAAAATCAATGAAACCAAGTTGG - Intronic
966510675 3:180759136-180759158 GGATATTACTGGCATCTAGTGGG - Intronic
971187301 4:24392217-24392239 GTAAATGACTGACAACTAGGTGG + Intergenic
972994439 4:44863187-44863209 GGAAGTCACTGGCATTTAGTGGG - Intergenic
974644439 4:64673454-64673476 GCAAAGTACTGTCACCTAGTTGG + Intergenic
974746755 4:66087685-66087707 GCAAAGTACTGTCACCTAGTTGG + Intergenic
975037965 4:69708692-69708714 AGAAATTACTCACACATAGTAGG - Intergenic
975583888 4:75931097-75931119 GGAAGTCCCTGCCACATAGTGGG + Intronic
976034029 4:80794491-80794513 GCAAAGCACTGTCACGTAGTTGG + Intronic
976753912 4:88478120-88478142 GGACCTCACTGTCACCTAGCTGG + Intronic
977031825 4:91893140-91893162 GGAAAGTATTGTCACCTAGTTGG - Intergenic
977808094 4:101326411-101326433 AAAAATAACTGACACCAAGTAGG + Intronic
978771966 4:112466451-112466473 GTAAAGTACTGTCACCTAGTTGG + Intergenic
985131398 4:186741821-186741843 GCAAAGCACTGAAAGCTAGTAGG - Intergenic
986340026 5:6780973-6780995 GCACACTACTGACACCTAGTGGG - Intergenic
988615985 5:32775382-32775404 GTAAATCATTTAAACCTAGTAGG - Intronic
989530434 5:42501626-42501648 GGAAGTCACTAGCATCTAGTGGG - Intronic
990813240 5:59752656-59752678 GGAAATTAATGTCATCTAGTGGG + Intronic
992577724 5:78135457-78135479 GGTAACCACTGCCACCTTGTTGG - Intronic
993372782 5:87113401-87113423 GGAAAACACTGACACCTGGAAGG - Intergenic
993875955 5:93307049-93307071 GAAAATGACTGAGACATAGTAGG - Intergenic
995123042 5:108555450-108555472 AGTAATAACTGGCACCTAGTAGG - Intergenic
995290002 5:110441228-110441250 GGATGTTACTGACATCTAGTGGG - Intronic
995770436 5:115663869-115663891 GGAAATCACTGGCACTGAGGAGG - Intergenic
996623518 5:125540378-125540400 GAAAATCTCTGACACTTATTAGG + Intergenic
998767437 5:145503480-145503502 GAAAATGACTGATATCTAGTAGG - Intronic
999549248 5:152666724-152666746 GGAAATCACTTGAACCTGGTAGG - Intergenic
999907385 5:156156767-156156789 GGAAATCACCGACTTCTACTTGG + Intronic
1000614776 5:163414644-163414666 GGCCATCACTGACATGTAGTGGG - Intergenic
1001498036 5:172203998-172204020 TGAAATCTCTGGCACCTAGGTGG - Intergenic
1004955530 6:20724020-20724042 GAAAATCACTTAAACCCAGTAGG - Intronic
1006399535 6:33808791-33808813 GGAAAACACTGACACAGAGAGGG + Intergenic
1007021133 6:38522729-38522751 GGAAATCCCTGACTGGTAGTTGG - Intronic
1008105285 6:47434419-47434441 GAAAATCACTGACATCTAGATGG - Intergenic
1008548252 6:52602828-52602850 GTAAGTCACTGACACCTACAAGG - Intergenic
1009660526 6:66605647-66605669 GCAAAGTACTGTCACCTAGTTGG + Intergenic
1011079503 6:83473854-83473876 GGAGATTACTAACACTTAGTGGG + Intergenic
1013745139 6:113336373-113336395 TAAAATCACTGGCACATAGTAGG + Intergenic
1016189893 6:141252244-141252266 GGGAATCACTGAAACCCAGGAGG - Intergenic
1018372758 6:163183369-163183391 GGAAATCATTGACAACTTGTAGG + Intronic
1022231394 7:28416619-28416641 GAAAAACACTGACTCCTAGGAGG + Intronic
1023814160 7:43936844-43936866 GGAAATCACTTTCACCTCTTTGG - Intronic
1024265307 7:47601734-47601756 GGAAATGACTGACACTGAGAGGG + Intergenic
1027832711 7:83200451-83200473 GGAAATCACTAGCATCCAGTTGG - Intergenic
1030277730 7:107737972-107737994 GCAAAGTACTGTCACCTAGTTGG - Intergenic
1030355592 7:108538863-108538885 GCAAAGGACTGTCACCTAGTTGG - Intronic
1030560473 7:111078818-111078840 GAGAATCACTGAAACCTGGTAGG - Intronic
1037675545 8:21047854-21047876 GCAAAGTACTGTCACCTAGTTGG + Intergenic
1040111311 8:43568283-43568305 GGAAGGCACTGACCCCTGGTGGG + Intergenic
1040355750 8:46617063-46617085 GGAAAGCACAGACACCGAGGTGG + Intergenic
1040384084 8:46901638-46901660 AGAAATCACTGGCTCCTAGGGGG - Intergenic
1041762041 8:61377730-61377752 GCAAATATCTGGCACCTAGTGGG + Intronic
1042677295 8:71335971-71335993 ATAAATAACTGACACATAGTAGG - Intronic
1043300775 8:78728741-78728763 GGAGATCACTGGCATCTAATGGG + Intronic
1043757558 8:84022078-84022100 GGAAATCAATGACAACTAAATGG + Intergenic
1046362412 8:113179555-113179577 AGAAATCAATGACACCTATAGGG - Intronic
1047327285 8:123851967-123851989 GTAAAGTACTGTCACCTAGTTGG + Exonic
1048073655 8:131044703-131044725 AGAAAGAGCTGACACCTAGTAGG - Intergenic
1050235011 9:3568559-3568581 GAAAATCACTGAAACCCAGGAGG + Intergenic
1050517915 9:6464172-6464194 GCAATTCTCTGACTCCTAGTGGG + Intronic
1050565928 9:6883680-6883702 GGAAATGAATGTCAACTAGTAGG + Intronic
1053094636 9:35314174-35314196 GGAAATCAAATAGACCTAGTGGG + Intronic
1055361481 9:75495793-75495815 GGAAATCACTTAAACCTAGGAGG - Intergenic
1055418350 9:76108661-76108683 GGAAATCGCTTGCACCCAGTAGG + Intronic
1055669916 9:78594434-78594456 GAAAATGCCTGGCACCTAGTAGG + Intergenic
1057461954 9:95271126-95271148 GGATGTCACTGGCACCCAGTGGG + Intronic
1059551485 9:115233603-115233625 GTAAAACACTAACACTTAGTAGG - Intronic
1060270127 9:122134232-122134254 GGAAATGCTTGACACTTAGTAGG - Intergenic
1188065186 X:25650218-25650240 GGACATTACTGGCATCTAGTGGG + Intergenic
1188664271 X:32799983-32800005 GGAAGTCATTGAAACCTTGTAGG - Intronic
1189695526 X:43657662-43657684 AGAAATTATTAACACCTAGTAGG - Intronic
1190142931 X:47863914-47863936 GAAAATCACTGCCACCCAGAGGG + Intronic
1192082663 X:68063429-68063451 GGAAATCACTTGAACCTAGGAGG + Intronic
1193841377 X:86412433-86412455 GCAAAGCATTGTCACCTAGTTGG + Intronic
1193914641 X:87350618-87350640 GCAAAGTACTGTCACCTAGTTGG + Intergenic
1194926599 X:99832967-99832989 AGAAATCACTAACAATTAGTAGG + Intergenic
1196703832 X:118699297-118699319 GGTTGCCACTGACACCTAGTGGG + Intergenic
1197002469 X:121454250-121454272 GCAAAATACTGACACCTAGTTGG - Intergenic
1197109142 X:122751964-122751986 GGAAAACACTCACACCGAGAAGG - Intergenic
1198127186 X:133657069-133657091 GAAAAGCTCTGACACCAAGTGGG + Intronic
1198317807 X:135487111-135487133 AGAAAGCTCTAACACCTAGTAGG + Intergenic
1199179698 X:144839029-144839051 GCACATCCCTGACTCCTAGTTGG - Intergenic