ID: 933215825

View in Genome Browser
Species Human (GRCh38)
Location 2:79629070-79629092
Sequence ACGGAAGTGGAGAGTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 753
Summary {0: 1, 1: 0, 2: 8, 3: 59, 4: 685}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933215825_933215841 27 Left 933215825 2:79629070-79629092 CCTTCCCCACTCTCCACTTCCGT 0: 1
1: 0
2: 8
3: 59
4: 685
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
933215825_933215836 16 Left 933215825 2:79629070-79629092 CCTTCCCCACTCTCCACTTCCGT 0: 1
1: 0
2: 8
3: 59
4: 685
Right 933215836 2:79629109-79629131 TTCCCCTATGCCAGCCATATTGG 0: 1
1: 0
2: 2
3: 7
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933215825 Original CRISPR ACGGAAGTGGAGAGTGGGGA AGG (reversed) Intronic
900438101 1:2641003-2641025 AGGGAAGCGGGGTGTGGGGAGGG + Intronic
900438113 1:2641027-2641049 AGGGAAGGGGGGTGTGGGGAGGG + Intronic
900544531 1:3221048-3221070 AGTGAGGTGGAGAGGGGGGACGG + Intronic
901156170 1:7140937-7140959 AAGGTAGCAGAGAGTGGGGATGG - Intronic
902367464 1:15986318-15986340 AGGGAAGGGAAGAGAGGGGAGGG - Intergenic
902546619 1:17194322-17194344 AGGGATGTGGAAAGTGGAGAGGG + Intergenic
902691538 1:18112937-18112959 AAGGAGGTGGAGAGGGAGGATGG - Intronic
903640874 1:24859331-24859353 ACAGAAGTGCAGGGTCGGGAGGG + Intergenic
903668696 1:25022892-25022914 AGGGAAGGGGAGAGGGGGTAGGG - Intergenic
903961541 1:27060891-27060913 ACAGAGGTAGAGAGTGGGGCCGG - Intergenic
904277473 1:29393891-29393913 AAGGAAGTGGGGAGGGGGGAGGG - Intergenic
904572819 1:31479951-31479973 ACAGAAGTGGAATGTGGGGGAGG - Intergenic
904902679 1:33869775-33869797 AGAGAAAGGGAGAGTGGGGAGGG - Intronic
905070451 1:35220649-35220671 AGGGTAATGGAGAGTGGGGTTGG - Intergenic
905290889 1:36921029-36921051 CTGGAGGTGGAGAGTGGGCATGG + Intronic
905454996 1:38082528-38082550 AGGGAAATGCAGTGTGGGGACGG + Intergenic
906082489 1:43102355-43102377 ACAGAAGTGGGGAGGGGGGCAGG + Intergenic
906105193 1:43287352-43287374 GGTGCAGTGGAGAGTGGGGAAGG - Intergenic
906225652 1:44119128-44119150 AAGGAATGGGAGATTGGGGAGGG + Intronic
906735817 1:48126041-48126063 ACTGAAGTGGAGAGGGAGGGAGG + Intergenic
906842352 1:49153012-49153034 ATGGAAGGGGAGAGGTGGGAAGG + Intronic
906929825 1:50158634-50158656 ACAGAATTGCATAGTGGGGAGGG - Intronic
907050539 1:51327055-51327077 AGGGAAGGGGAGAGTGGGGGCGG - Intronic
908421369 1:63961685-63961707 AGGGTAGGGGAGAGTGGAGAGGG + Intronic
909583366 1:77262876-77262898 AGGGAAGGGGAGGGAGGGGAAGG - Intergenic
910321813 1:85954989-85955011 ACGGAAGTGCAGGGTAGGGAAGG + Intronic
911186625 1:94910923-94910945 AAGGGAGTGGACAGTGGTGAAGG - Intronic
911317303 1:96370720-96370742 AAGGAAGTGGGGGGTGGGGGGGG - Intergenic
911729391 1:101277478-101277500 AAAGCAGTGGAGAGTGGAGATGG - Intergenic
912374637 1:109200247-109200269 GCGGTATTGGAGTGTGGGGATGG + Intronic
912572542 1:110635075-110635097 AGGGAAGTTGAGAGTGGGACTGG + Intergenic
913586105 1:120277420-120277442 AAGGAAATAGAGGGTGGGGAGGG - Intergenic
913622081 1:120620949-120620971 AAGGAAATAGAGGGTGGGGAGGG + Intergenic
914568114 1:148889278-148889300 AAGGAAATAGAGGGTGGGGAGGG - Intronic
914604710 1:149240971-149240993 AAGGAAATAGAGGGTGGGGAGGG + Intergenic
914900234 1:151707657-151707679 AGGGGAGAGGAGAGTGGGGCAGG + Intronic
915013584 1:152712766-152712788 GTGGAAGTGGTGAGTGGGAATGG + Intergenic
915515924 1:156412742-156412764 ACGGAAGCGGAGGGTGAGGGAGG - Intronic
915646090 1:157273715-157273737 AAGGAGTTGCAGAGTGGGGATGG + Intergenic
915794310 1:158711437-158711459 AGGGAAGTGGAGAGGTTGGAGGG - Intergenic
915935497 1:160088010-160088032 AGGGAAATGGAGGGTGGGGCCGG + Exonic
916014365 1:160735931-160735953 TGGGGAGTGGGGAGTGGGGAGGG - Intergenic
916052880 1:161048493-161048515 AAGGAACGGGAGAGTGGGGATGG - Exonic
916547644 1:165821530-165821552 ACGCAAGTGCAGGGTGGGAAAGG - Intronic
916757243 1:167784365-167784387 AATGAAATGGAGGGTGGGGAGGG + Intronic
917194348 1:172449983-172450005 GCTGGAGTGGAGAATGGGGAAGG + Intronic
917356526 1:174131659-174131681 AGGGAGGTGGTGAGTGGGCATGG - Intergenic
917931722 1:179827072-179827094 ACGGCAGTGGATGGTGGTGACGG - Intergenic
918211852 1:182358232-182358254 AGGGAAGAGTAGAGTTGGGATGG + Intergenic
918355230 1:183701578-183701600 AAGGCAGTGGAGGGTGGGGTGGG - Intronic
918812889 1:189142796-189142818 ACCGAAGGGAAGAGTGGGAAGGG - Intergenic
918920398 1:190702347-190702369 ACTCAAGTGTATAGTGGGGATGG - Intergenic
919458273 1:197846132-197846154 AGGGAAGGGAAGGGTGGGGAAGG - Intergenic
919755711 1:201064944-201064966 ACGGAGGCGGAGTGTGGGGCTGG + Intronic
920051678 1:203168148-203168170 AGAGAGGTGCAGAGTGGGGAGGG + Intronic
920244211 1:204575876-204575898 GTGGAAGTGGAGAGTGGCAAAGG - Intergenic
920560356 1:206934283-206934305 CTGAAAGTGGAGAGTGGGAAGGG - Intronic
920720581 1:208382987-208383009 ATGTAAGTGGAGAGAGTGGAAGG + Intergenic
921094941 1:211878375-211878397 ATGGAAGTAGAGACTGGGCATGG + Intergenic
921771936 1:219050611-219050633 AGGGAAGGGGAGAAAGGGGAGGG + Intergenic
922107815 1:222527546-222527568 GGAGAAATGGAGAGTGGGGAGGG - Intronic
922358642 1:224800320-224800342 ACTGATGTGGGGAGGGGGGAGGG + Intergenic
922421476 1:225463499-225463521 AAGGAAGAGGAGGGAGGGGAGGG + Intergenic
922496533 1:226062324-226062346 AGGGAAGTGGGGGGAGGGGAAGG - Intronic
922621476 1:226991944-226991966 AGGGAAGAGGAGGATGGGGAGGG + Exonic
922791157 1:228311833-228311855 AGGGAGGAGGAGAGTGTGGAAGG + Intronic
923008216 1:230068127-230068149 CCTGAAGCGGGGAGTGGGGATGG - Intronic
923238983 1:232062221-232062243 CTGGAAGTGGAGAGTGGGGAGGG + Intergenic
924401023 1:243682250-243682272 TGGGAAGTGGAGGGTGGGGTAGG - Intronic
924649417 1:245911227-245911249 AAGGATGTGGAGAAAGGGGAAGG + Intronic
1062958005 10:1552713-1552735 AGGGAAGGGGAGAGGAGGGAGGG + Intronic
1063631056 10:7734269-7734291 ATGGATGTTGATAGTGGGGAAGG + Intronic
1063692113 10:8296827-8296849 AGGGAAGTGGAGAGGAGGGGAGG - Intergenic
1064557935 10:16566416-16566438 AGGGAAGTGGAGCATGGGGAAGG + Intergenic
1064990408 10:21251935-21251957 AGGGAAGTGGAGAGCTGAGAAGG - Intergenic
1065728772 10:28691716-28691738 GAGGGAGTGGAGAGGGGGGATGG - Intergenic
1068258251 10:54542758-54542780 AGGGAAGTGCTGAGTGGAGAAGG + Intronic
1068311886 10:55289456-55289478 ATGGAAGGAGAGAGTGAGGAAGG + Intronic
1068335644 10:55630187-55630209 AAAGAAGTCGGGAGTGGGGATGG + Intergenic
1068833949 10:61531364-61531386 AGGGAGTAGGAGAGTGGGGATGG + Intergenic
1068989303 10:63133985-63134007 GGGGAAGTGGAGGGTGAGGAGGG - Intronic
1068989311 10:63134006-63134028 GGGGAAGTGGAGGGTGAGGAGGG - Intronic
1069684617 10:70309720-70309742 ACGGGAGTCCAGAGTAGGGAGGG - Intronic
1069755306 10:70771131-70771153 ATGGGAGTGGGGAGTAGGGATGG + Intergenic
1069913882 10:71775438-71775460 AAGGAAGTGAAAAGGGGGGAGGG - Intronic
1070684703 10:78472089-78472111 AGGGAAGTGGAGGGGAGGGAGGG - Intergenic
1070720037 10:78750009-78750031 AGGGAAGTATAGAGAGGGGATGG + Intergenic
1071521475 10:86334003-86334025 AGGGAAGAGGAGAGAAGGGAGGG - Intronic
1071799370 10:89042288-89042310 ATGGCAGGGAAGAGTGGGGAGGG - Intergenic
1072289639 10:93952293-93952315 AAGGACCTGGAGAGTGAGGAGGG + Intronic
1073432425 10:103494771-103494793 AGGGGAGTGGGGAGTGAGGAGGG + Intronic
1073836390 10:107448460-107448482 TCAGAAGTGGAGAGTGGGGAAGG + Intergenic
1074123279 10:110508962-110508984 AGGGAAGTGGAGGGTGGTAAGGG + Intronic
1074304348 10:112262961-112262983 AGAGAATTGCAGAGTGGGGAGGG - Intergenic
1074318600 10:112380579-112380601 ATGGAAGTGGAGAAGGGGAATGG - Intronic
1074476587 10:113780109-113780131 AGGGAAGTGGAGGTTGGGGTGGG + Intronic
1074524641 10:114253186-114253208 AGGGGAGAGGAGAGAGGGGAGGG - Intronic
1074992129 10:118718336-118718358 AGGGAAGGGGAGAGTCGGGGAGG + Intronic
1075856988 10:125638099-125638121 AAGAAACTTGAGAGTGGGGAAGG - Intronic
1076482513 10:130793901-130793923 TGGGAACTGGACAGTGGGGATGG - Intergenic
1076825909 10:132967920-132967942 ACGGAAGTGCTGGGAGGGGAAGG - Intergenic
1076852521 10:133100020-133100042 ACGGAAGTGTAGTGCTGGGAAGG - Intronic
1076870045 10:133188683-133188705 ACAGCAGTGGGGGGTGGGGACGG - Intronic
1076872206 10:133199690-133199712 ATGGAAGCGGAGGGTTGGGAGGG - Intronic
1076913034 10:133401877-133401899 AAGGGAGTGGAGGGTGGGGCGGG - Intronic
1076949489 10:133670077-133670099 AGGAAGGTGGAGAGGGGGGAGGG - Intronic
1076950473 10:133673376-133673398 AGGAAGGTGGAGAGGGGGGAGGG - Intergenic
1076953436 10:133683295-133683317 AGGAAGGTGGAGAGGGGGGAGGG - Intergenic
1076958371 10:133752875-133752897 AGGAAGGTGGAGAGGGGGGAGGG - Intergenic
1076960344 10:133759484-133759506 AGGAAGGTGGAGAGGGGGGAGGG - Intergenic
1077346956 11:2064745-2064767 ACGGAATTGGAAAAGGGGGAAGG - Intergenic
1077701109 11:4443491-4443513 AAGGAAGGGGAGGGTGGAGAGGG + Intergenic
1077701124 11:4443529-4443551 AGGGAAGGGGAGGGTGGAGAGGG + Intergenic
1077701132 11:4443548-4443570 AGGGAAGGGGAGGGTGGAGAGGG + Intergenic
1077701139 11:4443567-4443589 AGGGAAGGGGAGGGTGGAGAAGG + Intergenic
1077701146 11:4443586-4443608 AAGGAAGGGGAGGGTGGAGAAGG + Intergenic
1077701153 11:4443605-4443627 AAGGAAGGGGAGGGTGGAGAAGG + Intergenic
1077719750 11:4616079-4616101 AGGGAGGGGGAGAGAGGGGAAGG - Intergenic
1078197725 11:9150228-9150250 AAGGAAGTGGAGGGTGGGATGGG + Intronic
1078734373 11:14006635-14006657 AGGGAAGAGGAGAGAGGAGAGGG - Intronic
1078737809 11:14036787-14036809 AAGAAAGTGGAGAGAGTGGATGG + Intronic
1078908079 11:15705904-15705926 AGGGAAGGGGAGAGAAGGGAAGG + Intergenic
1079368236 11:19827964-19827986 GAGGAAGGGGAGGGTGGGGAGGG + Intronic
1079501475 11:21105802-21105824 AGGGAAGGGGAGAGGAGGGAAGG - Intronic
1079501485 11:21105826-21105848 AAGGGAGGGGAGAGAGGGGAAGG - Intronic
1080429407 11:32184707-32184729 AATGAAGTGGAGGGTGGGGTGGG - Intergenic
1080673737 11:34405534-34405556 AGAGAAGTGGAGAGATGGGAGGG - Intergenic
1080673752 11:34405599-34405621 ACAGAAGTGGAGAGATGGAAGGG - Intergenic
1080673781 11:34405737-34405759 ACAGAAGTGGAGAGATGGAAGGG - Intergenic
1080673808 11:34405845-34405867 AGAGAAGTGGAGAGATGGGAGGG - Intergenic
1080673814 11:34405877-34405899 AGAGAAGTGGAGAGATGGGAGGG - Intergenic
1080673828 11:34405942-34405964 AGAGAAGTGGAGAGATGGGAGGG - Intergenic
1080814054 11:35736842-35736864 AAGGGAGTGAAGAGTGAGGAAGG - Intronic
1081525289 11:43924081-43924103 AGGAAAGGGGAAAGTGGGGAGGG + Intergenic
1081914826 11:46724021-46724043 AAGGAAGTCAAGAGTGGGGAGGG - Intronic
1082299860 11:50492492-50492514 AGGGAAATGGGGAGTGGGGAAGG - Intergenic
1082874647 11:57975782-57975804 AAGGACGGGGAGAGTGGAGAAGG - Intergenic
1082915678 11:58433898-58433920 TAGGAAGTGGGGAGGGGGGAGGG + Intergenic
1083672591 11:64307330-64307352 AAGGAAGAGGAGGATGGGGAGGG + Exonic
1083755643 11:64790285-64790307 AAGGAATTGGTGAGTGGGGACGG + Intronic
1083803666 11:65060936-65060958 GGGCAGGTGGAGAGTGGGGAGGG - Intergenic
1084038266 11:66526624-66526646 AGGGAAGTGGACAGTGGAAATGG - Intronic
1084364765 11:68690411-68690433 AGGGAAGAGGAGTGAGGGGAGGG + Intronic
1086518838 11:87646275-87646297 AGGGAAGTGAAGGGTAGGGAAGG - Intergenic
1087287223 11:96278014-96278036 ACAGAATTGGAGACTGGGGATGG - Intronic
1088850711 11:113700969-113700991 AGAGAAGTGCAGAGTGGAGAGGG - Intronic
1089001302 11:115054502-115054524 AAGGAAAGAGAGAGTGGGGAGGG + Intergenic
1089399628 11:118156944-118156966 AAGGGAGTGGTGAGTAGGGAGGG - Intergenic
1089452053 11:118605700-118605722 GCGGAGATGGAGAGTGGGGGCGG + Intergenic
1089534832 11:119154567-119154589 AAGGAGCTGGTGAGTGGGGAAGG + Exonic
1089598467 11:119597984-119598006 GTGGCAGTGGAGAGTGGAGAGGG + Intergenic
1090484820 11:127103813-127103835 ACGGGGGAGGCGAGTGGGGATGG - Intergenic
1090499795 11:127250360-127250382 TTAGAAATGGAGAGTGGGGAAGG + Intergenic
1090613429 11:128492720-128492742 TTGGAGGTGTAGAGTGGGGATGG - Intronic
1090859874 11:130643300-130643322 AGGGAAGGGGAGAGAGGGGAAGG + Intergenic
1091121473 11:133061407-133061429 AGGGAAGTGGGAAGTGGGGATGG + Intronic
1091371483 11:135063731-135063753 AAGGAAAGAGAGAGTGGGGAGGG + Intergenic
1091791623 12:3275209-3275231 AGGGAAGTGGAGAGAGGGCTCGG + Intronic
1091990150 12:4948472-4948494 AGGGAAGGGAAGAGGGGGGAGGG - Intergenic
1093188130 12:16045397-16045419 GAGGAAGTGGAGAGTGGGAGGGG + Intergenic
1096113940 12:49044214-49044236 GCGGAGGTGTTGAGTGGGGATGG - Exonic
1096741873 12:53699546-53699568 GGGGAAGTGGAGAAAGGGGAGGG - Intergenic
1096775233 12:53959693-53959715 AGGTAACTGGAGAGAGGGGAGGG - Intergenic
1096847092 12:54413309-54413331 ACGGAAGAGGAGAGTGAGGAGGG + Intronic
1096968215 12:55645652-55645674 AAGGAAGAGAAGAATGGGGAAGG - Intergenic
1097804650 12:63952139-63952161 AGTGAGGTGCAGAGTGGGGAGGG - Intronic
1097967285 12:65594890-65594912 AGGGGAGTGGGGAGTGGGGTGGG + Intergenic
1098049679 12:66440440-66440462 ATGATAGTGGGGAGTGGGGATGG - Intronic
1098558993 12:71851401-71851423 AAGGAAATGGAGATTTGGGAGGG - Intronic
1098998231 12:77146550-77146572 ACGGTTGTGGAGTGGGGGGAGGG + Intergenic
1099434489 12:82627299-82627321 AAGGAAGTGGAGAGTTGGCATGG + Intergenic
1100114376 12:91285771-91285793 ACTGTTGTGGAGTGTGGGGAGGG + Intergenic
1100180888 12:92085043-92085065 AGGGAAGTGGAGAGGGCAGAAGG + Intronic
1100319966 12:93481526-93481548 AAGGAAGTGCAGAGTGGTGGAGG - Intronic
1101254219 12:102961797-102961819 AGAGAAATGGAGAGTGGGGGTGG - Intergenic
1101952428 12:109187104-109187126 AGGGAAGAGGGGAGTGAGGAAGG + Intronic
1102010568 12:109616036-109616058 ACCGAACTGGAAAGTGGGGGAGG + Intergenic
1102598820 12:114013120-114013142 AGGGAGATGGAGAGAGGGGAGGG + Intergenic
1102797112 12:115698252-115698274 AGGGGAGTGGAGAGGAGGGAAGG + Intergenic
1103528476 12:121582974-121582996 AGAGAAGTGGAGAGTAGGTAAGG + Intergenic
1103921679 12:124402579-124402601 AGGGCAGAGGGGAGTGGGGAGGG + Intronic
1103935528 12:124474595-124474617 ACGGAACTGGAGAGTGGCAGAGG - Intronic
1104006355 12:124895538-124895560 AGGGAAGGGGAGAGAGGGAATGG + Intergenic
1104048681 12:125182219-125182241 CTGGAACTGGAGAGTGGTGATGG + Intergenic
1104049376 12:125185891-125185913 AGGGGAGAGGAGAGAGGGGAGGG - Intergenic
1104069218 12:125329954-125329976 ACGGAAGTGGACAAAGGGAAGGG + Intronic
1104098433 12:125583151-125583173 AGGGAAGTTGGCAGTGGGGATGG + Intronic
1104162022 12:126190596-126190618 AAGGGACTGGAGAGTGGGGATGG - Intergenic
1105344574 13:19561086-19561108 AAGGAAGAGGAGGATGGGGAGGG - Intergenic
1105471428 13:20698327-20698349 ACGGAAGGGGAGAGAAGGGGAGG + Intergenic
1106051445 13:26193625-26193647 AGGAAAGTGGAGAGAGGGTAAGG + Intronic
1107412309 13:40169217-40169239 AAGGAAGTGAAGGGTGGGGAGGG - Intergenic
1107584075 13:41824856-41824878 AGGGAAGGGGAGAGGAGGGAAGG + Intronic
1107832801 13:44389507-44389529 AGGGAGGTGGAGAGTTGGGAAGG - Intronic
1108104753 13:46997270-46997292 ATGGAAATAGGGAGTGGGGATGG - Intergenic
1108357729 13:49642457-49642479 AGGGAAGGAGAGAGTGAGGAAGG + Intergenic
1108712700 13:53049430-53049452 AAGGAAGGGGAGAGTGAGGAAGG + Intronic
1110321459 13:74164912-74164934 AGGGTAGTGGAGAGTAGGGGTGG + Intergenic
1110412536 13:75220146-75220168 AACGCAGTGGGGAGTGGGGAGGG + Intergenic
1110625910 13:77655439-77655461 GCGGATGTGGAGAAAGGGGAAGG - Intergenic
1110727264 13:78839830-78839852 AAGGAAAAGGAGCGTGGGGAGGG - Intergenic
1112168599 13:96946830-96946852 AGGGGAGTGGAGAGTGTGGGAGG + Intergenic
1113314436 13:109163483-109163505 AGGGAAGGAGGGAGTGGGGAGGG - Intronic
1114340351 14:21736575-21736597 AGGGAAGTAGAGCGTGGGGATGG + Intergenic
1114391758 14:22316590-22316612 AAAGAAGTGGGGAGTGGGGAGGG + Intergenic
1114966223 14:27964396-27964418 GTGGAAGGGGAAAGTGGGGATGG - Intergenic
1115413459 14:33102701-33102723 ATGGAAGTGGGAAGAGGGGAAGG + Intronic
1115566363 14:34628931-34628953 AAGGGGGTGGAGAGTGGGGTGGG + Intronic
1117559847 14:56925845-56925867 GTGGAGGTGGAGAGTGGGGTAGG + Intergenic
1117931471 14:60846147-60846169 AAGGAATAGGAGAATGGGGAAGG - Intronic
1118694917 14:68375247-68375269 ACTGAAGCTGAGAGCGGGGAAGG - Intronic
1119548894 14:75493655-75493677 GCGGGGATGGAGAGTGGGGAGGG + Intergenic
1121086551 14:91150882-91150904 CTGGAAATGGAGAGTGGTGATGG - Intronic
1121150536 14:91629582-91629604 TGGGATGTGGATAGTGGGGAAGG + Intronic
1121260347 14:92561352-92561374 AGGGAGGTGGATAGTGGGGAAGG - Intronic
1121576579 14:94993841-94993863 ATGGAAGTGAAGTGTGTGGATGG - Intergenic
1121630737 14:95420187-95420209 TCGGGAGTGGAGGGTGGGGGTGG + Intronic
1121937893 14:98037291-98037313 TGGGAAGTGGGAAGTGGGGAGGG - Intergenic
1121979240 14:98439910-98439932 GCAGGAGTTGAGAGTGGGGAGGG + Intergenic
1122067172 14:99181807-99181829 CCTGAAGTCCAGAGTGGGGAAGG - Intronic
1122081450 14:99270473-99270495 GGGGAAGTGGGGGGTGGGGAGGG + Intronic
1122579390 14:102762146-102762168 AAGGACTAGGAGAGTGGGGAGGG + Intergenic
1124023760 15:25946099-25946121 ACTGAGGCTGAGAGTGGGGAAGG + Intergenic
1124685177 15:31776475-31776497 AAGGAAGGAGAGAGTCGGGAGGG - Intronic
1125249142 15:37679239-37679261 GGGGGAGTGGAGAGGGGGGAGGG + Intergenic
1125686805 15:41568374-41568396 AGGAGAGTGGAGAGAGGGGAGGG - Intronic
1125715667 15:41818639-41818661 ACTGAAATGGAGAGAGGGGAGGG - Intronic
1125786469 15:42322742-42322764 ACGGAAATAGAAAATGGGGAGGG + Intronic
1125992890 15:44127493-44127515 ATGGAAGTGGGGAGTGGTGATGG - Intronic
1126783080 15:52155068-52155090 AGGGAAGTGGAGAGTGGCCATGG - Intronic
1128706667 15:69841910-69841932 ATGAATGTGGAGTGTGGGGAGGG - Intergenic
1128809350 15:70559384-70559406 ACAGAAGGGGAGGGAGGGGAAGG + Intergenic
1129034866 15:72642804-72642826 ATGGAAGTGGAGAGGGGAGACGG - Intergenic
1129182356 15:73885285-73885307 ACTGAAGTGGAGAAGGGGGATGG + Intronic
1129215016 15:74094412-74094434 ATGGAAGTGGAGAGGGGAGACGG + Intergenic
1129239979 15:74245392-74245414 ACGGAAATGGAGTTGGGGGAGGG - Intronic
1129390352 15:75217188-75217210 ACGGAAGTGGAGAGGGCACACGG - Intergenic
1129473917 15:75770417-75770439 ACGGAAGTGGAGAGGGGACATGG + Intergenic
1129475616 15:75782897-75782919 AAGGAGGTGGAGAGTTTGGAGGG + Intergenic
1129732158 15:77938774-77938796 ACGGAAGTGGAGAGGGGACATGG + Intergenic
1130042426 15:80415988-80416010 ACAGCAGTGGAGAGTGGGCAGGG - Intronic
1130216324 15:81973799-81973821 AGGGGAGTGGAGGGTGGGGAGGG + Intergenic
1130897448 15:88182361-88182383 TGGGAAGTGGAGGGTAGGGAAGG - Intronic
1131450386 15:92534617-92534639 AGAGAAGTGGAGAGTGAGGGGGG - Intergenic
1133311157 16:4847622-4847644 ACGGAAGCGCCGAGAGGGGAGGG - Intronic
1133804702 16:9115962-9115984 ATGGAAGTGGGGAGGGGAGAGGG - Intronic
1133980410 16:10629162-10629184 ACAGAACTAGAGAGTGGTGAGGG + Intronic
1134029867 16:10983356-10983378 AGGGCAGTAGAGAGTGGCGAGGG + Intronic
1134291102 16:12903142-12903164 AGGGAGGTGGAGTGAGGGGAGGG + Intronic
1134842753 16:17414788-17414810 ACGGCAGTTGAGGGTGGTGAGGG - Intronic
1135089311 16:19500287-19500309 ACTGAAGTGGAGACAAGGGATGG - Intergenic
1135200772 16:20436232-20436254 AGGGGAGAGGAGAGTGGGGAGGG - Intronic
1136228799 16:28875418-28875440 GCGGAGCTGGACAGTGGGGAAGG - Intergenic
1136239701 16:28936651-28936673 AGGGATGAGGAGAGTGGGGGTGG - Intronic
1136580612 16:31148985-31149007 ACGGAAGTGGGGCGGGAGGAGGG + Intronic
1138290583 16:55843115-55843137 AAAAAAGGGGAGAGTGGGGAGGG + Intergenic
1138348204 16:56332694-56332716 ACGGCTGTGGAGGGTGGGCAAGG - Intronic
1138444412 16:57054663-57054685 AAGGAAAGGGAGGGTGGGGAGGG - Intronic
1138597829 16:58038586-58038608 AGGGAGGTGGGGGGTGGGGAAGG - Intronic
1139360938 16:66399650-66399672 ACTGAGGTGGACATTGGGGAGGG - Intronic
1139518678 16:67467013-67467035 AGGGAATTGGAGACTTGGGAGGG - Intronic
1139656224 16:68388629-68388651 AGTGGGGTGGAGAGTGGGGAGGG - Intronic
1139909027 16:70385441-70385463 CTGGAAATGGAGAGTGGTGATGG + Intronic
1140615558 16:76658332-76658354 ATGGAATTCTAGAGTGGGGAGGG + Intergenic
1141579413 16:84986962-84986984 TCTGAAGGGGAGAGTGGGCATGG - Intronic
1141594052 16:85086745-85086767 GCGGGAGGGGAGAGGGGGGAGGG + Intronic
1141876954 16:86831753-86831775 ACGGGAGTGGGTGGTGGGGATGG - Intergenic
1143587634 17:7858512-7858534 GAGGAAATGGAGAGCGGGGATGG + Intronic
1144004440 17:11087453-11087475 ACAGGAGTGGGGATTGGGGATGG + Intergenic
1145055882 17:19703828-19703850 AGGGAAGGAGTGAGTGGGGATGG + Intronic
1145168207 17:20632950-20632972 ATGGAAGTGGAACGTGGGCAAGG - Intergenic
1145716374 17:27027109-27027131 AAGGAAGTGGAGCCTGTGGATGG - Intergenic
1145878614 17:28338335-28338357 AGGGAAGAGGAGAGTAGGGCTGG + Intronic
1146393336 17:32442906-32442928 ACGGATGTGAGGAGGGGGGATGG - Intergenic
1147144297 17:38476443-38476465 ATGGGGGTGGAGAGTGGAGAAGG + Intronic
1147360073 17:39924822-39924844 AGGGAAGTGGGGAGGGAGGAAGG + Intronic
1147994225 17:44352476-44352498 AAGGACGTGGAGTGTGGGGAAGG + Exonic
1148783335 17:50133689-50133711 ACTGAGGTGGGGAGTGGGCAGGG - Intergenic
1148849401 17:50547485-50547507 AAGGAAGGGGAGAGGAGGGAAGG - Intronic
1149294454 17:55249345-55249367 CTGGAATTGGGGAGTGGGGAAGG - Intergenic
1150451055 17:65269324-65269346 ACGGAATTGGTGTCTGGGGATGG + Intergenic
1150972176 17:70041139-70041161 GGGTAAGTGGAGAGTGGGTAGGG + Intergenic
1151165331 17:72198480-72198502 GTGGTAATGGAGAGTGGGGAGGG - Intergenic
1151338898 17:73457168-73457190 ACTGGCGTGGAGTGTGGGGATGG + Intronic
1151390605 17:73784471-73784493 AAGGAACTGGAGACAGGGGAAGG - Intergenic
1151529469 17:74695320-74695342 TCGGAGGAGGATAGTGGGGATGG + Intronic
1151656482 17:75498619-75498641 ATGGAAATGAAGACTGGGGAAGG - Exonic
1151837460 17:76592015-76592037 CCGGAAGTGGAGAGTGGATGGGG + Intergenic
1152032840 17:77854565-77854587 GCGGGAGTGGAGGGTGGGGGTGG - Intergenic
1152110901 17:78357402-78357424 AGGGAAGTGGGGAGGGGGGGCGG - Exonic
1152311932 17:79556808-79556830 ACCGAAGGGGAGCGTGGGGAAGG + Intergenic
1152352892 17:79793203-79793225 GCGGGAGTTGGGAGTGGGGACGG - Exonic
1152592891 17:81222475-81222497 AGGGAGGTGGAGAGGGTGGAGGG + Intronic
1152859107 17:82685269-82685291 AGGGAAAAGGAGGGTGGGGAGGG + Intronic
1153084785 18:1271814-1271836 AAGGAACTGGAATGTGGGGAAGG + Intergenic
1153314884 18:3711908-3711930 AGGGATGGGGAGTGTGGGGATGG + Intronic
1153611798 18:6893331-6893353 ACTGAACTGGAGAGCAGGGATGG + Intronic
1153753302 18:8255820-8255842 AGGGAAGTGAGGAGTGGTGATGG + Intronic
1153778549 18:8475140-8475162 GGGGAAGAGGAGAGAGGGGAAGG - Intergenic
1153971995 18:10235504-10235526 ATGGAAGTGGAGAGGCAGGAGGG - Intergenic
1154963269 18:21330815-21330837 GAGGAAGTGGGGAGTTGGGATGG - Intronic
1155082716 18:22426788-22426810 CTGGAAGTGGATAGTGGTGATGG - Intergenic
1155243722 18:23887301-23887323 AAGGATGTGGGGAGTGGGAAAGG + Intronic
1155902795 18:31411678-31411700 AGGGAAGTGGAGAATGATGAGGG - Intronic
1156631536 18:38975295-38975317 AAGGAAAAGGAGAGTGTGGAAGG - Intergenic
1156863940 18:41868049-41868071 ACGGGAGGGGAGAGTGGAAAAGG - Intergenic
1156865367 18:41883448-41883470 GTGGAAGTGTAGAGTGGGGATGG + Intergenic
1157406101 18:47423900-47423922 AGGGAAGTGGAGAGGGAGAAAGG + Intergenic
1157741846 18:50100547-50100569 AGAGAAGTAGAAAGTGGGGAGGG - Intronic
1159441094 18:68481554-68481576 ACAGAAGAAGAGAGTAGGGATGG + Intergenic
1160177808 18:76610424-76610446 TTGGAAATGGAGAGTGGTGACGG - Intergenic
1160797951 19:954367-954389 CAGGAAGTGGACAGAGGGGAGGG + Intronic
1160910993 19:1473749-1473771 ACAGAAGTGCAGGGTGGGAAGGG + Exonic
1161207123 19:3047063-3047085 AGGGAAGTGGAGGGAGGGGGAGG - Intronic
1161239356 19:3213406-3213428 AAGGAAGGGGAGAGGGAGGAGGG + Intergenic
1161241236 19:3225013-3225035 AGGGAGGGGGAGAGGGGGGAGGG - Intronic
1161271024 19:3389350-3389372 AGGGGAGTGGAGGGTGGGAAGGG + Intronic
1161732005 19:5966518-5966540 ACGGAAGAGGAGAGAGGCGGAGG - Intronic
1162623912 19:11867682-11867704 ATGGTAGTGCACAGTGGGGATGG + Exonic
1162924515 19:13923499-13923521 AGGGAAGGGAAGAGAGGGGAAGG - Intronic
1163351321 19:16777850-16777872 AGGGAAGGGAAGAGGGGGGAAGG + Intronic
1163463852 19:17455131-17455153 CCGGAGGTGGAGAGCTGGGAGGG - Intronic
1163583438 19:18151728-18151750 GAGGAAGGGAAGAGTGGGGAGGG + Intergenic
1163632566 19:18424862-18424884 AGGGAGGGGGAGAATGGGGAAGG + Intronic
1163758476 19:19120563-19120585 CAGGAAGTGGAGCCTGGGGATGG - Intronic
1163945683 19:20531247-20531269 ACGGGAGAGGGGAGAGGGGAGGG + Intergenic
1164323929 19:24176130-24176152 ACTGTGGTGGAGAGGGGGGAAGG - Intergenic
1164532289 19:29057671-29057693 AGGGAAGTAGAAAGTGGGGCTGG - Intergenic
1165157129 19:33795735-33795757 GCCGAAGCGGAGACTGGGGAGGG + Intergenic
1165995458 19:39840561-39840583 CCTGAGGTGGGGAGTGGGGAGGG - Intronic
1166071273 19:40389561-40389583 ACGGATGTGGCGGGCGGGGAGGG + Exonic
1166665659 19:44678750-44678772 AGGAAAATGGAGAGGGGGGAGGG - Intronic
1167264508 19:48477059-48477081 ACAGGAGTGGAGATTGGTGATGG + Intronic
1167667566 19:50831649-50831671 AAGGAAGCGCAGAGTGGGGTTGG - Intronic
1168612699 19:57814028-57814050 AAGAAAGTGGAGGGTGGGGCCGG - Intronic
925348916 2:3187974-3187996 AGGTGAGTGGGGAGTGGGGAGGG - Intergenic
925835513 2:7941814-7941836 AGAGAAGTGGAGAGGAGGGATGG - Intergenic
925881108 2:8353103-8353125 AGGGAAGGGGAGAGGAGGGAAGG + Intergenic
925895420 2:8468022-8468044 CCGGAGGTGGAGAGTGGGGATGG - Intergenic
926862571 2:17324442-17324464 ATGGATGAGGAGAATGGGGATGG - Intergenic
927088139 2:19690432-19690454 AGGGAAGGGGAGAGAAGGGAAGG + Intergenic
927653184 2:24924501-24924523 ACGGGAGTGGAGAGGGGGACCGG + Intergenic
927882927 2:26701371-26701393 AGGGAAGTGGAGAAGGTGGATGG + Intronic
928213140 2:29338880-29338902 ATTGAAATGGAGACTGGGGAAGG - Intronic
928354100 2:30593055-30593077 AGGGAAGGGGAAAGTCGGGAGGG - Intronic
928644415 2:33336635-33336657 AGAGAAGTGGATAGTGGGAATGG - Intronic
928951464 2:36817159-36817181 TAGGAAGGGGAGAGTGAGGAAGG + Intergenic
929237892 2:39625742-39625764 GGGGAAGAGGAGAGTGGGGAGGG + Intergenic
929357942 2:41049501-41049523 ATGGAAGGGAAGAGAGGGGAGGG - Intergenic
929709965 2:44256750-44256772 GGGGAAGAGGGGAGTGGGGAAGG + Intergenic
929815916 2:45231357-45231379 AGGGAAGTGGAGAGAGGTGGAGG + Intergenic
930312247 2:49755940-49755962 AGGGAAGGGGGAAGTGGGGAAGG + Intergenic
930393882 2:50795566-50795588 AGGGAATTGGGGAGTGAGGAAGG - Intronic
930826355 2:55700350-55700372 AGGGGAGGGGAGAGAGGGGAGGG - Intergenic
931007199 2:57865240-57865262 GAGGAAGAGGAGAATGGGGATGG + Intergenic
931566650 2:63622018-63622040 AGGGGAGTGGGGAGGGGGGAGGG - Intronic
931831009 2:66051736-66051758 ATGGCAGTGGAGAGTGGGTTGGG - Intergenic
931831019 2:66051856-66051878 ATGGCAGTGGAGAGTGGGTTGGG - Intergenic
932024486 2:68119704-68119726 GCGGGAGGGGAGAGTGGGCATGG + Intergenic
932088128 2:68780598-68780620 AAGGAAGGGGAGAAGGGGGAAGG - Intronic
932462353 2:71891194-71891216 AATGAAGTGGGGAGTAGGGAGGG + Intergenic
932771155 2:74501639-74501661 ATGGAAGTGGAGAGTAGCAAAGG + Intronic
933215825 2:79629070-79629092 ACGGAAGTGGAGAGTGGGGAAGG - Intronic
933759162 2:85662362-85662384 ATGGAGGTGGAGGGAGGGGAGGG - Intronic
933771707 2:85748834-85748856 GTGGAAAGGGAGAGTGGGGAGGG - Intergenic
933803164 2:85979051-85979073 AAGGAAGAGGAAAGAGGGGAAGG - Intergenic
934162467 2:89264831-89264853 ACAGAAGTGGAGAGGGTGGGGGG - Intergenic
934204807 2:89917885-89917907 ACAGAAGTGGAGAGGGTGGGGGG + Intergenic
934860017 2:97756983-97757005 AAAGAAGAGGAGGGTGGGGAGGG + Exonic
935142806 2:100368862-100368884 ACTGAAGGGGAGATGGGGGAAGG + Intergenic
935210842 2:100938499-100938521 ACGGAGGGAAAGAGTGGGGAGGG - Intronic
936459958 2:112706332-112706354 AAGGGGGTGGAGAGAGGGGAAGG - Intergenic
936479625 2:112873960-112873982 AAGGTAGAGGAGAGTGTGGAGGG - Intergenic
936974498 2:118205587-118205609 AAGAAAGTGGAGACTGGAGAGGG + Intergenic
937130619 2:119509741-119509763 ATGGAAATGGATACTGGGGATGG - Intronic
937283347 2:120735491-120735513 AGGGAAGTGGGAGGTGGGGAGGG + Intergenic
937311096 2:120903953-120903975 CAGGAAGGGGAGATTGGGGAGGG + Intronic
937436477 2:121885844-121885866 ACGGGGGTGGGAAGTGGGGATGG - Intergenic
937857888 2:126685931-126685953 AGGGGAGTTGAGAGTGAGGATGG - Intronic
937972946 2:127564460-127564482 AAGGAAGTGGGAAGTGGGAAAGG + Intronic
937993935 2:127679314-127679336 ACGGCAGTTGGAAGTGGGGAGGG + Intronic
938000935 2:127736283-127736305 GAGGAAGAGGAGACTGGGGAAGG + Intronic
938717351 2:134032949-134032971 GAGTAAGTGGAGAGTGAGGATGG + Intergenic
939118690 2:138090249-138090271 AGGTAAGTGGGGAATGGGGAAGG + Intergenic
939182950 2:138825467-138825489 AGTGAAGTGGAAAGTGGGAATGG - Intergenic
939960108 2:148558834-148558856 AGGGAAGTGGAGAGTGGGTCTGG + Intergenic
941682945 2:168418588-168418610 AAGGGTGTGGAAAGTGGGGAGGG + Intergenic
942327185 2:174785879-174785901 ACAGAAGCTGGGAGTGGGGAGGG + Intergenic
943148320 2:184074999-184075021 AAGGAAGAGAAGAGAGGGGAGGG - Intergenic
944009651 2:194958241-194958263 TGGGGTGTGGAGAGTGGGGAGGG + Intergenic
944105611 2:196076179-196076201 AAGGAAGTGGAAAGAAGGGAAGG + Intergenic
944314395 2:198269634-198269656 AGGAAAGGGGAGAGGGGGGAAGG - Intronic
944778905 2:202997383-202997405 CAGGAAGTGGATAGTGGTGATGG - Intronic
946796857 2:223363495-223363517 AGGGAGGTGGTGGGTGGGGATGG + Intergenic
947126804 2:226877605-226877627 ATGGCAGGGGAAAGTGGGGAGGG + Intronic
947507023 2:230715533-230715555 AGCGAAGTGGGGAGTGGGAAGGG - Intronic
947661196 2:231869965-231869987 AAGGAAGGGGGGAGGGGGGAGGG - Intergenic
947833384 2:233158022-233158044 AAGGAAGAAGAGAGAGGGGAAGG + Intronic
948377928 2:237534329-237534351 AAGAGAGGGGAGAGTGGGGAGGG - Intronic
948701749 2:239765010-239765032 TCCTAAGTGGAGAGTGGGGACGG + Intronic
948994730 2:241572577-241572599 CCGGAAGGGGTGAGTGGGGAGGG + Exonic
1169345919 20:4828014-4828036 GAGGAAGTGGAGAGTGGGGAAGG + Intergenic
1169391481 20:5194752-5194774 AAGGAAGGGGAGGGTGGGGGAGG - Exonic
1169540147 20:6591150-6591172 AAGGCAGGGGAGAGAGGGGAAGG - Intergenic
1169918238 20:10705379-10705401 ATGGATGGGGACAGTGGGGATGG + Intergenic
1169946575 20:10995411-10995433 AAGGAAGTGGAGAGAGAGAAAGG + Intergenic
1170652713 20:18257364-18257386 TCAGATCTGGAGAGTGGGGAGGG - Intergenic
1170851760 20:20011304-20011326 AGGGAAGGGAAGAGAGGGGAGGG - Intergenic
1171399877 20:24865946-24865968 AAGGGAGTGGAAAGTGTGGATGG + Intergenic
1171766282 20:29282991-29283013 ACTGTTGTGGAGTGTGGGGAGGG + Intergenic
1172151488 20:32793713-32793735 ATGTGAGGGGAGAGTGGGGAGGG - Intronic
1172285082 20:33734541-33734563 CCAGAAATGGGGAGTGGGGAGGG + Intronic
1172548631 20:35781617-35781639 ACGGAGATGGAGAGTGGTGATGG - Intronic
1173200441 20:40950918-40950940 ATGGAAGTGGAGTGTGGTGAGGG - Intergenic
1173500261 20:43548073-43548095 AGGGAGGTGGAAAGTGGAGAAGG - Intronic
1173551173 20:43934062-43934084 ATGGAAGGTGAGGGTGGGGATGG + Intronic
1173803517 20:45909900-45909922 AGGGGAGTGGAGAGTGGGTCAGG - Intronic
1175045128 20:56097750-56097772 AAGGAAGTGGAGATTCAGGAAGG + Intergenic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1176165088 20:63668589-63668611 AGGGAAGAGGTGAGTGGGGGCGG + Intronic
1176253366 20:64137778-64137800 ACAGAGGTGGAAAGTGGGGTGGG + Intergenic
1176303736 21:5112853-5112875 ACGGGGGTGGAGGGTGGGGGAGG + Intergenic
1176740049 21:10593151-10593173 ACAAGAGTGGAGAGTGGGGTTGG - Intronic
1177797427 21:25793593-25793615 AAGGAAGGAGAGAGAGGGGAAGG - Intergenic
1179618811 21:42599058-42599080 AGCGATGTGGAGAGTGGGGATGG - Intergenic
1179853296 21:44149097-44149119 ACGGGGGTGGAGGGTGGGGGAGG - Intergenic
1179901447 21:44396488-44396510 AGGGATGTGGAGACTGTGGAAGG + Intronic
1180572162 22:16735863-16735885 ACAGCAGTGGAGAGTGGTGAGGG + Intergenic
1180793967 22:18592831-18592853 AAGGGAGGGGAGAATGGGGAAGG + Intergenic
1181227773 22:21402489-21402511 AAGGGAGGGGAGAATGGGGAAGG - Intergenic
1181250879 22:21532350-21532372 AAGGGAGGGGAGAATGGGGAAGG + Intergenic
1181661291 22:24351077-24351099 GCAGCAGTGGAGAGTGGAGAAGG - Intronic
1181737483 22:24893072-24893094 AAGGAAGCGGAGGGGGGGGAGGG + Intronic
1181766824 22:25098296-25098318 ACGAAAGGGGAGAGAGAGGAGGG - Intronic
1181924703 22:26348833-26348855 AGGGAAGGGGAGAGAAGGGAGGG + Intronic
1182011365 22:27003415-27003437 ATGGAATTGGAGGGTAGGGAGGG - Intergenic
1182052281 22:27322719-27322741 ACGGAAGCCCAGAGTGGGGAAGG + Intergenic
1182232543 22:28849547-28849569 AGGGAAGGGAAGAGAGGGGAGGG - Intergenic
1182262135 22:29081130-29081152 AAGGACGGGGGGAGTGGGGAGGG - Intronic
1183021723 22:35032837-35032859 AAGAAAGTGGAGAAGGGGGAGGG + Intergenic
1183058751 22:35322617-35322639 TGGGAAGTGGAGAGTGGGGAGGG + Intronic
1183466931 22:37984588-37984610 AAGGAGGGGGAGAGGGGGGAGGG + Intronic
1183932597 22:41244843-41244865 CTGGAAATGGAGAGTGGTGATGG - Intergenic
1185113988 22:48920759-48920781 CCGGGAGTGGGAAGTGGGGAGGG + Intergenic
1185306418 22:50119820-50119842 ACTGAAATGGAGAGCTGGGAGGG + Intronic
949221756 3:1642872-1642894 GGGGAAGTGAAGAGAGGGGAGGG + Intergenic
949382836 3:3465030-3465052 AGGGAAGGGGAGAGGGGGAAGGG + Intergenic
949682142 3:6526588-6526610 ACAGAAGTGGTGAGTGGGTCGGG + Intergenic
950096108 3:10331603-10331625 ACCGAAGTGGAGACTTGAGATGG - Intronic
950483758 3:13260838-13260860 AAGGAAGAGGAGAGTGGAGGGGG + Intergenic
950674894 3:14548771-14548793 ACTGAGGTCGAGAGAGGGGAAGG + Intergenic
950694960 3:14691885-14691907 AGGGTAGTGTGGAGTGGGGAGGG - Intronic
950881960 3:16329332-16329354 GCGGAAGTGGAGAAAGGGAAAGG + Intronic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
952804123 3:37330648-37330670 CAGGAAGTGGAGGGTGGGCAAGG + Intronic
953703069 3:45211455-45211477 ATGGAAATGGTTAGTGGGGAGGG + Intergenic
954893492 3:53954754-53954776 ACAGAAGTGGAGAGAAGGGCAGG + Intergenic
954992749 3:54855191-54855213 CAGGAAATGGAGAGAGGGGAGGG + Intronic
955670809 3:61400582-61400604 CTGGAAGTGGATAGTGGTGATGG - Intergenic
956436253 3:69237212-69237234 ACGGAAGAGGAGGGAGGGGCCGG + Intronic
956622250 3:71233237-71233259 AGGGAAGGGGAGAGGAGGGAAGG + Intronic
957106028 3:75888539-75888561 ACAGCAGTGGAGAGTGGTGAGGG - Intergenic
958135196 3:89479527-89479549 ACGGAAGTGGTGGCTGTGGAAGG + Exonic
958424312 3:93963867-93963889 ACGGAAGGGGAGGGGAGGGAAGG - Intronic
959784398 3:110276622-110276644 AGGGGAGGGGAGAGAGGGGAGGG - Intergenic
959784407 3:110276641-110276663 AAGGGAGGGGAGAGAGGGGAGGG - Intergenic
959921096 3:111869323-111869345 AAGGAAGTGGAGAGTGATGGGGG - Intronic
960571283 3:119187705-119187727 AAGGGGGTGGAGGGTGGGGAAGG - Intronic
961056056 3:123789685-123789707 ACGGAAGGGAAGAGATGGGAAGG + Intronic
961402613 3:126657772-126657794 TGGGAAGTGGAGAGTCAGGAAGG + Intergenic
961416323 3:126760422-126760444 CCGGAAAAGGAGAGTGGTGATGG - Intronic
961511560 3:127406870-127406892 AGGCATGTGAAGAGTGGGGAGGG + Intergenic
961514396 3:127423683-127423705 AAGGAAGGAGGGAGTGGGGAAGG - Intergenic
961765867 3:129210515-129210537 CCGGAAATGGAGAGTTGTGATGG + Intergenic
963016472 3:140828690-140828712 AGGGAAGTGGAGAATGGCTATGG - Intergenic
963263652 3:143217624-143217646 AAGGAGGTGGAGAGTGGGGTGGG + Intergenic
963291124 3:143490577-143490599 ATGGAAGTGGACAGTGGTGATGG + Intronic
963436368 3:145272659-145272681 AAGGAGGTGGGGAGGGGGGAGGG - Intergenic
963507064 3:146199681-146199703 ATGGAAGAAGATAGTGGGGAGGG - Intronic
964134003 3:153323976-153323998 ACTGGACGGGAGAGTGGGGAAGG - Intergenic
964209934 3:154215337-154215359 AGGGGAGTGGGAAGTGGGGAGGG - Intronic
965439621 3:168697228-168697250 ATGGAAGGAGAGAGAGGGGAAGG + Intergenic
965640727 3:170826169-170826191 AAGGAAGTGGAGAATGTGGGAGG + Intronic
966318599 3:178676424-178676446 AGGGGAGAGGAGAGTGGTGAAGG - Intronic
967196516 3:187030964-187030986 AAGGCAGTGGGCAGTGGGGAGGG + Intronic
967257945 3:187612316-187612338 ATGGAGGTGGAAAGTGGAGAAGG + Intergenic
967843249 3:194024054-194024076 ACCCAAGTGAAGGGTGGGGATGG - Intergenic
967847922 3:194058552-194058574 AGAGAAGAGGGGAGTGGGGAGGG + Intergenic
968741737 4:2334755-2334777 GCGGAAGTGGGGAGGGGGAAGGG - Intronic
968912441 4:3483104-3483126 AGGGGTGTGGAGGGTGGGGACGG + Intronic
968912454 4:3483148-3483170 AGGGGTGTGGAGGGTGGGGACGG + Intronic
968912467 4:3483192-3483214 AGGGGTGTGGAGGGTGGGGACGG + Intronic
968912480 4:3483236-3483258 AGGGGTGTGGAGGGTGGGGACGG + Intronic
969564326 4:7968774-7968796 CCGGAGCTGGAGAGTGGGGTTGG + Intronic
970105164 4:12574438-12574460 AAGGAAGAAGAGAGTGAGGAGGG + Intergenic
970983664 4:22130233-22130255 ACAGACGTGGAGTGTGGGAAGGG - Intergenic
971834840 4:31749333-31749355 AAGAAAGTGGAGAGAGGGGCAGG - Intergenic
972025788 4:34375190-34375212 ATGGAAGGAGAGAGTGTGGATGG - Intergenic
972067999 4:34976184-34976206 ATGGAAATGGAGACTGAGGAGGG + Intergenic
972532997 4:39977384-39977406 ACGGAAGGGGAGACTGGAGGGGG - Intronic
972574615 4:40340204-40340226 AAAGGGGTGGAGAGTGGGGAAGG - Intronic
972753284 4:42014915-42014937 TGGGAGGTGGAGAGTGAGGATGG + Intronic
972929471 4:44053571-44053593 ACAGGAGTGGATGGTGGGGATGG + Intergenic
972986149 4:44768489-44768511 CTGGAAGTGGATAGTGGTGACGG + Intergenic
973977766 4:56280380-56280402 AAGGAGGTGGAGATGGGGGATGG - Intronic
974608763 4:64187637-64187659 AGGGCAGGGGAAAGTGGGGATGG - Intergenic
974841307 4:67302680-67302702 ATGGAGGTGGAGAGAGAGGAAGG + Intergenic
975764257 4:77650526-77650548 TCCAAAGTGGAGAGTGGGGGAGG + Intergenic
976037674 4:80843901-80843923 ACTATTGTGGAGAGTGGGGAGGG - Intronic
976355346 4:84110833-84110855 AGGGAAGGGGAGAGAAGGGAAGG - Intergenic
976532039 4:86166698-86166720 AGGGAGGTGGAAAGTGGAGAGGG - Intronic
976572986 4:86635003-86635025 ACAGAACTGGAGAATGGGGGTGG - Intronic
976894037 4:90085635-90085657 CTGGAAATGGAGAGTGGTGATGG - Intergenic
976900635 4:90170511-90170533 AGGGTAGTGGAGAGTGGCTAGGG - Intronic
977003830 4:91540164-91540186 TGGGATGTAGAGAGTGGGGAAGG - Intronic
977454921 4:97246946-97246968 AGGGTAGTAGAGGGTGGGGATGG - Intronic
977763363 4:100767149-100767171 AAGGATGTCGACAGTGGGGAAGG + Intronic
979546983 4:121950920-121950942 AGAGAAGTGGGGAGTAGGGAGGG - Intronic
979608391 4:122664122-122664144 ACGCAAGTGGAAAGTTGTGAAGG + Intergenic
979814702 4:125086431-125086453 AAGGAGGTGGAGAGAGAGGAGGG - Intergenic
979865065 4:125744133-125744155 AGGGAAGTGGGGAGGGAGGAAGG + Intergenic
980256361 4:130385220-130385242 ACATAAGAGGAGAGTGGAGAAGG + Intergenic
981265256 4:142775525-142775547 AGGGAAGAGGAGAGTAGGGGAGG - Intronic
981774177 4:148346083-148346105 GCTGAAATGGAGAGAGGGGAGGG + Intronic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
982452835 4:155572997-155573019 AAGGAAGAGCAGTGTGGGGAAGG + Intergenic
982452839 4:155573016-155573038 AAGGAAGAGTAGTGTGGGGAAGG + Intergenic
982553682 4:156834050-156834072 AGGGAAGTAGAGAGTAAGGAAGG - Intronic
984044084 4:174776005-174776027 AAGGAGGTGGAGAGTGAGAAGGG + Intronic
984233130 4:177124175-177124197 AGGGAAGTGGAGAGAGGGAGAGG - Intergenic
984261979 4:177453411-177453433 AGGGGAGGGGAGAGTAGGGAAGG - Intergenic
984762698 4:183376667-183376689 GCAGAGGTGGACAGTGGGGAGGG - Intergenic
985542972 5:495397-495419 CGGGGAGTGGAGCGTGGGGAGGG - Intronic
985542983 5:495432-495454 CGGGGAGTGGAGCGTGGGGAGGG - Intronic
985542994 5:495467-495489 CGGGGAGTGGAGCGTGGGGAGGG - Intronic
985543005 5:495502-495524 CGGGGAGTGGAGCGTGGGGAGGG - Intronic
985543016 5:495537-495559 CGGGGAGTGGAGCGTGGGGAGGG - Intronic
985543027 5:495572-495594 CGGGGAGTGGAGCGTGGGGAGGG - Intronic
985543038 5:495607-495629 CGGGGAGTGGAGCGTGGGGAGGG - Intronic
985543049 5:495642-495664 CGGGGAGTGGAGCGTGGGGAGGG - Intronic
985543060 5:495677-495699 CGGGGAGTGGAGCGTGGGGAGGG - Intronic
985543071 5:495712-495734 CGGGGAGTGGAGCGTGGGGAGGG - Intronic
985543082 5:495747-495769 CGGGGAGTGGAGCGTGGGGAGGG - Intronic
985543093 5:495782-495804 CGGGGAGTGGAGCGTGGGGAGGG - Intronic
985543104 5:495817-495839 CGGGGAGTGGAGCGTGGGGAGGG - Intronic
985543115 5:495852-495874 CGGGGAGTGGAGCGTGGGGAGGG - Intronic
985543126 5:495887-495909 CGGGGAGTGGAGCGTGGGGAGGG - Intronic
985543137 5:495922-495944 CGGGGAGTGGAGCGTGGGGAGGG - Intronic
985658051 5:1142289-1142311 ACGGGAGGGGCGAGGGGGGAGGG - Intergenic
986761987 5:10888682-10888704 ACAAAAGTGGAGAGTGAGAAAGG + Intergenic
987147357 5:15005423-15005445 AAGGAAGGGGGGAGGGGGGAAGG - Intergenic
988197652 5:28025909-28025931 ATGGCAGGGGAGAGTGAGGAGGG + Intergenic
988249188 5:28732905-28732927 AGGGTATTGGGGAGTGGGGATGG - Intergenic
989411488 5:41124488-41124510 ATGAAAGTGCAGAGTGGGGATGG - Intergenic
990008175 5:50966418-50966440 AGGGGAGTGGAAACTGGGGAAGG + Intergenic
990709590 5:58565158-58565180 AGGGAGATGGAGAGTGGGGGGGG + Intergenic
991455959 5:66804630-66804652 ATGAAAGTAGAGAGTGGGAAGGG + Intronic
991941609 5:71858434-71858456 ACGGAAATGGTGACTGGGAAAGG + Intergenic
992033814 5:72751470-72751492 AAGGAAGTAGATAATGGGGAAGG + Intergenic
993124497 5:83816416-83816438 AAGGAAGGGGAGAGTGTAGAGGG + Intergenic
993158723 5:84260776-84260798 ACAGAAATGGAGAGAGGGCAGGG - Intronic
993452635 5:88091510-88091532 ACTGAAGAGGGGAGTGGGGTGGG - Intergenic
993644210 5:90443167-90443189 ACTGTGGTGGGGAGTGGGGAGGG - Intergenic
994273410 5:97808314-97808336 ACTTAAGTGCAGGGTGGGGAAGG + Intergenic
995071455 5:107926703-107926725 ATGGAAGAAGAGAGTTGGGAAGG + Intronic
996893585 5:128453716-128453738 GCTGAAATGCAGAGTGGGGAAGG + Intronic
997175396 5:131771079-131771101 ACTGTTGTGGGGAGTGGGGAGGG - Intronic
997654728 5:135546383-135546405 TCTGAAGTGGAGATGGGGGAGGG + Intergenic
998167700 5:139853774-139853796 AAGGAAGTGGGGGGTTGGGAGGG + Intronic
998304046 5:141055101-141055123 ACGGAAATGGAGGGTGGGTGAGG + Intergenic
998511001 5:142713880-142713902 CCGGAAATGGATGGTGGGGATGG - Intergenic
1000278115 5:159757342-159757364 AAGGAAGTGGAGAGAGATGAAGG - Intergenic
1001207594 5:169779002-169779024 AGGGATGTTGATAGTGGGGAAGG + Intronic
1001219864 5:169891242-169891264 ACGGAAGGGGAGAGGGGGTCAGG - Intronic
1001306520 5:170578362-170578384 ACAGAAGTGGAGGGTGGGAGTGG + Intronic
1001309723 5:170602261-170602283 AGGGAAGTGGTGAGTGGGAAGGG - Intronic
1001415987 5:171545173-171545195 AGGGTAATGGAGAGTGAGGAGGG + Intergenic
1001444743 5:171774608-171774630 AAGGAATTGGAGGGTGGGGTGGG - Exonic
1002346976 5:178554916-178554938 CTGGAAGTGGATAGAGGGGATGG - Intronic
1002461331 5:179375440-179375462 AAGGAGGGGGAGTGTGGGGAAGG - Intergenic
1002987291 6:2202808-2202830 ACCACAGTGGAGAGAGGGGATGG + Intronic
1003923507 6:10855686-10855708 AGGGAGGTTGAGGGTGGGGATGG - Intronic
1005532123 6:26718628-26718650 GCAGGAGTGGGGAGTGGGGAGGG - Intergenic
1005538672 6:26783037-26783059 GCAGGAGTGGGGAGTGGGGAGGG + Intergenic
1006101180 6:31687359-31687381 GCGGAAGTGGAGGGTGGGGAGGG - Intronic
1006253847 6:32813660-32813682 AGGGAAGGTGGGAGTGGGGAAGG + Intronic
1006473973 6:34243648-34243670 ACAGAAGTCCAGAGAGGGGAAGG + Intronic
1007178058 6:39909814-39909836 AGGTAAGTGCAGGGTGGGGAGGG - Exonic
1007553386 6:42746718-42746740 ACTGCAGTGGATAGGGGGGAGGG - Intergenic
1009009526 6:57825272-57825294 GCAGGAGTGGGGAGTGGGGAGGG + Intergenic
1010926337 6:81751036-81751058 ACTAAAGTGGAGGGTGGGGAGGG + Intronic
1010949977 6:82024116-82024138 ATGCAAATGGAGAGTGGTGATGG - Intergenic
1012873020 6:104694377-104694399 AGGGTAGTGGGAAGTGGGGATGG + Intergenic
1013649360 6:112178566-112178588 AGGGAAGAGTGGAGTGGGGAGGG - Intronic
1013921516 6:115410679-115410701 ACAGAAGTGGAGACTAGAGATGG + Intergenic
1014050999 6:116954278-116954300 AGGGTAGTGGGGAGTGGTGAAGG - Intergenic
1015771189 6:136769866-136769888 GTGGAAGTGGAGAGAAGGGAAGG + Intronic
1015899010 6:138045881-138045903 ATGGAAGTGTTGAGTGGTGAGGG - Intergenic
1015993370 6:138971812-138971834 AGGGAAGTGAAAAGTGGGGGTGG - Intronic
1016567348 6:145471555-145471577 CCTGGAGTGGGGAGTGGGGAAGG - Intergenic
1016794969 6:148108183-148108205 AGGGCAGTGGAGAGGTGGGAGGG - Intergenic
1016863744 6:148746975-148746997 AAGGAGGTGGAGCGAGGGGATGG + Intergenic
1017540239 6:155394238-155394260 AAGGCGGTGGGGAGTGGGGAGGG - Intergenic
1017685995 6:156914119-156914141 TCGGGAGTGGAGAGTGGAAAGGG - Intronic
1017775076 6:157674200-157674222 TCGGAAGTAGGGAGAGGGGAGGG + Exonic
1019160987 6:170066693-170066715 TTGGAAGTGGGCAGTGGGGATGG - Intergenic
1019738956 7:2663424-2663446 ATGGGAGGGCAGAGTGGGGAGGG + Exonic
1019892049 7:3954636-3954658 ACGGAAGCGGAGGGTGTAGAGGG - Intronic
1020104142 7:5413372-5413394 ACGGATGGGGAGAGGAGGGAAGG - Intronic
1020122005 7:5509851-5509873 CCGGAGATGGAGAGTGGGGGTGG - Intronic
1020570210 7:9850826-9850848 AGGGGAGTGGAGGGAGGGGAGGG + Intergenic
1021086439 7:16425621-16425643 AGGGAGATGGGGAGTGGGGAGGG - Intergenic
1021116004 7:16747391-16747413 AAGGAAGGGGAGAGAGAGGAGGG - Intergenic
1021142845 7:17049007-17049029 ACGGAAAATGAGAGTAGGGAGGG + Intergenic
1021340872 7:19460844-19460866 ACTGTGGTGGGGAGTGGGGAGGG + Intergenic
1021376302 7:19911425-19911447 GTGGCAGTGGGGAGTGGGGATGG + Intergenic
1023347468 7:39286131-39286153 TGGGAAGTGGGAAGTGGGGAGGG + Intronic
1023557294 7:41436576-41436598 AAGGAAGGGCAGAGTGGTGAGGG + Intergenic
1023740752 7:43278627-43278649 ACTGGAGTGGAGAGAGAGGAGGG - Intronic
1023968661 7:44976642-44976664 CCGGCAGGGGAGAGTGGGGCAGG - Exonic
1024275148 7:47671397-47671419 ACGGCGGTGGAGTGAGGGGAGGG + Intergenic
1024565493 7:50676748-50676770 ACGGTAGTGCAGAGGGGGTATGG + Intronic
1024999564 7:55303700-55303722 AAGGAAGAGGAGGGAGGGGAAGG + Intergenic
1025206648 7:56996882-56996904 ACGGCAGGGGAGAGTTGGGGAGG - Intergenic
1025217413 7:57070363-57070385 AGGGCAGTGAAGAGAGGGGAAGG + Intergenic
1025246278 7:57319893-57319915 ACAGAAGAGGATAGTGGGGATGG + Intergenic
1025628329 7:63244013-63244035 AGGGCAGTGAAGAGAGGGGAAGG + Intergenic
1025653937 7:63500102-63500124 AGGGCAGTGAAGAGAGGGGAAGG - Intergenic
1026275167 7:68870100-68870122 GAAGAAGTGGAGAGAGGGGAGGG + Intergenic
1026370221 7:69691419-69691441 AGGGAAGTGGAGGATGGGGGTGG - Intronic
1026833495 7:73623809-73623831 TCCAGAGTGGAGAGTGGGGATGG + Intronic
1027374555 7:77537241-77537263 ACGGAGGAGGAGGGCGGGGAAGG + Intergenic
1029374504 7:100169861-100169883 AAGGAAGTTGGAAGTGGGGAGGG - Exonic
1029537951 7:101166787-101166809 ACGGAAATGGGGAGGGGGCAGGG + Intergenic
1029707077 7:102281809-102281831 AAGGAGGGGGTGAGTGGGGATGG - Intronic
1031175347 7:118341742-118341764 AAGGATGTGGAGAATTGGGAAGG + Intergenic
1032624331 7:133573625-133573647 AGGGGAGGGGAGAGAGGGGAAGG - Intronic
1033120861 7:138665108-138665130 AGGGAGGTGGCGAGTGGGGGCGG - Intronic
1033146697 7:138877129-138877151 ATGGAGGTGGGGAGCGGGGAGGG - Intronic
1033317290 7:140308076-140308098 ACCTAAGTGGAGAGAGAGGAGGG - Intronic
1033523436 7:142185827-142185849 ACAGAAGCAGAGATTGGGGAAGG - Intronic
1033825657 7:145186878-145186900 AGGGAGGTGGAGGGAGGGGAAGG - Intergenic
1034368553 7:150572965-150572987 ACGGAAGTGGAGAGTAAGGATGG + Exonic
1035047808 7:155980799-155980821 GCGACAGTGGAGAGCGGGGAGGG + Intergenic
1035047837 7:155980919-155980941 CCGAGAGTGGAGAGTGGGGAGGG + Intergenic
1035047849 7:155980964-155980986 CCAAGAGTGGAGAGTGGGGAGGG + Intergenic
1035112021 7:156491178-156491200 AGGGTGGTGGAGAGTGGTGAGGG - Intergenic
1035454471 7:158998903-158998925 ACGCACGTGGGGAGTGTGGAGGG - Intergenic
1036074043 8:5474887-5474909 GTAGGAGTGGAGAGTGGGGAAGG - Intergenic
1036561786 8:9904891-9904913 AAGGGAGTAGAGAGTGGAGATGG - Intergenic
1036678170 8:10851942-10851964 AGGGAAGGGGAGCGCGGGGAAGG + Intergenic
1037541512 8:19876392-19876414 AAGGGAGTGGAGAGTGAAGAGGG - Intergenic
1038061276 8:23916172-23916194 AAGGTAGTGGGGAGTGGAGAAGG - Intergenic
1038136359 8:24790558-24790580 TCGGAGCTGGAGAATGGGGAGGG - Intergenic
1039503176 8:38032557-38032579 TGGGAAGTGGGGAGTGGGCAGGG + Intronic
1039755223 8:40515722-40515744 AGGGTGGTGGGGAGTGGGGAGGG - Intergenic
1040519171 8:48160389-48160411 AAGGAGGTGGTGAGTGGGGAGGG + Intergenic
1040629265 8:49190808-49190830 AAAGAAAGGGAGAGTGGGGAGGG - Intergenic
1040629346 8:49191690-49191712 TCGGAAGTGGAGAGGCTGGAAGG + Intergenic
1040735867 8:50508059-50508081 AGGGGAGTGGGGAGTGGGGAGGG - Intronic
1040983126 8:53266260-53266282 ATGGGTGTGGGGAGTGGGGAAGG - Intergenic
1041387188 8:57317053-57317075 TGGGAAGGGGAGAGTAGGGATGG + Intergenic
1041547507 8:59062185-59062207 AGGGAAGTTGAGGGTGGAGAAGG + Intronic
1042063613 8:64848602-64848624 ACGGAAGGGGAGAGGAGGGGAGG + Intergenic
1042389048 8:68211832-68211854 AAGGAAGTGGAAAGTGGGAGAGG + Intronic
1042444580 8:68869223-68869245 AAAGAAGTGGAGAAAGGGGAAGG - Intergenic
1043609625 8:82046001-82046023 ACTGAAGGGGAGATGGGGGAGGG - Intergenic
1044638722 8:94355630-94355652 ACGGAAATGGATGGTGGTGATGG + Intergenic
1045777675 8:105824750-105824772 AGAGAAGGTGAGAGTGGGGAAGG + Intergenic
1047011912 8:120681772-120681794 ACCTATGTGGGGAGTGGGGAGGG - Intronic
1047300777 8:123612107-123612129 AGGGGAGGGGAGAGAGGGGAGGG - Intergenic
1047414678 8:124654374-124654396 ACAGAGGTGGAGAGAGTGGATGG - Intronic
1047489494 8:125362944-125362966 AGGGAAGTGGAGAGTGAGGTGGG - Intronic
1047582546 8:126232124-126232146 AAGGAAGTGGGGAGAGGAGAAGG + Intergenic
1048345553 8:133572118-133572140 ACGGAGGCGCAGAGTCGGGAGGG - Intergenic
1048509315 8:135048252-135048274 GTGGAAGTGGAGTGTGAGGAAGG - Intergenic
1049254344 8:141605816-141605838 AGGGAAGAGGAGGGTGGGGCGGG - Intergenic
1049384868 8:142338131-142338153 GCAGAACTGGAGGGTGGGGATGG - Intronic
1049440492 8:142607302-142607324 AGGGGAGTGGAGGGTGGGGAGGG + Intergenic
1050985453 9:12076601-12076623 AGGGGAGAGGAGAGTGGAGAGGG - Intergenic
1052058357 9:23928334-23928356 AGGGAAGGGGAGAGTGGGCAGGG - Intergenic
1052594007 9:30536120-30536142 ATGGGAGGGGAGGGTGGGGAGGG - Intergenic
1053192823 9:36087768-36087790 ACGGAAATGGAGATTGTTGATGG + Exonic
1055514904 9:77024138-77024160 AACGAAGTGGAGACTGGAGAAGG + Intergenic
1056366745 9:85912561-85912583 CAGGAAAGGGAGAGTGGGGAAGG + Intergenic
1056814075 9:89788574-89788596 ACTACAGTGGAAAGTGGGGAGGG + Intergenic
1057450575 9:95155293-95155315 ACGGAAGGGGAGAGGAGGGGAGG + Intronic
1057644495 9:96860044-96860066 AGGGGAGGGGAGAGTGGGAAGGG + Intronic
1059202845 9:112434113-112434135 GCTGAAATGGAGGGTGGGGAAGG + Intronic
1059354238 9:113687101-113687123 AGGGAGGAGGAGGGTGGGGAAGG + Intergenic
1059542457 9:115144189-115144211 AGGGAAGAGAAGAGAGGGGAAGG - Intronic
1060121865 9:120999036-120999058 ACAGCAGGGGAGGGTGGGGAAGG + Intronic
1060123933 9:121023899-121023921 ACAGAAGTGGAGGTGGGGGATGG + Intronic
1060397520 9:123326576-123326598 AGGAGAGAGGAGAGTGGGGAGGG - Intergenic
1060432686 9:123564023-123564045 ACGGAACTGCAGAGGAGGGAGGG + Intronic
1060692510 9:125676675-125676697 ATGGAAATGGACAGTGGTGACGG + Intronic
1060852548 9:126889592-126889614 AGGGAAGGGGAGAGAGGGAATGG - Intergenic
1060889386 9:127178307-127178329 ACAGAAGTGGCAAGTGGGCAGGG + Intronic
1060949072 9:127589334-127589356 AGGGAAGGAGAGAGGGGGGAGGG + Intergenic
1061398654 9:130356757-130356779 ACAGAGGTGGACAGTGGAGATGG - Intronic
1061433612 9:130546810-130546832 AGGGCGGTGGAGAGTGGGGGAGG + Intergenic
1061797028 9:133091699-133091721 ATGGAAATAGAGAGTGGTGATGG - Intergenic
1062362622 9:136194797-136194819 AGGGGAGGGAAGAGTGGGGAGGG - Intergenic
1062447193 9:136599905-136599927 AGGGGAGTGGGTAGTGGGGAGGG + Intergenic
1062551626 9:137090073-137090095 GGGGGAGTGGAGACTGGGGATGG + Intronic
1203366928 Un_KI270442v1:267114-267136 ACGGTTGTGGAGTGGGGGGAGGG + Intergenic
1185537258 X:872678-872700 AGGGAAGGGGAGAGGAGGGAAGG - Intergenic
1186112210 X:6270409-6270431 ACGGATGTGGGGTGGGGGGATGG + Intergenic
1186178924 X:6954001-6954023 AGGGAAGTGGGAAGTGGGAAAGG - Intergenic
1186224160 X:7379326-7379348 ATTGAGGTGGAGAGTGGGGAGGG + Intergenic
1186327818 X:8498749-8498771 GGGGGAGGGGAGAGTGGGGAGGG + Intergenic
1186698622 X:12065526-12065548 ATGGAAGTGGAGAGGGAGGAAGG - Intergenic
1187906943 X:24075711-24075733 AAGGAAGTAGATAGTGGGTAGGG - Intronic
1188086250 X:25905245-25905267 ACGGAGATGGAGAGAGGGGGAGG - Intergenic
1188368482 X:29339445-29339467 AGGGAATTGAAAAGTGGGGAAGG + Intronic
1188534496 X:31181530-31181552 ATGGGGGTGGGGAGTGGGGAAGG - Intronic
1188955826 X:36434213-36434235 AGGGAAGGGAAGAGAGGGGAAGG + Intergenic
1189235099 X:39480871-39480893 AGGGGAGTGGAGAGGGGAGATGG + Intergenic
1189286103 X:39853589-39853611 GGGGAAGAGGAGGGTGGGGAAGG + Intergenic
1190330066 X:49230422-49230444 TCGGAGGTGGAGGGTGGGGGTGG - Intronic
1191790957 X:64971395-64971417 TGGGAGGTGGAGAGTGGGGCAGG + Intronic
1191929352 X:66351944-66351966 TGGGATGGGGAGAGTGGGGAGGG + Intergenic
1192467241 X:71366195-71366217 GGGGAAGTGGGGAGAGGGGAGGG - Intergenic
1193380367 X:80809900-80809922 AAGGGGGTGGAGAGAGGGGAGGG + Intergenic
1193400564 X:81037112-81037134 ACGGAAGGGAAGTGGGGGGAAGG - Intergenic
1193896655 X:87122169-87122191 ACTGTAGTGGGGTGTGGGGAGGG + Intergenic
1194942426 X:100027094-100027116 ACGGAAGGGAAGAGAAGGGAAGG + Intergenic
1195067468 X:101250587-101250609 ATGGAACTGGGGAGTGGGGGAGG + Intronic
1195312881 X:103650339-103650361 GGGGAGGTGGGGAGTGGGGATGG + Intergenic
1196222856 X:113132178-113132200 ACAGTAGTAGGGAGTGGGGAGGG + Intergenic
1197540474 X:127753692-127753714 AATGAAATGGAAAGTGGGGAAGG - Intergenic
1198340586 X:135709712-135709734 AGGGAAGTGGAGGGGAGGGAGGG + Intergenic
1198342668 X:135730349-135730371 AGGGAAGTGGAGGGGAGGGAGGG + Intergenic
1198345321 X:135752946-135752968 AGGGAAGTGGAGGGGAGGGAGGG - Intergenic
1198373193 X:136011738-136011760 AGGAAATTGGAGGGTGGGGACGG + Intronic
1199347568 X:146760004-146760026 ATGAAACTGGAGAGTGGGCACGG - Intergenic
1200010111 X:153114390-153114412 ACGCACGTGGTGAGTGGGGCTGG - Intergenic
1200029489 X:153285532-153285554 ACGCACGTGGTGAGTGGGGCTGG + Intergenic
1200181770 X:154155223-154155245 ATGGAGGTGGAGAGTGGGTCAGG - Intronic
1200187419 X:154192337-154192359 ATGGAGGTGGAGAGTGGGTCAGG - Intergenic
1200193068 X:154229477-154229499 ATGGAGGTGGAGAGTGGGTCAGG - Intronic
1200198823 X:154267281-154267303 ATGGAGGTGGAGAGTGGGTCAGG - Intronic
1200383378 X:155864113-155864135 AGGGTAGTGGGGAGTGGGGATGG - Intergenic
1200780365 Y:7210128-7210150 ACTGAAGTGGGGAGTGGGCCTGG - Intergenic
1200827170 Y:7657692-7657714 ACTGAAATGGGGAGTGGGGGTGG - Intergenic
1201261252 Y:12161001-12161023 ACAGAGGTGGAGAGAAGGGAGGG - Intergenic
1201338357 Y:12904501-12904523 AGGGAAGTTGAGGGTGGGTAAGG + Intronic
1201341811 Y:12942355-12942377 ATGGAAGAGGAGAGTGGCCAGGG + Intergenic
1201434196 Y:13939300-13939322 AGTGGAGGGGAGAGTGGGGAGGG - Intergenic
1201452965 Y:14136128-14136150 AGGGAAGTGGAGAGGGAGGGAGG - Intergenic
1201552553 Y:15233976-15233998 CGGGAAGTAGAGAGTGGGGATGG + Intergenic
1201593641 Y:15641935-15641957 ATTGAGATGGAGAGTGGGGAGGG + Intergenic
1201955757 Y:19620817-19620839 ATGGAAGTTGAGAAGGGGGATGG - Intergenic