ID: 933209264

View in Genome Browser
Species Human (GRCh38)
Location 2:79548013-79548035
Sequence TACATCCCTTGGTATACCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933209264_933209266 11 Left 933209264 2:79548013-79548035 CCTTAGGTATACCAAGGGATGTA 0: 1
1: 0
2: 0
3: 7
4: 94
Right 933209266 2:79548047-79548069 AAACTTATTGCTATCATTGTAGG 0: 1
1: 0
2: 0
3: 15
4: 178
933209264_933209267 12 Left 933209264 2:79548013-79548035 CCTTAGGTATACCAAGGGATGTA 0: 1
1: 0
2: 0
3: 7
4: 94
Right 933209267 2:79548048-79548070 AACTTATTGCTATCATTGTAGGG 0: 1
1: 0
2: 0
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933209264 Original CRISPR TACATCCCTTGGTATACCTA AGG (reversed) Intronic
909174295 1:72336240-72336262 TATATCCCTTGATATGCATATGG + Intergenic
913162782 1:116160453-116160475 TAGATCCCTTGATATAGATATGG + Intergenic
916590334 1:166184032-166184054 GAGATCCTTTGGTATAGCTAAGG - Intergenic
916894323 1:169146298-169146320 TCCATCTCATGGTATAGCTATGG - Intronic
920638036 1:207724106-207724128 TACATCCCTTTTTATACATCTGG + Intronic
920967840 1:210715954-210715976 TACTTTCCTTTGTATCCCTAAGG - Intronic
1062991188 10:1820727-1820749 TTCATCCCTTGGTATCCACAAGG - Intergenic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1065336999 10:24663112-24663134 GTCATCCCTTGATATACCCAGGG - Intronic
1066161787 10:32740593-32740615 GTCATTCCTTGGTATACATAGGG - Intronic
1066161815 10:32741408-32741430 GTCATTCCTTGGTATACATAGGG + Intronic
1071591271 10:86875628-86875650 TACTTCCCTTGTTGTACATATGG + Intronic
1075577746 10:123591358-123591380 GTCATCCCTTGGTATACAGAGGG - Intergenic
1079063363 11:17269093-17269115 TACATCTCTTGGTACTTCTAGGG - Intronic
1084730637 11:71071282-71071304 CACACCCCGTGGCATACCTAGGG + Intronic
1085298558 11:75444919-75444941 TATAACCCTTGGTATAACCAAGG - Intronic
1087577586 11:100009403-100009425 TACATACCTTTGTTTCCCTATGG - Intronic
1091116673 11:133019724-133019746 AGCATCCCTGGGTATCCCTATGG + Intronic
1092963904 12:13623284-13623306 TACATATCTTGGTATTTCTAAGG + Intronic
1094024073 12:25943588-25943610 TACATCACTGGGTAAACCAAAGG + Intergenic
1094147012 12:27239661-27239683 TACATTCCTTGGTGGACATAAGG + Intergenic
1098345122 12:69494609-69494631 AACATCCCTGGCTCTACCTAAGG + Intronic
1104564588 12:129869312-129869334 TCAATCCCTTGGCATACCTGGGG + Intronic
1105061522 12:133155996-133156018 TTCATCTCTTGGTATATCAAAGG + Exonic
1108340925 13:49497187-49497209 TTCATTCATTGGTATACATATGG + Intronic
1120783116 14:88504003-88504025 TACTTCCCTCTCTATACCTATGG - Intronic
1122461442 14:101898922-101898944 TACATCTCTTGGTAGCACTAAGG + Intronic
1126504670 15:49390948-49390970 TTCATCCCATGGTCTTCCTAAGG - Intronic
1134663869 16:16004064-16004086 TATATCCATGGGTATACATATGG + Intronic
1135102843 16:19622090-19622112 GTCATCCCTTGGTATACTTAGGG + Intronic
1139849818 16:69944277-69944299 CAGATCCCTTGGTATAGATACGG + Intergenic
1139878814 16:70167274-70167296 CAGATCCCTTGGTATAGATACGG + Intergenic
1140373704 16:74428218-74428240 CAGATCCCTTGGTATAGATACGG - Intergenic
1143813516 17:9491977-9491999 TATATGCCTGGGTATACTTATGG - Intronic
1151262253 17:72925442-72925464 GTCATCCCTTGGTATCCGTAGGG + Intronic
1154034791 18:10790425-10790447 TACATTTATTGGCATACCTAGGG + Intronic
1159114163 18:64094028-64094050 CAAATCCCTTGCTATACCTGGGG + Intergenic
1162696784 19:12482842-12482864 TACATCCCTTGGGAGACCCAAGG + Intronic
1166410668 19:42553955-42553977 TACTTCCCTGGGTCTACTTATGG + Intronic
927122828 2:19985003-19985025 TGCATCCCTGGGTCTAGCTAAGG + Intronic
931841586 2:66155761-66155783 GTCATCCCTTGGTATTCATAGGG + Intergenic
933209262 2:79548008-79548030 TACACCCTTAGGTATACCAAGGG + Intronic
933209264 2:79548013-79548035 TACATCCCTTGGTATACCTAAGG - Intronic
935897791 2:107756306-107756328 GTCATCCCTCGGTATCCCTAGGG - Intergenic
938306470 2:130259866-130259888 TAGATCCTTTGGGAAACCTAAGG - Intergenic
944824471 2:203467727-203467749 GTCATTCCTTGGTATACATAGGG - Intronic
1172184756 20:33024420-33024442 TACATCCCTTGGTGTTCCCTAGG - Intergenic
1182519756 22:30878701-30878723 TACCTTCCTTGGTAAACCCAGGG - Intronic
1184009000 22:41732630-41732652 TCCATCCCTGCATATACCTAAGG + Intronic
949960561 3:9308762-9308784 TTCATCCCTTGGTAGAGCCAAGG - Intronic
954008573 3:47614163-47614185 TCCATCCCTTTTTATACCTGAGG + Intronic
954256183 3:49408658-49408680 TACATGCCTTGCTATACATGGGG - Intronic
954438368 3:50508040-50508062 TGCATCCCTGGGTATCCCCAAGG - Intergenic
956828179 3:73018370-73018392 GTCATCCCTTGGTATACTTTAGG - Intronic
956983679 3:74670927-74670949 GTCATCCCTTGGTATCCTTAGGG - Intergenic
958882706 3:99691122-99691144 GTCATCCCTTGGTATACCCAGGG - Intronic
966428361 3:179805338-179805360 AACATCCCTTGGTATCCGTGGGG + Intronic
970464596 4:16310053-16310075 TACATCCATTGCTATATCTCTGG - Intergenic
970566551 4:17337437-17337459 TGAATCCCTTGGTAAATCTAAGG + Intergenic
971403935 4:26302711-26302733 TACTTCCCTTTTTATAGCTAAGG - Intronic
975076910 4:70220975-70220997 TACTTCCCTTTTTATAGCTAGGG + Intergenic
978588860 4:110302615-110302637 AACATACCTAGGTATACATAAGG + Intergenic
979737386 4:124104462-124104484 TCCATGCCTTGGCATACCTCTGG - Intergenic
980305307 4:131053328-131053350 GTCATCCCTTGGTATTTCTAAGG + Intergenic
981505680 4:145496727-145496749 GTCATCCCTTGGTATACCTGGGG - Intronic
984310089 4:178046862-178046884 AACATCCCTTATTATTCCTATGG - Intergenic
988006754 5:25422536-25422558 TACATATCTATGTATACCTATGG - Intergenic
993600868 5:89923049-89923071 TAGATTCCTTAGTATCCCTAAGG - Intergenic
995189933 5:109309518-109309540 TGCTTCCCTTGGTAAACCAAGGG - Intergenic
996942363 5:129023768-129023790 GACATCCCTTGGTATCCTTGGGG + Intronic
1000111299 5:158110794-158110816 GCCATCCCTTGGTATACACAGGG - Intergenic
1000381617 5:160634754-160634776 TGCATCCCTTGGAATTCTTAGGG + Intronic
1003363339 6:5449897-5449919 GTCATCCCTTGGTATACATGTGG + Intronic
1003369939 6:5514687-5514709 GACATCCCTTGACATCCCTATGG + Intronic
1006817359 6:36861396-36861418 GTCATCCCTTGGTATACTCAGGG + Intronic
1008603234 6:53116198-53116220 TACATTCCGTGGTATCCCCAAGG - Intergenic
1009238081 6:61149372-61149394 TACACCCCTTTCAATACCTACGG + Intergenic
1010008059 6:71017464-71017486 TGCACCCCTTGGTACACCCAGGG + Intergenic
1017531398 6:155295968-155295990 GCCATCCCTTGGTATCCATAGGG - Intronic
1018773526 6:166993235-166993257 GACATCCCTTGGTATCCATGGGG - Intergenic
1025227393 7:57177512-57177534 AACAACCCTTGGGATACCTAGGG + Intergenic
1026587278 7:71666182-71666204 TTCATCCCTTGGTATCCACAGGG + Intronic
1028677506 7:93483021-93483043 GTCATCCCTTGGTATACTCAGGG + Intronic
1032319976 7:130876992-130877014 TTCATCCCTTGGTATCCTTGAGG + Intergenic
1036408584 8:8477808-8477830 TACTTCCCTGGCTATTCCTAGGG + Intergenic
1037309100 8:17536151-17536173 TAGAGCCCTTGGTATTCCTGGGG + Intronic
1038539982 8:28384310-28384332 TACATTCCCTGGTATGGCTAAGG + Intronic
1043966571 8:86484359-86484381 TACATTGCTTGGTATAGCTGGGG - Intronic
1049131118 8:140843379-140843401 TTCATTCCTTTGTATACCTCTGG + Intronic
1052037691 9:23701588-23701610 TACACCCCTTGATATGCCTATGG + Exonic
1052222127 9:26037484-26037506 TAGATCCCTGGGTATAATTATGG - Intergenic
1056200178 9:84267968-84267990 GTCATCCCTTGGTATTCCTGGGG + Intergenic
1189660476 X:43291672-43291694 GTCATCCCTTGGTATACACAGGG + Intergenic
1191052097 X:56205180-56205202 TATATCCCTTGTTATACTTAGGG - Intergenic
1192606467 X:72524351-72524373 CACATCCCTGGGCATCCCTAGGG - Intronic
1193596742 X:83455515-83455537 CTCATCCCTTGGTATACGCAGGG + Intergenic
1197043860 X:121971916-121971938 TCCATCCCTTGGTATCCATGGGG - Intergenic
1197570464 X:128144708-128144730 TATATGCCTTTGCATACCTATGG - Intergenic
1201793399 Y:17867250-17867272 AACATCCAGTGGTTTACCTAAGG + Intergenic
1201808155 Y:18038736-18038758 AACATCCAGTGGTTTACCTAAGG - Intergenic
1202354782 Y:24035079-24035101 AACATCCAGTGGTTTACCTAAGG + Intergenic
1202515996 Y:25635030-25635052 AACATCCAGTGGTTTACCTAAGG - Intergenic