ID: 933215826

View in Genome Browser
Species Human (GRCh38)
Location 2:79629074-79629096
Sequence AGGGACGGAAGTGGAGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 839
Summary {0: 1, 1: 0, 2: 4, 3: 62, 4: 772}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933215826_933215836 12 Left 933215826 2:79629074-79629096 CCCCACTCTCCACTTCCGTCCCT 0: 1
1: 0
2: 4
3: 62
4: 772
Right 933215836 2:79629109-79629131 TTCCCCTATGCCAGCCATATTGG 0: 1
1: 0
2: 2
3: 7
4: 113
933215826_933215841 23 Left 933215826 2:79629074-79629096 CCCCACTCTCCACTTCCGTCCCT 0: 1
1: 0
2: 4
3: 62
4: 772
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933215826 Original CRISPR AGGGACGGAAGTGGAGAGTG GGG (reversed) Intronic
900193216 1:1360159-1360181 AGGGACGGCCCTGCAGAGTGAGG - Intronic
900507149 1:3035378-3035400 AGGGAGGGAAGGAGAGAGGGAGG - Intergenic
900818446 1:4868352-4868374 AGGGAAGGAAGAGAAGAGAGAGG - Intergenic
900932843 1:5747660-5747682 AGGGAGGGAGGAGGAGAGGGAGG + Intergenic
901168785 1:7239094-7239116 AGGGAAGGAATGGGAGAGTATGG - Intronic
901401269 1:9016630-9016652 AGGGAGGGAAGAAGAGAGAGAGG + Intronic
902455940 1:16534289-16534311 AGGGGCGGCAGTGGGGAGGGTGG - Intergenic
902496229 1:16873622-16873644 AGGGGCGGCAGTGGGGAGGGTGG + Intronic
902628319 1:17689515-17689537 AGGGAGGGAAGAAGAGAGGGAGG - Intronic
902628330 1:17689547-17689569 AGGGAGGGAAGAAGAGAGGGAGG - Intronic
902628343 1:17689583-17689605 AGGGAGGGAAGAAGAGAGGGAGG - Intronic
902691539 1:18112941-18112963 AGGAAAGGAGGTGGAGAGGGAGG - Intronic
902783895 1:18720904-18720926 AGGGACGAAGGTGCAGAGAGAGG + Intronic
902933884 1:19750564-19750586 AAGGAGGGAAGAGGAGAGAGAGG - Intronic
903725009 1:25434953-25434975 AGGGAAGGGAGTGGAAAGTATGG - Intronic
904011032 1:27390830-27390852 AGGGGCGGGAGCAGAGAGTGAGG - Intergenic
904053862 1:27657471-27657493 AGGGAGGGAAGGGGAGGGGGCGG - Intergenic
904497089 1:30893131-30893153 AGGGAGGGAAGTGCTGAGGGTGG + Intronic
905354599 1:37372635-37372657 AGGGGAGGAGGTGGAGGGTGGGG - Intergenic
905772329 1:40646342-40646364 AGGGAAGGTGGTGGAGACTGTGG + Intronic
906141846 1:43538456-43538478 AGTGACAGAAGTGGAGAGAAGGG + Intronic
906239938 1:44236645-44236667 AGGGAAGGGCGTGGAGTGTGGGG + Intronic
906262541 1:44405460-44405482 AGGGAAGCAGGCGGAGAGTGTGG - Exonic
906627662 1:47338524-47338546 AGGGAGGGAAGGAGAGAGGGAGG - Intronic
906627669 1:47338544-47338566 AGGGAGGGAAGGAGAGAGGGAGG - Intronic
906627676 1:47338564-47338586 AGGGAGGGAAGGAGAGAGGGAGG - Intronic
906707751 1:47907066-47907088 AGGGAAGGAAGTGGGGAGTCTGG + Intronic
906947822 1:50310486-50310508 AAGGATGGTAGAGGAGAGTGGGG - Intergenic
906969393 1:50495249-50495271 AGGGAGGGCAGTGGGGTGTGGGG - Intronic
907050541 1:51327059-51327081 TGGGAGGGAAGGGGAGAGTGGGG - Intronic
907237318 1:53061622-53061644 AGGGATGGGAGTGGAGGGTGGGG + Intergenic
907255130 1:53173405-53173427 AGGGAGGGGAGGGGAGAGGGAGG - Intergenic
907322846 1:53616635-53616657 ATGGAGGGAGGTGGAGAGAGGGG - Intronic
908468903 1:64422875-64422897 AGGGATGGAAGTGGGGAGAGGGG + Intergenic
908848168 1:68346199-68346221 AGTGAGGGAAAAGGAGAGTGAGG - Intergenic
908877272 1:68691759-68691781 AGGGAGGGAAGAGGAGGGTTTGG - Intergenic
909102685 1:71369665-71369687 AGGGAGGGAGAAGGAGAGTGAGG - Intergenic
909601361 1:77464767-77464789 ATGGACTGAAGTGGAGAGACTGG + Intronic
910490455 1:87764020-87764042 AGGGAGGAAAGGGGAGAGGGAGG - Intergenic
910725724 1:90336600-90336622 TGGGCTGGAAGTAGAGAGTGAGG + Intergenic
911038792 1:93575981-93576003 AGGGTCGGAAGTGCAGAGGACGG + Intronic
911741628 1:101392537-101392559 GGAAACGGAAGTGGAGAGGGAGG - Intergenic
911767923 1:101701659-101701681 AGGGAGGGGAGTGGGGAGGGGGG - Intergenic
912228672 1:107766695-107766717 AGAGAGGGAAAAGGAGAGTGGGG + Intronic
912512478 1:110198575-110198597 TGGGACTGAAGAGGGGAGTGAGG - Exonic
912738529 1:112172327-112172349 AGAGAGGGAATGGGAGAGTGAGG - Intergenic
913004912 1:114620030-114620052 AGGGAAGGAAAGGAAGAGTGGGG + Intronic
913148063 1:116011782-116011804 GGGGATGCAAGTGGGGAGTGGGG + Intronic
914713789 1:150237675-150237697 GGGGAAGGAAGTGGAAAGTGGGG + Intergenic
914754716 1:150556382-150556404 AGAGACGGAAGTGGAAGGGGAGG - Intronic
914900233 1:151707653-151707675 GGGGAGGGGAGAGGAGAGTGGGG + Intronic
915117088 1:153607950-153607972 GGGGAGGGAAGGGGAGAGGGAGG + Intronic
915453108 1:156020633-156020655 AGGGGCTGGACTGGAGAGTGGGG - Intronic
915515926 1:156412746-156412768 GGGAACGGAAGCGGAGGGTGAGG - Intronic
915521872 1:156450477-156450499 AGGGAGGGAAGGAGAGAGAGAGG + Intergenic
916088105 1:161285821-161285843 AGGGAGGGGAGGGGAGAATGTGG - Intergenic
916304861 1:163318873-163318895 ATTGACAGAAGTGGAGAGGGAGG + Intronic
917683095 1:177387720-177387742 AGGAAGGGTAGTGGGGAGTGGGG - Intergenic
918242658 1:182634150-182634172 AGGGAGATAAGGGGAGAGTGTGG + Intergenic
918305223 1:183239997-183240019 AGGGACGGAAGGAGAGATAGGGG - Intronic
918741406 1:188135684-188135706 AGGCAAGGAAGGGGAGAGAGTGG - Intergenic
919756169 1:201067422-201067444 TGGGAAGGAGGTGGAGAGGGAGG - Intronic
919785430 1:201255210-201255232 AGGGAAGGAAGCGGAAAGAGGGG - Intergenic
919943518 1:202304320-202304342 GGGGAGGGGAGTGGAGAGAGAGG - Intronic
920116352 1:203624467-203624489 AGGGAGGGAAGGGAAGAGGGAGG + Intergenic
920309929 1:205043059-205043081 GGGGACGGAAGTGGGGTGGGAGG + Intergenic
921168973 1:212528763-212528785 AGTGATGGAAGGGCAGAGTGAGG - Intergenic
921266881 1:213428390-213428412 AGGGAGGGAGGTGGAGAGAGAGG - Intergenic
921771899 1:219050457-219050479 AGGGAGGGAAGGAGAGAGGGAGG + Intergenic
921994909 1:221407790-221407812 AGGGAAGGAAGAGATGAGTGTGG - Intergenic
922534957 1:226372871-226372893 AGGGACGGAGGTGGAGGGAAAGG - Intronic
922544535 1:226446033-226446055 AGGGACGTACTTGGAGAGAGAGG - Intergenic
922791156 1:228311829-228311851 TGGGAGGGAGGAGGAGAGTGTGG + Intronic
922984375 1:229854713-229854735 AGGGAGGGAAGGAGAGAGGGAGG - Intergenic
923001186 1:230007531-230007553 AGGGCCGGAAGGGGAGAGCTGGG + Intergenic
923300472 1:232635554-232635576 AGGGAGGGAAGAAGAGAGGGAGG + Intergenic
923569580 1:235101634-235101656 AGGTAGGGAAGGGGAGAGGGAGG + Intergenic
924539875 1:244970680-244970702 AGGGAGGGAAGAGGGGAGAGAGG - Exonic
924615478 1:245608450-245608472 GAGGACGGAAGTGCAGAGAGAGG - Intronic
1062760282 10:12148-12170 AGGGGCGTTAGGGGAGAGTGAGG + Intergenic
1062922825 10:1292969-1292991 AGGGAGGGAAGGAGAGAGAGAGG + Intronic
1062922834 10:1292995-1293017 AGGGAGGGAAGGAGAGAGGGAGG + Intronic
1062923605 10:1298044-1298066 AGGGAGGGAAGTGGAAAGCAAGG - Intronic
1062937607 10:1399971-1399993 AGAGACAGAAATGGAAAGTGTGG - Intronic
1062958003 10:1552709-1552731 AGGGAGGGAAGGGGAGAGGAGGG + Intronic
1062958010 10:1552728-1552750 AGGGAGGGAAGGGGAGAGAAGGG + Intronic
1063187929 10:3667070-3667092 AGGGAAGGAAGTGGAGAGAAAGG - Intergenic
1063193330 10:3718072-3718094 AAGGAGGGAAGTGGGGAGGGAGG + Intergenic
1063573566 10:7240144-7240166 AGGGACAGAGGTGGGGAATGTGG - Intronic
1064014470 10:11761842-11761864 AGGGAAGGAAGGAGAGAGGGAGG - Intronic
1064405537 10:15059096-15059118 AGGGAGGGAAGGAGAGAGGGAGG - Intronic
1064405544 10:15059116-15059138 AGGGAGGGAAGGGGGGAGGGAGG - Intronic
1064405553 10:15059132-15059154 AGGGAGGGAAGGGGAGAGGGAGG - Intronic
1064557934 10:16566412-16566434 AGAGAGGGAAGTGGAGCATGGGG + Intergenic
1065267492 10:23992831-23992853 AGGGACACAAATGGAGTGTGAGG + Intronic
1065728749 10:28691646-28691668 AGGGAGGGAAGGAGAGAGGGAGG - Intergenic
1065885380 10:30072162-30072184 AGGGAGGGAAGGAGAGAGGGAGG + Intronic
1066005998 10:31146635-31146657 AGGGGAGGAAGTGGAGAGGCAGG + Intergenic
1066443503 10:35460972-35460994 AGGGAGGGATGTGAAGAGTGGGG + Intronic
1068307933 10:55238992-55239014 AGGAAGGGTAGTGGGGAGTGGGG - Intronic
1068311885 10:55289452-55289474 AGGAATGGAAGGAGAGAGTGAGG + Intronic
1069624905 10:69861540-69861562 AGAGACGGAGGTGGAGAGGCTGG - Intronic
1069837162 10:71316791-71316813 AGGGAAGGAACAGGAGAATGGGG - Intergenic
1070145907 10:73773061-73773083 AGGGAAGGAAAAGGAGAGGGCGG + Intronic
1070771223 10:79083411-79083433 AGTGAGGGAAGGAGAGAGTGGGG + Intronic
1070914649 10:80145074-80145096 AGGCATGGAAGTGGAGTGAGAGG - Exonic
1070986862 10:80696750-80696772 AGGGACAGAAAAGGAAAGTGAGG - Intergenic
1071081301 10:81815211-81815233 AGGGAAGGGAGTGGAGAAGGTGG + Intergenic
1071412837 10:85413655-85413677 AGGTGCAGGAGTGGAGAGTGAGG - Intergenic
1072694591 10:97593832-97593854 AGGGAGGGAAGTGCAGTGTCTGG + Intronic
1073169339 10:101490216-101490238 AGGGAGGGAAGGAGGGAGTGAGG - Intronic
1073243662 10:102074493-102074515 AGGGAAGGAAGGGTAGACTGAGG + Intergenic
1073582831 10:104683382-104683404 AGGAACAGAAGTGGGCAGTGAGG - Intronic
1074189937 10:111127007-111127029 AGGGATGGCAGGGCAGAGTGGGG - Intergenic
1074828000 10:117228499-117228521 AGGGAAGGAAGGGGAGAAGGAGG - Intergenic
1075674773 10:124288837-124288859 AGGGAGGGAAGAGGAGCGGGGGG + Intergenic
1076303858 10:129449488-129449510 AGGGAGGGAAGGAGAGAGGGAGG + Intergenic
1076913036 10:133401881-133401903 AAGGAAGGGAGTGGAGGGTGGGG - Intronic
1077061003 11:617855-617877 AGGGACAGATGTGGAGACGGAGG - Intronic
1077121099 11:908875-908897 AGGGAAGGAAGAGGAAAGGGTGG + Intronic
1077504316 11:2923043-2923065 TGGGTCGGAAGTGGGGACTGGGG - Intronic
1077984242 11:7334350-7334372 ATGGACAGGAGGGGAGAGTGAGG + Intronic
1078099376 11:8320750-8320772 AATGGCGGAAGAGGAGAGTGGGG + Intergenic
1078143227 11:8706531-8706553 AGAGACCTAAGTGGTGAGTGGGG - Intronic
1079364093 11:19793943-19793965 AGGGACTGAAGTGGACACTGTGG - Intronic
1079368234 11:19827960-19827982 AGGGGAGGAAGGGGAGGGTGGGG + Intronic
1079501476 11:21105806-21105828 AGGGAGGGAAGGGGAGAGGAGGG - Intronic
1079501486 11:21105830-21105852 AGGGAAGGGAGGGGAGAGAGGGG - Intronic
1080389850 11:31834798-31834820 AGGGAAGGAAGTAGGGAGGGAGG - Intronic
1080814055 11:35736846-35736868 AAGGAAGGGAGTGAAGAGTGAGG - Intronic
1081082973 11:38766513-38766535 AGGGAGGGAAAGGAAGAGTGAGG + Intergenic
1081683275 11:45023684-45023706 AGGGTCTGAAGTGGACACTGGGG - Intergenic
1082885152 11:58074241-58074263 TGGAGAGGAAGTGGAGAGTGTGG - Intronic
1082915676 11:58433894-58433916 AGGGTAGGAAGTGGGGAGGGGGG + Intergenic
1083224641 11:61277020-61277042 AGGGAAGGAAGGAGAGAGGGAGG + Intronic
1083332889 11:61907233-61907255 AGGGAGGGAAGGGAAGGGTGGGG - Intronic
1083755642 11:64790281-64790303 AGGGAAGGAATTGGTGAGTGGGG + Intronic
1084056742 11:66638840-66638862 AGTGACGGGTGTGGAGACTGCGG - Intronic
1084191408 11:67500567-67500589 AGGAATGGGAGTGGAAAGTGGGG + Intronic
1084313217 11:68328669-68328691 AGGGACGGAGGTGCAGACTGCGG - Intronic
1084352010 11:68608857-68608879 AGGGAAAGGAGTGGAGAATGGGG + Intronic
1084455773 11:69267454-69267476 AGGGACGGAGGGAGAGAGGGAGG + Intergenic
1085076447 11:73597091-73597113 AGGGATGGAAATGGAGTGTGGGG - Intronic
1085365579 11:75939743-75939765 AGGGAGGAAAAAGGAGAGTGTGG + Intronic
1085603929 11:77880592-77880614 TGGGATGGAATGGGAGAGTGTGG - Intronic
1085713113 11:78848128-78848150 AGGGAGGGAAGGAGGGAGTGAGG - Intronic
1085998215 11:81947976-81947998 AGGGAGGGAAGCGGGGGGTGGGG + Intergenic
1086461939 11:87014660-87014682 AAGGATGGAAGAGGAGAGTAGGG - Intergenic
1087008258 11:93489755-93489777 AGGGACAGCTGTGGAGAGAGGGG - Intronic
1087501137 11:98955924-98955946 AGGGAGGGAAGTAGAGAGGAAGG - Intergenic
1087624733 11:100583690-100583712 AGAGACGGAAGGTGAGAGGGTGG - Intergenic
1087769812 11:102195857-102195879 GGGGAAAGAAGTGCAGAGTGTGG + Intronic
1088454991 11:110024081-110024103 GGGGAGGGAAGTGGGGAGGGAGG + Intergenic
1088596415 11:111444265-111444287 AGGGAGGGAAGAGGAGAGAAGGG + Intronic
1089010772 11:115129926-115129948 AGGGACGAAAATGGAGTGGGAGG + Intergenic
1089213868 11:116823714-116823736 AGTGGCGGATGTGGAGACTGGGG - Intergenic
1089442244 11:118527426-118527448 AGGGAGGGACGTGGTGAGGGTGG - Intergenic
1089498844 11:118921491-118921513 GGGTGGGGAAGTGGAGAGTGAGG + Intronic
1090062695 11:123477618-123477640 AGGGAGGGGAGGGGAGAGAGAGG - Intergenic
1090584043 11:128190826-128190848 ATGGAGTCAAGTGGAGAGTGGGG - Intergenic
1091172594 11:133531709-133531731 AGGGAGGGAGGAGGAGAGTGGGG + Intronic
1091361039 11:134978602-134978624 AGGGAGGGAAGGGCAGAGGGAGG + Intergenic
1091382876 12:74114-74136 AAGGACAAAAGTGGAGAGTGAGG + Intronic
1091653880 12:2330157-2330179 AGGGAGGGAAGGTGAGAGGGCGG - Intronic
1091678204 12:2506867-2506889 AGAGCCTGAAGTGGAGAATGAGG + Intronic
1091785004 12:3238027-3238049 AGGGAAGGAAGAGGAGAGGAAGG - Intronic
1091816161 12:3439894-3439916 AGGGCCAGAAATGGAGAGGGTGG + Intronic
1091841984 12:3628014-3628036 AGGGAGGGAAGGAGAGAGGGAGG - Intronic
1093098464 12:14998941-14998963 AGTGAGGGAGGTGGAGAGAGAGG + Intergenic
1093181752 12:15974901-15974923 AGGGAGGGAAGGAGAGAGAGAGG - Intronic
1093310810 12:17581201-17581223 AGGGAAGGAAGGAGAGAGGGAGG + Intergenic
1094691308 12:32772044-32772066 AGGGACGGAAGGAGGGAGGGAGG + Intergenic
1095385560 12:41645937-41645959 AGGGATGGAAGGAGAGAGGGAGG + Intergenic
1095459444 12:42426899-42426921 TGGGAAGGAAGTGGAGGGGGTGG + Intronic
1096847090 12:54413305-54413327 GGGGACGGAAGAGGAGAGTGAGG + Intronic
1097265687 12:57743307-57743329 GGGGATGGAGGTGGGGAGTGAGG + Intronic
1097816549 12:64080695-64080717 AGGGAAGGAAGAAGAGACTGGGG - Intronic
1097888522 12:64754519-64754541 AGGGAGGAAAAGGGAGAGTGAGG + Intronic
1097904058 12:64902228-64902250 AGGGAGGGAAGTAGGGAGGGAGG - Intergenic
1097924083 12:65108629-65108651 AAGGAAGGCAGTGGAGAGGGAGG - Intronic
1097970790 12:65631092-65631114 AGGGAAGGAAGGGGAGAGTGTGG - Intergenic
1098103414 12:67043116-67043138 AGGGACTGCAGGCGAGAGTGAGG + Intergenic
1098163131 12:67666715-67666737 AGGGAGGGAGGGGGAGAGGGAGG + Intergenic
1098384226 12:69901837-69901859 TGGGAGGGTAGTGGGGAGTGGGG - Intronic
1098430454 12:70413878-70413900 ACTGAGGGAAGTGGAAAGTGGGG + Intronic
1098769676 12:74537781-74537803 AGGGGCGGAAGCGGAGAGGCGGG + Intergenic
1098918924 12:76285211-76285233 AGGGTAGGAAGTGGAAACTGGGG + Intergenic
1098951030 12:76640559-76640581 ATGTATGTAAGTGGAGAGTGTGG - Intergenic
1100292546 12:93231620-93231642 AGGGAGGGAAGGTGAGAATGGGG - Intergenic
1100802969 12:98252396-98252418 AGGGAGGGAGGTAGAGAGAGTGG - Intergenic
1101421986 12:104557724-104557746 AGGGAAGGAAGTGGGAAGAGAGG + Intronic
1101952427 12:109187100-109187122 AAGGAGGGAAGAGGGGAGTGAGG + Intronic
1102498021 12:113332899-113332921 AGAAAGGGAAGTGGAGAGTAAGG - Exonic
1102530472 12:113542805-113542827 AGGGAGGGAGGGGGAGAGGGAGG - Intergenic
1102645257 12:114399642-114399664 AGGGACGGAGGGAGAGAGGGGGG + Intronic
1102648648 12:114420471-114420493 AGAGAGGGAAGTGGAGAGACTGG - Intergenic
1102778944 12:115546782-115546804 AGGGAAGGAGGAGGAGAGTGAGG - Intergenic
1102991892 12:117321933-117321955 AGGGAAGGAAGGAGAGAGGGAGG - Intronic
1102991898 12:117321953-117321975 AGGGAAGGAAGGAGAGAGGGAGG - Intronic
1102991909 12:117321993-117322015 AGGGAAGGAAGGAGAGAGGGAGG - Intronic
1103205063 12:119122328-119122350 AAGGAAGGAAGGGGAGAGGGAGG + Intronic
1103346488 12:120254246-120254268 ATGGGTGGAAGTGGAGAATGGGG + Intronic
1104084741 12:125464045-125464067 AGGGAGGGATCTGGAGAGGGGGG - Intronic
1104668893 12:130667120-130667142 AGGGAAGGAAGGAGAGAGGGAGG + Intronic
1105471426 13:20698323-20698345 GGGGACGGAAGGGGAGAGAAGGG + Intergenic
1105645407 13:22312700-22312722 AGGGAGGGAAGAAGAGAGGGAGG - Intergenic
1105792205 13:23812601-23812623 AGCGAGGGACGGGGAGAGTGAGG - Intronic
1106222885 13:27761484-27761506 AGGGAGGGAAGTGGAGATGGTGG - Intergenic
1106232649 13:27833239-27833261 AGAGACGGAAGGTGAGGGTGGGG - Intergenic
1106568828 13:30908694-30908716 AGGGAAGGAAGTGGGGAGGGAGG - Intronic
1106616134 13:31329699-31329721 AGGGAATGAACTGGAGACTGTGG + Exonic
1106713282 13:32360972-32360994 ATGGAGGGAAATGGAGAGTTTGG + Intronic
1106866697 13:33972332-33972354 AGGGCTGGAAGTGGAGGTTGTGG - Intergenic
1107117596 13:36763590-36763612 AGGGACAGAAGTGAAGAGTCAGG - Intergenic
1107773600 13:43814160-43814182 AGGGAGGGAAGGAGAGAGGGAGG + Intergenic
1107949870 13:45452326-45452348 AGGAAAGGAAGTGAAGAGTAGGG - Intergenic
1108598710 13:51972406-51972428 GGGGCCGGAAATGCAGAGTGTGG - Intronic
1109070238 13:57756508-57756530 AGGGACAAAAGTGGAGAATAGGG + Intergenic
1109184845 13:59255694-59255716 AGAAAGGGAAGTGGGGAGTGAGG + Intergenic
1110123459 13:71911925-71911947 AGTGAGGGAACTGGAGAATGAGG - Intergenic
1110321457 13:74164908-74164930 GGGGAGGGTAGTGGAGAGTAGGG + Intergenic
1110833083 13:80053871-80053893 AGAGAGGGAAAGGGAGAGTGTGG + Intergenic
1110889796 13:80684728-80684750 AGGGAGGGAGGTAGGGAGTGAGG - Intergenic
1110901970 13:80835374-80835396 AGAGCAGGAAGAGGAGAGTGTGG + Intergenic
1112168597 13:96946826-96946848 GGGAAGGGGAGTGGAGAGTGTGG + Intergenic
1112603809 13:100883528-100883550 AGGGAAGGAAGAGAAGAGAGAGG - Intergenic
1113076268 13:106470721-106470743 AGGGACAGTAAGGGAGAGTGTGG + Intergenic
1113314438 13:109163487-109163509 AGGGAGGGAAGGAGGGAGTGGGG - Intronic
1113573910 13:111381534-111381556 AGGGAGGGCACTGGTGAGTGAGG + Intergenic
1113652525 13:112045693-112045715 AGGGACAGAAATGTAGAGGGAGG - Intergenic
1114301030 14:21378073-21378095 GGGGGTGGAAGTGGGGAGTGAGG + Intronic
1114301042 14:21378169-21378191 GGGGGTGGAAGTGGGGAGTGAGG + Intronic
1114559376 14:23579228-23579250 AGGGCCGGAAGTGGTGTTTGTGG + Intergenic
1114662187 14:24354184-24354206 AGGGAGGGAGGGGGAGAGGGAGG - Intergenic
1116217926 14:42044145-42044167 AGGGAGGGAAAGAGAGAGTGAGG + Intergenic
1116746751 14:48830086-48830108 AAGGAAGGAAGGGGAGAGAGGGG + Intergenic
1116806005 14:49494502-49494524 AGGGATGGAGGTGGGGAGAGAGG + Intergenic
1117325425 14:54664567-54664589 AGAGAAGGAAGTGGGGAGAGAGG - Intronic
1118413154 14:65503629-65503651 AGGGAGGGAAGGGCAGAGAGAGG - Intronic
1119217753 14:72882144-72882166 AGGGAAGGCAGTGCAGAGTCAGG + Intronic
1119437763 14:74609425-74609447 AGGTGGGGAAGTGGAGCGTGGGG - Intronic
1119997640 14:79271357-79271379 AGGGAGGGGAGGGGAGAGGGAGG - Intronic
1120517723 14:85490292-85490314 AAGGAAGGATGTGGAGAGGGAGG + Intergenic
1120615570 14:86699807-86699829 GGGGTTGGCAGTGGAGAGTGAGG - Intergenic
1121260348 14:92561356-92561378 AGGGAGGGAGGTGGATAGTGGGG - Intronic
1121355210 14:93207838-93207860 AGGGACCGAATGGGAGAGTCAGG + Intronic
1121576580 14:94993845-94993867 AGGAATGGAAGTGAAGTGTGTGG - Intergenic
1121682926 14:95809094-95809116 AGGCAGGGAAGTGTTGAGTGTGG - Intergenic
1121842101 14:97143178-97143200 AGGGATGAAAATGGACAGTGCGG + Intergenic
1121843497 14:97154151-97154173 AGGGAAGGAGGGAGAGAGTGAGG - Intergenic
1121916704 14:97842261-97842283 AGGGAGAGAAGAAGAGAGTGAGG + Intergenic
1122002053 14:98666924-98666946 AGGGAAGGAAGGAGAGAGGGAGG - Intergenic
1122873067 14:104650410-104650432 GGGGATGGAAGGAGAGAGTGGGG - Intergenic
1122930533 14:104931309-104931331 GGGGAAGGAAGGGAAGAGTGAGG + Intronic
1123075486 14:105665579-105665601 AGGGACAGATGGGGACAGTGTGG + Intergenic
1123090110 14:105738668-105738690 AGGGACAGGAGGGGAGAGCGTGG + Intergenic
1123090128 14:105738736-105738758 AGGGACAGGTGGGGAGAGTGTGG + Intergenic
1124212043 15:27771256-27771278 CGGGACCGCGGTGGAGAGTGGGG - Intronic
1125011484 15:34880866-34880888 TGGGACGGATGAGCAGAGTGGGG + Intronic
1125470553 15:39998499-39998521 TAGGACGAAAGTGAAGAGTGAGG + Intronic
1126417072 15:48428612-48428634 AGGGAAGGAAGGTGAGAGGGAGG - Intronic
1127007025 15:54582073-54582095 AGGGAAGGAAGGAGAGAGGGAGG + Intronic
1127340471 15:58038125-58038147 AGGGAAGGAAGTAGGGAGGGAGG - Intronic
1127490033 15:59453803-59453825 AGGGAGGCAAGAGGAGAGAGAGG + Intronic
1127664491 15:61132013-61132035 AGGGAGGGAAGGAGAAAGTGAGG - Intronic
1128513437 15:68327404-68327426 AGGGACAGAAGTTGAAAGAGAGG + Intronic
1128679662 15:69638953-69638975 AGGGATGGGGGTGGAGGGTGAGG - Intergenic
1129182355 15:73885281-73885303 AGGCACTGAAGTGGAGAAGGGGG + Intronic
1129634906 15:77305192-77305214 AGGGACGGAAGGAGGGAGGGAGG + Intronic
1129791121 15:78341205-78341227 ACGGACGCAAGTGCAGGGTGAGG + Exonic
1130484653 15:84391988-84392010 AAGGAAGGAGCTGGAGAGTGTGG + Intergenic
1130910418 15:88266733-88266755 AGGGACAGAAGAGAAGAGTGGGG - Intergenic
1131143912 15:89999923-89999945 AGGGAAGGAAGGGAAGAGGGAGG + Intergenic
1131450390 15:92534621-92534643 GGAGAGAGAAGTGGAGAGTGAGG - Intergenic
1131460009 15:92611189-92611211 AGGGAGGGAGGGAGAGAGTGAGG + Intergenic
1131460018 15:92611209-92611231 AGGGAGGGAAGTGGGGAAAGGGG + Intergenic
1131649883 15:94387160-94387182 AGGGAAGGAAGGAGAGAGGGAGG - Intronic
1131652736 15:94419451-94419473 AGGGAAGGAAAGGGAGAGTCAGG + Intronic
1131796985 15:96029156-96029178 AGGGAGGGAAGGAGAGAGGGAGG + Intergenic
1131894229 15:97008134-97008156 AGGGACAGGAGTGGGCAGTGGGG + Intergenic
1132719400 16:1308634-1308656 AGGGAGGGAATTAGTGAGTGAGG + Intergenic
1133417419 16:5617090-5617112 AGGGAGGGAAGGAGGGAGTGAGG - Intergenic
1133575766 16:7087579-7087601 AGGGAGGGAGGGGGAGAGAGAGG + Intronic
1133839305 16:9394157-9394179 AGGGAGGGAAGGAGAGAGGGAGG - Intergenic
1133846183 16:9455812-9455834 AGGGAAGGAAGAGGAGAGTCGGG - Intergenic
1134108104 16:11498570-11498592 GGGGTGGGAAGTGGGGAGTGAGG - Intronic
1134187932 16:12098991-12099013 AGGGTGGGAACTGGGGAGTGGGG + Intronic
1134871549 16:17656555-17656577 AGGGAGGGATGGAGAGAGTGAGG + Intergenic
1135200774 16:20436236-20436258 GGGGAGGGGAGAGGAGAGTGGGG - Intronic
1135313391 16:21422842-21422864 AGGGGCAGAGGAGGAGAGTGGGG - Intronic
1135366315 16:21855120-21855142 AGGGGCAGAGGAGGAGAGTGGGG - Intronic
1135445500 16:22516044-22516066 AGGGGCAGAGGAGGAGAGTGGGG + Intronic
1135784435 16:25336027-25336049 AGGGAGGGAAGGAGAGAGAGAGG - Intergenic
1135927721 16:26709934-26709956 AGGGACGGAAGGAGAGAAGGAGG + Intergenic
1136152538 16:28360562-28360584 AGGGGCAGAGGAGGAGAGTGGGG - Intronic
1136210544 16:28754719-28754741 AGGGGCAGAGGAGGAGAGTGGGG + Intronic
1136310056 16:29401544-29401566 AGGGGCAGAGGAGGAGAGTGGGG - Intronic
1136323502 16:29503347-29503369 AGGGGCAGAGGAGGAGAGTGGGG - Intronic
1136438187 16:30243316-30243338 AGGGGCAGAGGAGGAGAGTGGGG - Intronic
1137683331 16:50369213-50369235 AGGGAGGGAAGTGGAGACGGAGG - Intergenic
1137763610 16:50960620-50960642 AGGGCTGGAAGTGGGGGGTGAGG + Intergenic
1138370216 16:56520638-56520660 AGGGAAGGAAGAGGGGAGAGAGG + Intergenic
1139332237 16:66202283-66202305 AAGGTGGGAAGTGGAGGGTGGGG + Intergenic
1139590783 16:67931691-67931713 AGGGACGAAGGTGGACAGAGTGG - Intronic
1139857741 16:69993946-69993968 AGGGGCAGAGGAGGAGAGTGGGG - Intergenic
1140436251 16:74949447-74949469 AGGGAGGGAAGGAGAGAGGGAGG + Intronic
1140743820 16:77963991-77964013 GGGTCTGGAAGTGGAGAGTGTGG - Intronic
1140894721 16:79314795-79314817 AGGGAAGGAAGTGGATGGAGAGG - Intergenic
1140914632 16:79482991-79483013 AGGGAGGGAAGGAGGGAGTGAGG - Intergenic
1141216307 16:82027377-82027399 AGGAAAGGAAGTGGAGATGGTGG + Intergenic
1141223403 16:82092294-82092316 AGGGAGGGGAGTGGAGAGAAGGG - Intronic
1141266481 16:82502418-82502440 AGGGACAGAATTGGAGACAGAGG + Intergenic
1141646476 16:85370588-85370610 AGGGAGGGAAGAGAAGAGGGAGG - Intergenic
1142028046 16:87824860-87824882 AGGGAGGGAAGAGGGAAGTGTGG - Intergenic
1142715924 17:1746948-1746970 AGGGACTGGAGTGGGCAGTGGGG + Intronic
1142957669 17:3532428-3532450 AGGGACTGAAGTCTAGAGAGTGG + Intronic
1143129967 17:4671933-4671955 AGGGACGGAGGAGGAGCGTGGGG - Exonic
1144148483 17:12420729-12420751 AGGGAAGGAAGTGGGCATTGTGG + Intergenic
1144619406 17:16807459-16807481 AGGGACTGAAGGGGAGGGTATGG - Intergenic
1144647827 17:16987454-16987476 AGGGAGGGAGGTGGAGAGGGAGG + Intergenic
1144893287 17:18508245-18508267 AGGGACTGAAGGGGAGGGTATGG + Intergenic
1145093284 17:20003479-20003501 AGGGACAGAAATGCAAAGTGGGG + Intergenic
1145138937 17:20436046-20436068 AGGGACTGAAGGGGAGGGTATGG - Intergenic
1145225268 17:21123208-21123230 AGGGAGCCAAGTGGAGAGTCAGG - Intergenic
1145254794 17:21316642-21316664 AGGGAGGGAAGGGGGGAGGGAGG + Intergenic
1145321806 17:21771323-21771345 AGGGAGGGAAGGGGGGAGGGAGG - Intergenic
1145878613 17:28338331-28338353 TGGGAGGGAAGAGGAGAGTAGGG + Intronic
1146086336 17:29833722-29833744 AGGGAGGGAAGTAGGGAGGGAGG - Intronic
1146639514 17:34529515-34529537 AGGGAAGGAAGTGGAGGGTGGGG - Intergenic
1147162138 17:38574494-38574516 AGAAACGGAAGGGGAGGGTGTGG + Intronic
1147261174 17:39210475-39210497 GGGCAGGGAAGTGGGGAGTGGGG - Intergenic
1147571701 17:41575551-41575573 AGGGTGGGAAGTGGAGAAGGTGG - Intergenic
1147583392 17:41639042-41639064 AGGGAGGGAAGGGCAGAGGGAGG - Intergenic
1147670676 17:42175121-42175143 AGGGACAGAAGAGGTGAATGGGG - Intronic
1148160067 17:45444605-45444627 GAGGAGGGAAGTGGGGAGTGTGG - Intronic
1148177497 17:45580002-45580024 AGGGAGGGAGGGGGAGAGAGCGG - Intergenic
1148781030 17:50122090-50122112 AGGGATGGAGGTGGGAAGTGAGG - Intronic
1149122812 17:53190515-53190537 AGGGAAGGAAGTGAGTAGTGGGG - Intergenic
1149205999 17:54248917-54248939 AGGCACTGAAGTAGACAGTGGGG - Intergenic
1150521796 17:65876075-65876097 TGGAACAGAAGTGGAGTGTGAGG - Intronic
1150953676 17:69831127-69831149 AGGGAGGGAAAAGGAGAGGGAGG - Intergenic
1150984858 17:70184549-70184571 AGGGAGGGGAGGGGAGAGGGAGG - Intergenic
1151295729 17:73184927-73184949 AGTGAGGGAGGAGGAGAGTGGGG + Intergenic
1151512706 17:74571051-74571073 AGGGAAGAAAGTGGGCAGTGGGG - Intergenic
1151918454 17:77136316-77136338 AGGGAGGGAAGGGGAGAGGGAGG - Intronic
1152013449 17:77734893-77734915 AGAGACGGGAGGGCAGAGTGGGG - Intergenic
1152032842 17:77854569-77854591 GGGGGCGGGAGTGGAGGGTGGGG - Intergenic
1152571658 17:81123743-81123765 GGGGAAGGAAGGGGAGAGAGGGG + Intronic
1152953190 18:12502-12524 AGGGGCGTTAGGGGAGAGTGAGG + Intergenic
1153250739 18:3119134-3119156 AGGGAAGAAAGTGGGAAGTGGGG - Intronic
1153335870 18:3924368-3924390 GGGGGAGGAAGTGGAGGGTGTGG - Intronic
1153538815 18:6133498-6133520 AGGGAGGGAAGGGGAGAGGAGGG - Intronic
1154119185 18:11637199-11637221 AGGGGCAGAGGAGGAGAGTGGGG - Intergenic
1154204904 18:12328037-12328059 AGGAAAGGAAGTGGCCAGTGTGG + Intronic
1154217814 18:12428414-12428436 AGGGAGGAAAGGGAAGAGTGAGG - Intronic
1154399260 18:14019756-14019778 AGGGCAGGGAGGGGAGAGTGGGG + Intergenic
1155345535 18:24853296-24853318 AATGATGGAAGTGGAGGGTGTGG - Intergenic
1156987553 18:43366044-43366066 AGGGAGGGAAGGAGAGAGGGAGG + Intergenic
1157204030 18:45683280-45683302 AGAAATGGAGGTGGAGAGTGGGG - Exonic
1157214695 18:45773164-45773186 AGGGAAGGAGGGGGAGAGGGAGG - Intergenic
1157442532 18:47721727-47721749 AGAGGAGGAAGAGGAGAGTGTGG + Intergenic
1157737058 18:50058961-50058983 AGGGAAGGAAGTGATCAGTGAGG - Intronic
1157896117 18:51469882-51469904 TGGGACAGAAGTGGTGAGAGTGG + Intergenic
1158520728 18:58170095-58170117 AGGGAGGGAAGGAGAGAGGGAGG - Intronic
1159247680 18:65830561-65830583 AGGGAAGGAAGGAGAGAGAGAGG - Intronic
1159343609 18:67169377-67169399 AGGGAGGGAAGAGGAGAGGAGGG + Intergenic
1159442117 18:68494820-68494842 AGGAAGGGAAATGGAGGGTGGGG - Intergenic
1159879954 18:73849526-73849548 AGGGAAAGAAGGGGAGAGGGAGG + Intergenic
1159987279 18:74858113-74858135 AGGGAGGGAAGAAGAGAGGGAGG - Intronic
1160467254 18:79089915-79089937 GGGAAGGGTAGTGGAGAGTGGGG - Intronic
1160844241 19:1159594-1159616 AGGGACAGCAGGGGACAGTGGGG + Intronic
1161171907 19:2816318-2816340 AGGGACAGCCCTGGAGAGTGAGG - Intergenic
1161401545 19:4067797-4067819 AGGGGCGGAGGTGGGGAGTGGGG + Intergenic
1161530179 19:4784121-4784143 CGGGGAGGGAGTGGAGAGTGAGG + Intergenic
1161613434 19:5256849-5256871 AGGGACGAAGGTGGTGAGTGAGG + Intronic
1161636545 19:5392872-5392894 ATGGAAGGAAGTGGGGAGGGAGG - Intergenic
1161683672 19:5692885-5692907 AGGGATGGGAGGGAAGAGTGGGG + Intronic
1161878060 19:6927214-6927236 AGGGAGGGAAGAGGGGAGGGAGG - Intronic
1162011712 19:7820499-7820521 AGGGAGGGCAGTGGCAAGTGGGG - Intergenic
1162040079 19:7965597-7965619 ATGGAAGGAAGTGGGGAGGGCGG - Intronic
1162310086 19:9901024-9901046 AGGGAAGGAAGCGGGGAGGGAGG + Intronic
1162493340 19:11008300-11008322 AGGGAGGGTAGTGGAAAGGGAGG - Intronic
1163151651 19:15418612-15418634 AGGGACGGAGGTGGTGGGGGCGG + Intronic
1163166957 19:15505226-15505248 AGGGGAGGAAGTGGAGGCTGTGG - Intergenic
1163207416 19:15813820-15813842 AGAGAGAGAAGTGGAGAGAGAGG + Intergenic
1163508673 19:17722776-17722798 AGGGAGGGAGGGGGAGAGGGAGG + Intronic
1163720114 19:18894755-18894777 GGGGACGGGAGTGGGGAGAGTGG + Intronic
1163760580 19:19134228-19134250 AGTGAGGGACGTGGGGAGTGTGG + Intronic
1163817223 19:19474202-19474224 AGGGAAGGGAGAGGAGGGTGAGG + Intronic
1164323930 19:24176134-24176156 AGGGACTGTGGTGGAGAGGGGGG - Intergenic
1164425996 19:28142455-28142477 AGAGAAGGAAGGGGAGAGGGAGG + Intergenic
1164581830 19:29439393-29439415 AGGGAGGGGAGGGGAGAGAGAGG + Intergenic
1164615079 19:29662936-29662958 AAGGACAGAAGAGGAGACTGAGG + Intergenic
1164680385 19:30130703-30130725 AGGGAGGGAGGAGGAGAGGGAGG - Intergenic
1164771898 19:30816074-30816096 AGGGAAGGAAGAAGAGAGGGAGG - Intergenic
1165476297 19:36032741-36032763 GGGGACCAAAGTGGAGACTGGGG + Exonic
1166060261 19:40321444-40321466 AGGGAGGTCAGTGGGGAGTGGGG + Exonic
1166088790 19:40494787-40494809 AGGGAAGGAAGATGAGAGAGAGG - Intronic
1166168553 19:41009958-41009980 AGGGAAGGAAGGGGAGGGTCAGG - Intronic
1166283301 19:41809218-41809240 AGGGAGGGAAGTAGGGAGGGAGG + Intronic
1166387509 19:42390420-42390442 GGGGATGGGAGTGGAGAGGGAGG - Intergenic
1166568554 19:43779693-43779715 AGGGAAGAAAGGGGAAAGTGGGG - Intronic
1166650351 19:44569374-44569396 AGGGAAGGAAGGAGAGAGGGAGG + Intergenic
1166859455 19:45801399-45801421 CCGGAGGGAAGTGGAGAGAGAGG - Intronic
1166985042 19:46654729-46654751 AGGGAGGGAAGTGGGGAGGAGGG + Intronic
1166999829 19:46739196-46739218 AGGGATGGCAGTGGAGAGGAGGG + Intronic
1167634980 19:50649152-50649174 AGGAAGGGAGGTGGAGAGAGAGG + Intronic
1167792741 19:51691270-51691292 AGGGAGGGAAGGAGAGAGAGAGG + Intergenic
1168190625 19:54735944-54735966 AGGGAGGGAAATGCTGAGTGAGG - Intronic
1168202982 19:54830052-54830074 AGGGAGGGAAATGCTGAGTGAGG - Intronic
1168250917 19:55141474-55141496 AAAGACGGGAGTGGGGAGTGGGG + Intronic
1168499325 19:56880104-56880126 ACTGAGGGAAGTGGTGAGTGGGG + Intergenic
1168647086 19:58066487-58066509 AGGAAAGGAAGAGGAGAGGGAGG - Intronic
1168663082 19:58182966-58182988 AGGGCCGGAAGTGCAGGGGGCGG - Intergenic
1202706827 1_KI270713v1_random:30645-30667 AGGGGCGGCAGTGGGGAGGGTGG - Intergenic
925032212 2:659678-659700 AGGGAAGGAAGGAGAGAGGGAGG + Intergenic
925060641 2:887459-887481 AGGGGCTGGAGTGGAGAGTCAGG + Intergenic
925422998 2:3726741-3726763 ATGGAGGGAAGTGCAGGGTGCGG - Intronic
925881098 2:8353079-8353101 AGGGAGGGAAGGGGAGAGGAGGG + Intergenic
925895422 2:8468026-8468048 AGTTCCGGAGGTGGAGAGTGGGG - Intergenic
926106816 2:10157517-10157539 GGGGATGGAAGTGGAGATGGAGG - Intronic
927094380 2:19736525-19736547 AGTGTCTGAGGTGGAGAGTGAGG - Intergenic
927204554 2:20598993-20599015 AGGGAGGGCAGTGGGGAGTGGGG + Intronic
927532277 2:23818216-23818238 AGGGAGGGAAGAAGAGAGGGAGG + Intronic
927532294 2:23818270-23818292 AGGGAGGGAAGAAGAGAGGGAGG + Intronic
927641601 2:24849051-24849073 AGGGAGGGACGTGGAACGTGAGG + Intronic
929261702 2:39873121-39873143 AAGGAAGGAAGGGGAGAGAGAGG - Intergenic
929452004 2:42044140-42044162 AGGGAGGGAAGGAGGGAGTGAGG + Intergenic
929860995 2:45677186-45677208 AGGGAGGGAGGAGGAGAGGGAGG - Intronic
930016159 2:46971949-46971971 AGGGACGGAGGTAGGGAGGGAGG + Intronic
930147678 2:48023917-48023939 TGGGAGGGAAGTTGAGAGTTTGG + Intergenic
930366179 2:50442508-50442530 AGGGAGAAATGTGGAGAGTGAGG + Intronic
930393883 2:50795570-50795592 AGGGAGGGAATTGGGGAGTGAGG - Intronic
930622529 2:53658899-53658921 AGTGAGGGAAGGGGGGAGTGAGG + Intronic
931140609 2:59453568-59453590 TGTGACGGAAGTGAAGAATGAGG - Intergenic
931437667 2:62262948-62262970 AGGGGTGGAAGAGGAGAGTAAGG - Intergenic
931851953 2:66260577-66260599 AGGTAGGGAAGTGGAAAGAGAGG + Intergenic
932416474 2:71576512-71576534 AGGGCCAGAGGTGGACAGTGGGG + Intronic
932628516 2:73318445-73318467 AGGGAGGGAAGTGAGAAGTGAGG - Intergenic
933215826 2:79629074-79629096 AGGGACGGAAGTGGAGAGTGGGG - Intronic
933566794 2:83960299-83960321 GGGGCCGGAAATGGAGAGTTTGG + Intergenic
933708447 2:85308404-85308426 AGGGAGGGAAGGGGAAAGGGAGG - Intronic
933708467 2:85308466-85308488 AGGGAAGGAGGGGGAGAGGGAGG - Intronic
933946282 2:87288654-87288676 AGGGAGGGAAGGAGAGAGGGAGG - Intergenic
934162471 2:89264835-89264857 GGAGACAGAAGTGGAGAGGGTGG - Intergenic
934204803 2:89917881-89917903 GGAGACAGAAGTGGAGAGGGTGG + Intergenic
934614196 2:95761269-95761291 TGGGAGGGACGTGGAGGGTGGGG - Intergenic
935947453 2:108299265-108299287 AGGGACGAAAGTGAAGAGGGAGG - Intronic
936333912 2:111572879-111572901 AGGGAGGGAAGGAGAGAGGGAGG + Intergenic
936917562 2:117655463-117655485 AGGGAAGAAGGTGGAGAGGGAGG + Intergenic
937857889 2:126685935-126685957 AAGGAGGGGAGTTGAGAGTGAGG - Intronic
938265084 2:129922801-129922823 AGGCATGGAAGTGGAGGGAGAGG + Intergenic
938390623 2:130902235-130902257 AGGGAGGGAAGGAGAGAGGGAGG - Intronic
938977747 2:136495535-136495557 AGGGAGGGAATTAGAGAGGGAGG - Intergenic
939068074 2:137507727-137507749 AGGGAAAGAAGTAGAGAGAGAGG - Intronic
939144010 2:138390715-138390737 AGGGCGGGAAGTGGGGAGTCTGG - Intergenic
939379356 2:141414270-141414292 AGGGAGGGAGGGGGAGAGGGAGG + Intronic
939591108 2:144064935-144064957 AGGGACTGAGGAGGAGAGGGGGG + Intronic
940302010 2:152185138-152185160 AGGTACAGAGGTGGAGCGTGTGG + Intergenic
941095744 2:161238261-161238283 AGGGACGGGAGGGGAGAGTTGGG - Intergenic
941420622 2:165279363-165279385 AGGGGAGGAAGTGGAGAGATTGG + Intronic
942211771 2:173678295-173678317 AGGGAAGGAGGAGGAGAGGGAGG + Intergenic
942444501 2:176069077-176069099 AGGGTGAGAAGTGGAGTGTGTGG + Intergenic
943060948 2:183040771-183040793 AGGGAAGGAGGAGGAGAGGGAGG + Intergenic
943977061 2:194496206-194496228 AGGGACTGAGGAGGAGATTGGGG - Intergenic
944848144 2:203689665-203689687 AGGGTGGGAAGTGGAGGATGGGG - Intergenic
945053099 2:205843998-205844020 AGGGAGGGAGGGGGAGAGAGAGG + Intergenic
945137314 2:206642282-206642304 AGGGAGAGAAGAGGAGGGTGCGG + Intergenic
945290327 2:208120468-208120490 AGGGAAGGAGGGGGAGAGAGAGG - Intergenic
945763986 2:213950637-213950659 AGGGAGGGAAGGAGAGAGGGAGG - Intronic
945895427 2:215475989-215476011 AGGGTCCGAAGGGGAGAGTGGGG - Intergenic
945967399 2:216203309-216203331 AGAGAGGGCAGTGGAAAGTGGGG - Intronic
946683830 2:222246145-222246167 AGGGACTGAAGTTGAGGCTGAGG + Intronic
946708025 2:222478195-222478217 AGGGAGGGAGGGGGAGAGGGAGG + Intronic
946736828 2:222762137-222762159 GGGGAGGGAAATGCAGAGTGAGG + Intergenic
946895840 2:224322487-224322509 AGGGACTGAAGAAGACAGTGTGG + Intergenic
946941210 2:224771857-224771879 AGGTAGGGAACGGGAGAGTGTGG + Intronic
947865937 2:233397775-233397797 AGAGAGTGGAGTGGAGAGTGCGG + Intronic
947998011 2:234544769-234544791 AGGGAAGGAAGGAGAGAGGGAGG + Intergenic
948230995 2:236349216-236349238 AGGGATGGAGCTGAAGAGTGAGG + Intronic
948353492 2:237359745-237359767 AGGGAAGGGAGTGGAGTGAGAGG - Intronic
948575277 2:238945929-238945951 AAGGAGGGAAGTGCAGAGTGGGG - Intergenic
948839090 2:240640582-240640604 AGGGAAGGAAGGAGAGAGGGAGG - Intergenic
1168806002 20:672730-672752 AGGGAGGGAAGGAGAGAGGGAGG - Intronic
1168855718 20:1006300-1006322 AGGACTGGAAGTGGAGAGGGAGG - Intergenic
1168956243 20:1836457-1836479 AGTGAAGGAGGTGGAGAGGGAGG - Intergenic
1169078848 20:2782067-2782089 AGGGAAAGAAGTGGAGATGGGGG + Intergenic
1169254544 20:4086772-4086794 AGGGAAGGAAGTGCAGAGAGAGG - Intergenic
1169345918 20:4828010-4828032 GAGGGAGGAAGTGGAGAGTGGGG + Intergenic
1169556441 20:6755840-6755862 AGGGAGGGAAGGAGGGAGTGAGG - Intergenic
1169768028 20:9169667-9169689 AGGGAAGGAAGTGGGCAGTGGGG + Intronic
1169971708 20:11275703-11275725 AGGGAGGGAAGAGAAGAGGGAGG - Intergenic
1170149855 20:13218433-13218455 TGGGATGGAGGTGGGGAGTGGGG + Intergenic
1170287431 20:14725605-14725627 TGGTACGGAAGTAGAAAGTGAGG + Intronic
1170500113 20:16966856-16966878 AGGGAAGCAAGTGGAGAGCACGG - Intergenic
1170813914 20:19696944-19696966 AGGGAGGGAGGAGGAGAGGGAGG + Intronic
1170963028 20:21042221-21042243 AGGGAGGAAGGTGTAGAGTGCGG - Intergenic
1171048612 20:21834717-21834739 AGGTAGGGGAGTGGAGGGTGGGG + Intergenic
1171990071 20:31689254-31689276 AGGGAGGGAAGGGGAGGGGGAGG + Intronic
1172441896 20:34971755-34971777 AGCGACGGAATTTGACAGTGTGG - Intergenic
1172565503 20:35927109-35927131 AGGGAAGGAAGTGGAGCCTTGGG + Intronic
1172641492 20:36442940-36442962 AGGGTAGGGAGTGGAGAGTCAGG - Intronic
1172657181 20:36544303-36544325 AGGGATGGAGTGGGAGAGTGAGG + Intronic
1174358981 20:50016116-50016138 AGGGGCGGAGCTGGAGAGGGTGG - Intergenic
1174692051 20:52516003-52516025 AGGGAGGGAAGGAGAGAGGGAGG + Intergenic
1175254041 20:57628140-57628162 AGGAAGGGAAGTGGGGGGTGAGG + Intergenic
1175392518 20:58636146-58636168 AGGGAGGGAGGAGGAGAGGGAGG + Intergenic
1175625953 20:60488369-60488391 AGGGAAGGAAGTGGCCTGTGGGG + Intergenic
1175643667 20:60652797-60652819 AGGGCCGGATGTGGTTAGTGTGG - Intergenic
1175733828 20:61371862-61371884 AGGGACGGATGGTGAGGGTGGGG - Intronic
1176282307 20:64320645-64320667 AAGGACAAAAGTGGAGAGTGAGG - Intergenic
1177003373 21:15640706-15640728 AGGGAGGGAAGGAGAGAGGGAGG - Intergenic
1178125911 21:29515636-29515658 AGGAATGGGAGTGAAGAGTGAGG - Intronic
1178616753 21:34141320-34141342 AGTGAGGGCAATGGAGAGTGAGG + Intronic
1179084993 21:38208001-38208023 AGGGAAGGAGGTGGAGAGGAGGG - Intronic
1179091044 21:38266032-38266054 AGGGAAAGAATGGGAGAGTGAGG + Intronic
1179395092 21:41032274-41032296 AGGGAGGGGATTGGAAAGTGTGG - Intergenic
1179618812 21:42599062-42599084 TGGGAGCGATGTGGAGAGTGGGG - Intergenic
1179652119 21:42818350-42818372 AGGGAGAGAAGGAGAGAGTGAGG - Intergenic
1179899381 21:44381117-44381139 AGGCATGGAGGTGGAGTGTGAGG + Intronic
1180186642 21:46143331-46143353 AGGGAGGGGAGTGGGGAGAGAGG - Intronic
1180866873 22:19124735-19124757 AGGGGCAGCACTGGAGAGTGTGG - Intergenic
1182103777 22:27674687-27674709 AGAAACAGAAGGGGAGAGTGAGG - Intergenic
1182273436 22:29170115-29170137 AGGGGTGGAAGGAGAGAGTGTGG + Intergenic
1182320538 22:29476027-29476049 AGGGAATGCAGTGGAGAGAGGGG + Intergenic
1182456821 22:30457061-30457083 AGGGTCTGAGGTAGAGAGTGTGG - Intronic
1182763743 22:32743740-32743762 AGGGAAGGAACAGGAGAGGGAGG - Intronic
1182953160 22:34396499-34396521 AGAGAGGGAAGGGGAGAGAGAGG - Intergenic
1183231249 22:36583576-36583598 AGGGACGGAAGTGAAAGGAGAGG - Intronic
1183347389 22:37315394-37315416 AGGGACGGAGGTGGAGGGCCCGG - Intergenic
1183367174 22:37412919-37412941 AGGGGAGGAAGTGGGGAGCGTGG - Intronic
1183482474 22:38072647-38072669 AGGGTGGGGAGGGGAGAGTGTGG + Intronic
1183611267 22:38908103-38908125 AGAGAGGGAAGGAGAGAGTGAGG - Intergenic
1185377291 22:50488346-50488368 AGAGTTGGAAGTGGAGGGTGAGG + Intronic
1185380024 22:50503994-50504016 AGGGGGGGATGTGGAGCGTGAGG - Intronic
950186854 3:10950741-10950763 ATGGACCAAAGTGGAGGGTGGGG - Intergenic
950264595 3:11564677-11564699 AGGGAGGGAGGTGGTGAGGGAGG - Intronic
950290205 3:11777927-11777949 AGGGCCGGAAGTGGGTAATGGGG - Intergenic
950401581 3:12773185-12773207 AGGGAGGGAAGGAGAGAGAGAGG + Intergenic
950480849 3:13242853-13242875 AGGGAGGGAAGAGGAGAGGAGGG + Intergenic
950576407 3:13834670-13834692 AGGGAGCCATGTGGAGAGTGGGG - Intronic
950598339 3:14006682-14006704 AGGGAGGGAAGTAGGGAGAGAGG - Intronic
952191265 3:31025762-31025784 TGGAGGGGAAGTGGAGAGTGGGG - Intergenic
952935766 3:38397221-38397243 AGGGTGGAAAGGGGAGAGTGAGG + Intronic
952972163 3:38658420-38658442 AGGGAGGGAGCTGGTGAGTGAGG + Intergenic
953019234 3:39103378-39103400 AGGGAGGGAAGGGTAGACTGGGG + Intronic
953138710 3:40207184-40207206 AGGTTCAGAAGTGGAGAGAGTGG - Intronic
953315414 3:41922464-41922486 AGGGAAGGGAGGGGAGAGTATGG + Intronic
953530489 3:43735882-43735904 AGGGCCTGCAGTGGAGAATGTGG + Intergenic
954590382 3:51777562-51777584 AGGGACACAAGCTGAGAGTGAGG + Intergenic
955156415 3:56421094-56421116 AGGGAGTGAAGAGGTGAGTGTGG + Intronic
956153387 3:66267457-66267479 AGGGACTGGAGTGGAGAATTTGG + Intronic
956275773 3:67499600-67499622 AGAGACTGCAGTGGAGAGGGTGG + Intronic
956436252 3:69237208-69237230 AGGAACGGAAGAGGAGGGAGGGG + Intronic
958135572 3:89485391-89485413 AGTGAAGCAAGTGAAGAGTGTGG + Intergenic
958602370 3:96312817-96312839 AGGGACTGATGAGGTGAGTGGGG - Intergenic
960094713 3:113678006-113678028 AGGGAAGGAGGGGGAGAGTAAGG - Intronic
960111971 3:113853993-113854015 AGGGATTGATGTGGTGAGTGAGG + Intronic
960465842 3:117996483-117996505 AGGGAGGGAGGAAGAGAGTGGGG - Intergenic
961353138 3:126316573-126316595 AGGGAAGGAAGTCCAGAGTGGGG + Intergenic
962076814 3:132090762-132090784 AGGGAGGAAACTGGAGAGTGGGG + Intronic
962734566 3:138313900-138313922 AGGCCAGGAAGTGGAGAGAGAGG + Intronic
962865941 3:139448103-139448125 AGGGACAGGAGGGGAGAATGAGG - Intergenic
964338791 3:155686238-155686260 AGGGAAGGAAGTGCAAAGAGGGG + Intronic
964767316 3:160191389-160191411 AAGGAAGGAAGAGGAGACTGGGG + Intergenic
965463617 3:168999983-169000005 AGGGAGGGAAGTGGGGGGTTTGG + Intergenic
965504229 3:169494689-169494711 AGGGAAGGTAGAGGACAGTGAGG + Intronic
967027215 3:185575463-185575485 AGGGCAGGGAGTGGAGTGTGTGG + Intergenic
967210786 3:187166629-187166651 AGTGAAGGAACTGGAGAATGGGG + Intronic
967249067 3:187518451-187518473 AGGGACGGAGGGAGAGAGGGAGG + Intergenic
967943847 3:194786908-194786930 AGGGGCGGCAGTAGAGAGGGTGG + Intergenic
967992518 3:195142120-195142142 AGGGTCGGAAGAGGAGAGACTGG - Intronic
968235699 3:197029185-197029207 AGGGATGGAGGTGGAGACGGAGG - Intronic
968881309 4:3301591-3301613 AGGGCCGGGGATGGAGAGTGAGG + Intronic
968965963 4:3769265-3769287 AGGAAGGGCAGTGGAAAGTGGGG + Intergenic
969129659 4:4982221-4982243 AGGGGAGGAGGTGGAGGGTGTGG - Intergenic
969207184 4:5655768-5655790 AGGGAGGGAAGAAGAGAGGGAGG + Intronic
969219594 4:5751325-5751347 GAGGATGGAAGTGGAGAGAGTGG - Intronic
969717503 4:8874937-8874959 AGGGACTAAAGTGGACAGGGAGG - Intergenic
969842628 4:9893551-9893573 AGGGACGGAGGGAGAGAATGAGG + Intronic
970365100 4:15350244-15350266 AGGGAGGGAAGGAGAGAGGGAGG + Intronic
970609987 4:17716271-17716293 GGGGAAGGGAGTGGAGAGGGTGG - Intronic
970726271 4:19048801-19048823 AGGGACTGAATTAAAGAGTGTGG - Intergenic
971157941 4:24103254-24103276 AGGGAAGGCAGTTGAGAGTGTGG - Intergenic
971405887 4:26320694-26320716 AGGGACGTACGTGGAGACTGAGG - Exonic
972940952 4:44194768-44194790 AGGGAGGGAAGGGGGGAGGGTGG - Intronic
974020430 4:56687943-56687965 AGGGAGGGAGGTGGATAGAGAGG + Intergenic
974020437 4:56687963-56687985 AGGGAGGGAGGTGGAGAGGAAGG + Intergenic
974145563 4:57943246-57943268 AGGGAGGGAAGGAGAGAGAGAGG + Intergenic
974154101 4:58047981-58048003 AGGGATGGGAGAGCAGAGTGTGG - Intergenic
975289711 4:72663429-72663451 AGGGAAGGAAGTAGGGAGGGAGG - Intergenic
975507896 4:75159663-75159685 AGAGAGAGAAGAGGAGAGTGGGG + Intergenic
975615585 4:76243653-76243675 AGGAACAGAAGTGGAGAATAGGG - Intronic
976132835 4:81903395-81903417 AGGGCCTGAAGCAGAGAGTGAGG - Intronic
976205883 4:82622909-82622931 AGGGACGGAAGGAGGGAGGGAGG - Intergenic
976572988 4:86635007-86635029 AGAGACAGAACTGGAGAATGGGG - Intronic
977997117 4:103508032-103508054 AGGGATGGAAGAGGAGACAGAGG - Intergenic
978133331 4:105226602-105226624 AGGGAGGGAAGGAGAGAGGGAGG - Intronic
978457302 4:108908341-108908363 AGGGAAGAAAGAGGACAGTGAGG - Intronic
978487959 4:109277429-109277451 AGGGTGGGAGCTGGAGAGTGGGG + Intronic
978931059 4:114312513-114312535 AGGGAGGGAAAAAGAGAGTGGGG - Intergenic
979865064 4:125744129-125744151 AGGGAGGGAAGTGGGGAGGGAGG + Intergenic
981265258 4:142775529-142775551 AGGAAGGGAAGAGGAGAGTAGGG - Intronic
981459929 4:145001221-145001243 AGGGAGGGAAGGAGGGAGTGAGG + Intronic
981672599 4:147304143-147304165 AGGGAGTGAAGTTGAGAGTTGGG - Intergenic
982033199 4:151321332-151321354 AGGGCAAGAAGTGGAGGGTGGGG - Intronic
982225861 4:153165775-153165797 AAGGAAGGAAAAGGAGAGTGAGG - Intronic
982553683 4:156834054-156834076 AAGGAGGGAAGTAGAGAGTAAGG - Intronic
983387425 4:167082833-167082855 AGGGAAGGAAGGGAAGAGGGAGG + Intronic
983683839 4:170384519-170384541 AGGGAGGGAAGCAGAGAGGGAGG - Intergenic
984699434 4:182809201-182809223 AGGGAGGGAAGTGGCGAGCAGGG + Intergenic
984822047 4:183890531-183890553 AGGGAAGGAAGGAGAGAGGGAGG + Intronic
985273574 4:188216700-188216722 AGGGAAGGAAGGAGAGAGGGAGG - Intergenic
985423325 4:189805545-189805567 AAGGACGGAGGTGGAGACCGAGG + Intergenic
985511998 5:318324-318346 AGGGGGGGAGGTGGAGGGTGAGG - Intronic
985666945 5:1186245-1186267 AAGGACAGAAGGGGAGAGAGGGG - Intergenic
986029309 5:3880580-3880602 AGGGACAGAAGAAGAGAGGGAGG - Intergenic
987079795 5:14416729-14416751 AGGGTGGGAAGGGGAGAGAGGGG - Intronic
987345873 5:16978531-16978553 AGGGAAGGAAGGAGAGAGGGAGG - Intergenic
988386076 5:30566874-30566896 AGTGATGGAAGTGACGAGTGTGG + Intergenic
988829129 5:34970666-34970688 AGGGAGGGAAGGAGAGAGAGAGG + Intergenic
988943575 5:36171094-36171116 AGTGCCAGAAGTGGGGAGTGGGG + Intronic
989175634 5:38522309-38522331 AGGGAAGGAAGAGGAAAGTGAGG - Intronic
989278057 5:39611308-39611330 AGGGAGGGAGGTAGAGAGGGAGG - Intergenic
989666979 5:43866138-43866160 AGGCACTGTAGTGGATAGTGAGG + Intergenic
990694929 5:58405521-58405543 AGGAATGGCAGTGGTGAGTGTGG + Intergenic
991432436 5:66562365-66562387 TGGGAGGGAAGTGGAGACTGAGG - Intergenic
992616826 5:78553202-78553224 AGATGCGGAAGTGCAGAGTGTGG - Intronic
993375060 5:87141082-87141104 AGGGAGGGAGGGGGAGAGGGAGG + Intergenic
993820446 5:92608517-92608539 AGGGATGGAGATGGAAAGTGAGG - Intergenic
994567600 5:101471244-101471266 AGGGAGGGAGGAGGAGAGGGAGG + Intergenic
995609499 5:113893888-113893910 AGGGATGTCACTGGAGAGTGGGG - Intergenic
997214148 5:132096561-132096583 ATGGCCTGAACTGGAGAGTGAGG + Intergenic
997696948 5:135869006-135869028 AGGGAGGGAAGTGAAGAGAGTGG + Intronic
998734674 5:145122983-145123005 AGGGAGGGAAGGAGAGAGAGAGG - Intergenic
998761358 5:145435446-145435468 AGGGAGTGATGGGGAGAGTGGGG + Intergenic
999132558 5:149295620-149295642 AGGGAGGGAAGTGGGGAAGGAGG + Intronic
999329631 5:150663437-150663459 AGAGAGGGGAGTGGAGAGAGTGG + Intronic
1000255879 5:159537782-159537804 GGGGTGGGAACTGGAGAGTGAGG - Intergenic
1001191767 5:169638026-169638048 AGGGGCGGAAGTGGTGGCTGGGG + Intronic
1001238057 5:170046338-170046360 GGTGGGGGAAGTGGAGAGTGGGG + Intronic
1001647009 5:173289708-173289730 AGGGAGGGAAGGGGGGAGGGAGG - Intergenic
1001919439 5:175588741-175588763 AGGGAAGGAAGTAGGGAGGGAGG + Intergenic
1002095931 5:176831076-176831098 AGGCACGGAGGTGGGGGGTGGGG - Intronic
1002377013 5:178796064-178796086 AGGGAGGGAAGTGGGGAGGGAGG + Intergenic
1002459124 5:179364274-179364296 AGAGACGGAGGGGGAGAGGGAGG + Intergenic
1002459142 5:179364322-179364344 AGAGACGGAGGGGGAGAGGGAGG + Intergenic
1002459151 5:179364346-179364368 AGAGACGGAGGGGGAGAGGGAGG + Intergenic
1002459160 5:179364370-179364392 AGAGACGGAGGGGGAGAGGGAGG + Intergenic
1002459167 5:179364394-179364416 AGAGACGGAGGGGGAGAGAGAGG + Intergenic
1002459174 5:179364418-179364440 AGAGACGGAGGGGGAGAGAGAGG + Intergenic
1002459183 5:179364442-179364464 AGAGACGGAGGGGGAGAGGGAGG + Intergenic
1002459192 5:179364466-179364488 AGAGACGGAGGGGGAGAGGGAGG + Intergenic
1002459201 5:179364490-179364512 AGAGACGGAGGGGGAGAGGGAGG + Intergenic
1002459210 5:179364514-179364536 AGAGACGGAGGGGGAGAGGGAGG + Intergenic
1002459219 5:179364538-179364560 AGAGACGGAGGGGGAGAGGGAGG + Intergenic
1002459228 5:179364562-179364584 AGAGACGGAGGGGGAGAGGGAGG + Intergenic
1002459235 5:179364586-179364608 AGAGACGGAGGGGGAGAGAGAGG + Intergenic
1003299062 6:4860336-4860358 AGGGAAAGAAGGGGGGAGTGAGG - Intronic
1003335430 6:5167388-5167410 AGGGAAGGCAGTGAAGAGTGTGG - Intronic
1003560889 6:7179110-7179132 AGGGAAGGAAGTGGAGAGGAGGG - Intronic
1003606966 6:7571027-7571049 AGGGATGGAAGTGAGGAGAGGGG + Intronic
1003849436 6:10206703-10206725 AGGGTGGGAAGAGGAGGGTGAGG - Intronic
1003923496 6:10855660-10855682 TGGGAGGGAGGTTGAGAGTGGGG - Intronic
1004697309 6:18045747-18045769 AGGGAGGGAAGGAGGGAGTGAGG - Intergenic
1004772297 6:18797322-18797344 AAGAATAGAAGTGGAGAGTGGGG + Intergenic
1004815997 6:19312350-19312372 AGGGAGGAGAGAGGAGAGTGAGG - Intergenic
1005060705 6:21774522-21774544 AGGAAAGGAAGTGGGGAATGAGG - Intergenic
1005366085 6:25078850-25078872 AGAGAAGGAGGTGGAGAGGGAGG - Intergenic
1005510963 6:26511188-26511210 AGGGACGGGGGAGGAGAGAGGGG + Intergenic
1006109328 6:31735225-31735247 CGGCAGGAAAGTGGAGAGTGGGG + Intronic
1006274285 6:32989353-32989375 AGACACAGAAGTGGGGAGTGGGG - Intergenic
1006792907 6:36715453-36715475 TGGGACAGAAGTGGACAGAGGGG - Intronic
1008427746 6:51379373-51379395 AAGGAAGGAAGGGGAGAGGGAGG + Intergenic
1008497948 6:52152102-52152124 AGGGAGGGAGGTAGAGAGGGAGG + Intergenic
1011758680 6:90533520-90533542 AGGGAGGGCAGTCCAGAGTGAGG + Intronic
1011980190 6:93365052-93365074 AGGGAGAGAAGTGGAGAGATGGG - Intronic
1012091936 6:94909323-94909345 AGGGAGGGAAGTGGAAAAGGTGG - Intergenic
1013239398 6:108229418-108229440 AGGGAGGGAGGGGGAGAGGGAGG - Intronic
1013256815 6:108395795-108395817 AGGGAGGGAAGGAGAGAGAGAGG + Intronic
1013674946 6:112448806-112448828 AGGGAGGGAGGGGGAGAGGGAGG - Intergenic
1015112457 6:129609058-129609080 AGGGAAGGAAGAGGAGAGAGAGG + Intronic
1016342037 6:143073031-143073053 AGGCACGGGAGTGGGAAGTGGGG - Intronic
1016505709 6:144776630-144776652 AGGGAAGGAGGTGGACAGAGAGG - Intronic
1016585918 6:145685393-145685415 AGGGACTGGAGTGGGGAGAGAGG + Intronic
1016818159 6:148322958-148322980 AGGGAGGGAAGTAGAGAGGGAGG - Intronic
1016962851 6:149690088-149690110 AAGTATGGAAATGGAGAGTGAGG + Intronic
1017163999 6:151391045-151391067 GGGGACGGAAGCCGAGAGGGCGG - Intronic
1017300044 6:152846518-152846540 AAAGACAAAAGTGGAGAGTGGGG + Intergenic
1019414095 7:919527-919549 AGGGAGGGAAGGAGAGAGAGAGG + Intronic
1019445974 7:1071555-1071577 AGGGAGGAAAGGGGAGAGGGAGG + Intronic
1019730616 7:2627506-2627528 AGGGAGGGAAGGAGAGAGGGAGG + Intergenic
1020570208 7:9850822-9850844 AGGGAGGGGAGTGGAGGGAGGGG + Intergenic
1021447494 7:20749152-20749174 AGGGAAGGAAGGAGAGAGAGAGG - Intronic
1021778120 7:24073697-24073719 AGGGAGGGAAGAGGAGAGGAAGG + Intergenic
1022221878 7:28321681-28321703 AGGCAGGGAGGTGGTGAGTGGGG + Intronic
1022514273 7:30965510-30965532 AGGGAGGGAAGTGGTGGGAGTGG - Intronic
1022875234 7:34521172-34521194 AGGTGGGGAAGAGGAGAGTGGGG + Intergenic
1023031884 7:36096835-36096857 AGGAAAGGAAGAGGAGATTGTGG - Intergenic
1023367814 7:39481753-39481775 AGGGAGGGAAGGGAAGAGTTGGG - Intronic
1023368574 7:39489668-39489690 AGAGAAGGAAGGGGAGGGTGGGG - Intronic
1023735333 7:43231220-43231242 AAGGACAGAAGTGCAGAGGGAGG - Intronic
1024296006 7:47842804-47842826 AGGGAGGGCAGTGGAAAGGGCGG + Intronic
1024555603 7:50600584-50600606 AGGGAAGGAAGGAGAGAGGGGGG + Intronic
1024654158 7:51434914-51434936 AGGAAAGAAAGGGGAGAGTGAGG - Intergenic
1024970579 7:55066123-55066145 AAGGACGCAAGAGGGGAGTGCGG - Intronic
1025957361 7:66193228-66193250 AGGGAAGGAAGGAGAGAGGGAGG + Intergenic
1026186453 7:68085404-68085426 AGGCACTGAGGTGCAGAGTGAGG + Intergenic
1026256386 7:68715733-68715755 AGGGAAGGAGATGGAAAGTGAGG + Intergenic
1026763307 7:73142953-73142975 AGGGAGGGAAGGAGAGAGGGAGG + Intergenic
1026927517 7:74204394-74204416 AGGGAAGGAAGTAGGGAGAGAGG + Intronic
1027039776 7:74952735-74952757 AGGGAGGGAAGGAGAGAGGGAGG + Intergenic
1027083868 7:75249649-75249671 AGGGAGGGAAGGAGAGAGGGAGG - Intergenic
1027226000 7:76244008-76244030 AGGGACTGAGGTGGACACTGAGG + Intronic
1027533150 7:79361332-79361354 AAGGAGGGAAGGGAAGAGTGTGG + Intronic
1027609048 7:80336793-80336815 AGGGACAGAAATGGAGAGAGAGG + Intergenic
1027815077 7:82958369-82958391 AGGGAAGGATGGGGAGAGGGAGG - Intronic
1029178597 7:98683307-98683329 AGGGAAGGAAGGAGAGAGGGAGG - Intergenic
1029198982 7:98826266-98826288 AGGGAGGGAAGGAGAGAGGGAGG + Intergenic
1029405323 7:100371495-100371517 AGGGACGGATGTGGCCAGTGAGG + Intronic
1029547213 7:101216857-101216879 AGGGAGGGAAGTCGAGTGAGAGG - Intronic
1029595759 7:101536900-101536922 AAGGCAGGAAGTGGAGGGTGAGG + Intronic
1030884724 7:114922831-114922853 AGGGAGGGAAGTGGAGGGGGAGG + Intronic
1031026537 7:116685959-116685981 CAGGAAGGAAGGGGAGAGTGGGG - Intronic
1031484093 7:122307496-122307518 AGGAGAGGAAGGGGAGAGTGAGG - Intronic
1031890642 7:127289607-127289629 AGGGAAGGAAATGGTGAGTGAGG - Intergenic
1031930377 7:127679585-127679607 ACTGACAGAAGGGGAGAGTGGGG - Intronic
1032196186 7:129789931-129789953 AGGGTAGGAAGTGGAGGGGGTGG + Intergenic
1032545256 7:132736853-132736875 AGGAAGAGAAGTGGACAGTGTGG - Intergenic
1033264344 7:139871896-139871918 AGGAAAGGAATTGGAGAGAGTGG + Intronic
1033844175 7:145412353-145412375 AGGAAGGGTAGTGGGGAGTGGGG - Intergenic
1034368552 7:150572961-150572983 AAGAACGGAAGTGGAGAGTAAGG + Exonic
1034416642 7:150968755-150968777 AGGGAGGGAAGGGGAGAGGCAGG + Intronic
1034470917 7:151253935-151253957 AGGGAGAGGAGAGGAGAGTGAGG - Intronic
1034950273 7:155292008-155292030 AGAGCAGGCAGTGGAGAGTGAGG - Intergenic
1035049556 7:155990602-155990624 AGGTAGGGAAGAGGAGAGTTGGG + Intergenic
1035266411 7:157692325-157692347 AGGGAGGGGAGGGGAGACTGTGG - Intronic
1035625291 8:1066749-1066771 AGGGACGGAGGTGCCGCGTGTGG - Intergenic
1035743495 8:1945696-1945718 GGGGACGGACGTGGGGGGTGCGG + Intronic
1035975685 8:4308090-4308112 AGTGGCAGAAGTGGAGAGGGTGG + Intronic
1036546228 8:9771929-9771951 AGGGAGGGAGGGGGAGAGGGAGG + Intronic
1037436067 8:18864811-18864833 AGGCAAGGAAGTGGACATTGAGG - Intronic
1037566420 8:20122149-20122171 AGGAATGAATGTGGAGAGTGAGG - Intergenic
1037834208 8:22206818-22206840 AGTGACGGAAGGGGATAGAGAGG - Intronic
1037897275 8:22666337-22666359 AGGGAGGGAGGGGGTGAGTGGGG + Intronic
1037949565 8:23010051-23010073 AGGGACTGAGGTGTAGATTGAGG + Intronic
1039977580 8:42380454-42380476 AGGGAGGGAAGGAGAGAGGGAGG + Intergenic
1040305457 8:46209515-46209537 AGGGACTGAAGGGGACACTGAGG + Intergenic
1040979909 8:53236354-53236376 AGGGAAGGCAGTGGACACTGAGG - Intronic
1041755897 8:61313031-61313053 AGGAGCAGAAGGGGAGAGTGGGG - Intronic
1041864514 8:62554832-62554854 AGGGGTGGAAGTGGGGTGTGGGG - Intronic
1041953624 8:63533172-63533194 AGGGAGGGAAGAGGGGAGGGAGG - Intergenic
1042063611 8:64848598-64848620 GGGGACGGAAGGGGAGAGGAGGG + Intergenic
1042190160 8:66177914-66177936 AAGGGCAGAAGTGGAGAGGGAGG - Intronic
1042375327 8:68044556-68044578 GGTGATGGAAGTGGAGAATGTGG + Exonic
1042723313 8:71846584-71846606 AGGGAGGGAAGTAGGGAGGGAGG - Intronic
1042942125 8:74118389-74118411 AGGGAGGGAGGTGGGGAGAGAGG - Intergenic
1043860230 8:85307854-85307876 TGGGAAGGAAGTGGAGAAAGTGG - Intergenic
1044820859 8:96154800-96154822 AGGGAATGAGGTGGAGACTGTGG - Intronic
1045266555 8:100623493-100623515 AAGGAGGGAGGAGGAGAGTGTGG - Intronic
1045395765 8:101759373-101759395 AGGGAAGGAAGAAGAGAGTCAGG + Intronic
1045729449 8:105218309-105218331 AGGGAGGGAAGAAGAGAGAGAGG + Intronic
1047075573 8:121398631-121398653 AGGGAGGGCAGGGGAGAGTCAGG + Intergenic
1047097655 8:121641491-121641513 GGTGAGGGAAGTGGAGAGGGAGG + Intergenic
1047414679 8:124654378-124654400 AGTGACAGAGGTGGAGAGAGTGG - Intronic
1047489496 8:125362948-125362970 GGAGAGGGAAGTGGAGAGTGAGG - Intronic
1047497238 8:125417159-125417181 TGGGAAGGAAGTGGAGAGAGGGG + Intergenic
1048259657 8:132934977-132934999 AGTGACGGGAGAGGAGAGAGAGG - Intronic
1048758499 8:137765970-137765992 AGAGAGAGAAGTGGAGGGTGGGG - Intergenic
1049251197 8:141590045-141590067 AGGGACAGCAGGGGAAAGTGTGG - Intergenic
1049254346 8:141605820-141605842 AGGTAGGGAAGAGGAGGGTGGGG - Intergenic
1049370326 8:142261257-142261279 AGGGAAGGAAGGAGAGAGAGAGG + Intronic
1049440490 8:142607298-142607320 AGGGAGGGGAGTGGAGGGTGGGG + Intergenic
1049654995 8:143793401-143793423 AGGGACGGGGGTAGAGAGGGGGG + Intronic
1050414150 9:5397616-5397638 AGGGAGGGAAGAGGGGAGAGAGG + Intronic
1051906071 9:22096202-22096224 AGAGATGGAACTGGAGAGTGAGG + Intergenic
1052537865 9:29770641-29770663 GGGGAGAGGAGTGGAGAGTGGGG + Intergenic
1053054990 9:34988875-34988897 AGGGACTGAAATGGAGACCGCGG + Intergenic
1053140504 9:35679829-35679851 AGGGAGGTCAGTGGACAGTGTGG - Intronic
1053337290 9:37286936-37286958 AGGGAGGGAAGGGGGGAGGGAGG - Intronic
1054881363 9:70148287-70148309 CTGGATAGAAGTGGAGAGTGGGG - Intronic
1056265733 9:84895056-84895078 AGAGAAGGAAGTGAAGGGTGGGG + Intronic
1056740930 9:89255002-89255024 AGGGACTGAAGTGAAGAGTGTGG - Intergenic
1056954575 9:91072065-91072087 AGGGAGGGAGGGAGAGAGTGAGG + Intergenic
1057450573 9:95155289-95155311 GGGGACGGAAGGGGAGAGGAGGG + Intronic
1057531117 9:95847551-95847573 AGGGATGGGGGTGGGGAGTGGGG - Intergenic
1058601047 9:106670686-106670708 AGGTAGGGAAGTGGAGAGGCTGG - Intergenic
1058811015 9:108639589-108639611 AGGGAGGGAGGAGGAGAATGAGG - Intergenic
1059035333 9:110748193-110748215 AGGGAGGGAAGGGAAGAGGGAGG - Intronic
1059595515 9:115715931-115715953 AGAGACAGAATTGGAGAGTGAGG + Intergenic
1059672284 9:116502969-116502991 AGGGAAGGAAGGAGAGAGGGAGG + Intronic
1059750707 9:117244717-117244739 AGGGAGGGAAGGAGGGAGTGAGG + Intronic
1059835528 9:118147845-118147867 AGGGATGGAAGAGGAGATTTAGG + Intergenic
1060106654 9:120877037-120877059 AGGGCCGGGAGGGGAGAGCGTGG + Intronic
1060548228 9:124473118-124473140 AGGGATGGAGGTGGAGTGTGAGG - Intronic
1061164177 9:128912870-128912892 AGGGACGGGAGTTGATGGTGGGG + Intronic
1061291877 9:129655021-129655043 AGGAACGACAGGGGAGAGTGGGG + Intergenic
1062037762 9:134390302-134390324 AGGGACGGCAATGGAGAGGAGGG - Intronic
1062197163 9:135280682-135280704 AGGGGCGGTAATGGAGACTGGGG + Intergenic
1062480909 9:136750949-136750971 AGGGAGGGAAGGAGAGAGGGAGG + Intergenic
1202802073 9_KI270720v1_random:9429-9451 AGGGAAGGAAGGGGGGAGGGAGG - Intergenic
1185536062 X:862472-862494 AGAGAGGGAATTGGAGAATGCGG - Intergenic
1185708479 X:2282705-2282727 AGGGAAGGAAGGAGAGAGGGAGG + Intronic
1186020603 X:5251161-5251183 AGGGAGGGAAGTGGAGGGCAGGG + Intergenic
1186069982 X:5808895-5808917 AGGGACGGAGGGAGAGAGGGAGG - Intergenic
1186200847 X:7153583-7153605 AGAGAAGGAAGCAGAGAGTGAGG - Intergenic
1186200858 X:7153657-7153679 AGGGAGGGAAGGAGAGAGGGAGG - Intergenic
1186200892 X:7153814-7153836 AGGGAAGGAAGCAGAGAGGGAGG - Intergenic
1186200908 X:7153895-7153917 AGGGAAGGAAGCAGAGAGGGAGG - Intergenic
1186264586 X:7818618-7818640 AGGGAGGGAAGAGGAGGGGGAGG + Intergenic
1186489410 X:9959726-9959748 ACGGAGGGAAGGAGAGAGTGAGG - Intergenic
1186694530 X:12016174-12016196 AGAGAAGAAAGTTGAGAGTGAGG + Intergenic
1186698623 X:12065530-12065552 TGAGATGGAAGTGGAGAGGGAGG - Intergenic
1187043812 X:15625639-15625661 AGGGAGGGAGGTGGAGATGGAGG + Intergenic
1187321835 X:18246112-18246134 GAGGAAGGATGTGGAGAGTGAGG + Intronic
1190417964 X:50199777-50199799 AGGGAGGGGAGTGGGGAGAGAGG - Intronic
1190828841 X:54043031-54043053 GGGGTGGGGAGTGGAGAGTGTGG - Intronic
1191056672 X:56248908-56248930 AGTGACAGAAAAGGAGAGTGAGG - Intronic
1191937744 X:66443101-66443123 GGGGAGAGAATTGGAGAGTGGGG - Intergenic
1192551108 X:72054305-72054327 AGAGATGGGAGTGGAGATTGGGG - Intergenic
1194451822 X:94052807-94052829 AGGGAGGGAAGGGAAGAGTGAGG - Intergenic
1194755154 X:97730731-97730753 AGGGAGGGAAGGAGAGAGAGGGG - Intergenic
1195244607 X:102983985-102984007 AGGGTTGGAAGGGGAGACTGAGG - Intergenic
1195923032 X:110002005-110002027 AGGCACTGAAGTGTGGAGTGGGG + Intergenic
1196065351 X:111458149-111458171 AGGGGCTGAAGTGGAGATTTTGG + Intergenic
1197172005 X:123444796-123444818 AGGGAGGGAAGAAGAGAGGGAGG - Intronic
1197720930 X:129744184-129744206 AGGGAGGGAAGTAGAGAGCATGG + Intronic
1198040844 X:132850605-132850627 AGGGATGGAGGTGGAGATAGAGG + Intronic
1198416493 X:136425531-136425553 AGGGATGGAAATGGAGATTTTGG + Intergenic
1199039328 X:143092808-143092830 AGAGAAGGAAGTGGTGAGTAGGG + Intergenic
1199338446 X:146646947-146646969 AGGGAGGCAAGTGCAGAGTCGGG - Intergenic
1199519573 X:148720309-148720331 AGGGAAGGAAGGAGAGAGGGAGG - Intronic
1199550665 X:149057542-149057564 AGGGAGGGAAGTGGATTCTGTGG + Intergenic
1199703441 X:150403289-150403311 AGGGACTGAGGTGGGGTGTGGGG + Intronic
1201452967 Y:14136132-14136154 GGAGAGGGAAGTGGAGAGGGAGG - Intergenic
1202366963 Y:24172174-24172196 AAGGAAGGAGCTGGAGAGTGTGG + Intergenic
1202373443 Y:24213309-24213331 AAGGAAGGAGCTGGAGAGTGTGG - Intergenic
1202497338 Y:25456811-25456833 AAGGAAGGAGCTGGAGAGTGTGG + Intergenic
1202503819 Y:25497949-25497971 AAGGAAGGAGCTGGAGAGTGTGG - Intergenic