ID: 933215827

View in Genome Browser
Species Human (GRCh38)
Location 2:79629075-79629097
Sequence AAGGGACGGAAGTGGAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 595
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 539}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933215827_933215841 22 Left 933215827 2:79629075-79629097 CCCACTCTCCACTTCCGTCCCTT 0: 1
1: 0
2: 3
3: 52
4: 539
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
933215827_933215836 11 Left 933215827 2:79629075-79629097 CCCACTCTCCACTTCCGTCCCTT 0: 1
1: 0
2: 3
3: 52
4: 539
Right 933215836 2:79629109-79629131 TTCCCCTATGCCAGCCATATTGG 0: 1
1: 0
2: 2
3: 7
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933215827 Original CRISPR AAGGGACGGAAGTGGAGAGT GGG (reversed) Intronic
901893196 1:12286022-12286044 AAGGGAGGGGAGGGGAGAGGAGG - Intronic
902244460 1:15111166-15111188 AAGGGAGGGGAGTGGTGTGTAGG - Intronic
902622531 1:17658880-17658902 AAGCCAGGCAAGTGGAGAGTTGG + Intronic
902811886 1:18892653-18892675 AGGGGAGGGGAGTGGAGAGAAGG - Intronic
902816088 1:18917574-18917596 AAGGCATGGAGGTGGAGAGAGGG + Intronic
903331630 1:22599828-22599850 AGGGGAGGGAAGAGGAGAGGAGG + Intronic
903419732 1:23209976-23209998 AGGGGAAGGAAGTGGTGACTGGG + Intergenic
903668698 1:25022897-25022919 GAGGGAGGGAAGGGGAGAGGGGG - Intergenic
905354600 1:37372636-37372658 AAGGGGAGGAGGTGGAGGGTGGG - Intergenic
906141845 1:43538455-43538477 CAGTGACAGAAGTGGAGAGAAGG + Intronic
906947823 1:50310487-50310509 AAAGGATGGTAGAGGAGAGTGGG - Intergenic
907050542 1:51327060-51327082 GTGGGAGGGAAGGGGAGAGTGGG - Intronic
907237317 1:53061621-53061643 CAGGGATGGGAGTGGAGGGTGGG + Intergenic
907721980 1:56980684-56980706 AAAGGATGGAAGAGGAGAGGAGG - Intergenic
908262495 1:62349624-62349646 AAGGGAGGGGAGAGGAGGGTAGG + Intergenic
908354119 1:63315200-63315222 AAGGGATGGAAGAAGAGAGAAGG - Intergenic
908358345 1:63344064-63344086 AAGGGAGGGAGGGGGAGAGGGGG - Intergenic
908468902 1:64422874-64422896 AAGGGATGGAAGTGGGGAGAGGG + Intergenic
911478347 1:98402630-98402652 AAGGGAGGGAAGAGGAGGGGAGG - Intergenic
912376470 1:109213798-109213820 GAGGGAGGGGAGGGGAGAGTGGG - Intergenic
912554045 1:110503472-110503494 GAGGAACCGAAGTGTAGAGTGGG + Intergenic
912661812 1:111538494-111538516 AAGGGCCAGATGTGGGGAGTAGG - Intronic
913093286 1:115494354-115494376 AAGGGAAGTAGGTGGAGGGTAGG + Intergenic
914713788 1:150237674-150237696 TGGGGAAGGAAGTGGAAAGTGGG + Intergenic
914751804 1:150539782-150539804 AAGGGAGGGAAGTGGAGGGAGGG + Intergenic
915426738 1:155833672-155833694 AAGGGAAGGAAGGGGAGGGGAGG + Intronic
915609933 1:156983660-156983682 GTGGGAAGGAAGTGAAGAGTGGG - Intronic
915724536 1:158008174-158008196 GAGGGAGAGAAGGGGAGAGTGGG + Intronic
915974292 1:160374989-160375011 AGGAGAAGGAGGTGGAGAGTGGG + Intergenic
915987887 1:160484566-160484588 AAGGGAAGGGGTTGGAGAGTTGG - Intergenic
917683096 1:177387721-177387743 AAGGAAGGGTAGTGGGGAGTGGG - Intergenic
918331405 1:183464262-183464284 AAGGGAGGGAAGGGGAGGGGAGG + Intergenic
918604175 1:186401578-186401600 AAGGGAGGGAAGGGGAGGGAAGG - Intronic
918812891 1:189142801-189142823 AGGGGACCGAAGGGAAGAGTGGG - Intergenic
919570463 1:199242506-199242528 AAGGGACAGGAGAGGAGAGATGG + Intergenic
920419327 1:205820455-205820477 AGGGGAGGGAAGGGGAGAGTGGG - Intergenic
920987084 1:210901086-210901108 AAGAGATGTAAGTAGAGAGTTGG - Intronic
921825856 1:219671161-219671183 GAGGGAAGGAAGTGGAGGGTGGG + Intergenic
922776455 1:228216332-228216354 AATGGACGGAAGGGGAGACAAGG - Intronic
922933936 1:229409821-229409843 AAGGGACCAAAGTGCAGAGAAGG + Intergenic
923001185 1:230007530-230007552 TAGGGCCGGAAGGGGAGAGCTGG + Intergenic
1062958002 10:1552708-1552730 GAGGGAGGGAAGGGGAGAGGAGG + Intronic
1062958009 10:1552727-1552749 GAGGGAGGGAAGGGGAGAGAAGG + Intronic
1063153367 10:3356388-3356410 AAGGGAGGGAAGGGAAGAGAAGG - Intergenic
1063225694 10:4013206-4013228 AAGGAAAGGAAGGGGAGAGGAGG - Intergenic
1063692106 10:8296807-8296829 AGGGGAGGGAAGCGGAGAGGAGG - Intergenic
1063692116 10:8296832-8296854 AGGGAAGGGAAGTGGAGAGGAGG - Intergenic
1065156391 10:22874246-22874268 CAGAGGCTGAAGTGGAGAGTTGG - Intergenic
1065220487 10:23491473-23491495 AAGGGAGGGAAGGGGAGGGGAGG - Intergenic
1065656716 10:27959175-27959197 AGGGGAGGGGAGTGGAGAGGAGG + Intronic
1066045890 10:31595340-31595362 AAGGGAAGGAAGGGGAGGGGAGG + Intergenic
1066204963 10:33180027-33180049 AAAGGACGGAAGTGGAAGGACGG - Exonic
1066443502 10:35460971-35460993 GAGGGAGGGATGTGAAGAGTGGG + Intronic
1067440822 10:46308424-46308446 AGGGGAGGGGAGTGGAGAGGAGG - Intronic
1067557893 10:47285067-47285089 AAGGGAGGGAAGGGGAGGGAGGG + Intergenic
1070479523 10:76868854-76868876 AAGGGAAGGATCTGGAGAATGGG - Intergenic
1071487816 10:86114343-86114365 CAGGGAAGGCAGTGGAGAGGTGG + Intronic
1072782332 10:98259303-98259325 AAAGGAGGGAAGGGGAGGGTAGG + Intronic
1073744046 10:106445518-106445540 AAGGGAGGGAAGGGGAGGGGAGG + Intergenic
1073744058 10:106445548-106445570 ATGGGACGGGAGGGGAGTGTAGG + Intergenic
1074189938 10:111127008-111127030 AAGGGATGGCAGGGCAGAGTGGG - Intergenic
1074302839 10:112248543-112248565 AAGGGATAGAAATGGAGAGAAGG - Intergenic
1074409232 10:113211115-113211137 AAGGGAGGGGAGGGGAGAGGAGG - Intergenic
1074430518 10:113390452-113390474 AAGGGAAGGGGGTGGAGAGTAGG - Intergenic
1074874027 10:117600623-117600645 AAGGGAGGGAAGTGGATGGATGG - Intergenic
1075812836 10:125238467-125238489 AGGGGAAGCAAGTGGAGAGAGGG + Intergenic
1076007970 10:126963532-126963554 AAAGGACGGAAGTGAAGGGAGGG - Intronic
1076558769 10:131347304-131347326 AAGGAAGGGAAGAGGAGAGAAGG - Intergenic
1077571925 11:3346501-3346523 AAGGGAAGGGAGAGGAGAGGAGG + Intronic
1077594130 11:3516950-3516972 GAGGGAAGGAAGAGGAGAGGAGG - Intergenic
1078203723 11:9209479-9209501 AAGGGGCAGATGTGGAGAGGTGG - Intronic
1078431964 11:11295092-11295114 AAGGGACAGAAGTGGAAAGAAGG + Intronic
1078483430 11:11700298-11700320 AAGAGACAGAAGAGGAGGGTTGG - Intergenic
1078826526 11:14935484-14935506 AGGGGAGGGAAGGGGAGAGGAGG + Intronic
1078826533 11:14935504-14935526 AGGGGAGGGAAGAGGAGAGGAGG + Intronic
1078882679 11:15467366-15467388 AATGGAAGGTAGGGGAGAGTTGG - Intergenic
1079368233 11:19827959-19827981 AAGGGGAGGAAGGGGAGGGTGGG + Intronic
1079470596 11:20774078-20774100 AAGGGAGGGAAGGGGACAGGAGG - Intronic
1079501477 11:21105807-21105829 AAGGGAGGGAAGGGGAGAGGAGG - Intronic
1079564439 11:21864842-21864864 AGGGGAGGGAAGGGGAGAGAAGG - Intergenic
1079564447 11:21864862-21864884 AGGGGAGGGAAGGGGAGAGAAGG - Intergenic
1079564455 11:21864882-21864904 AGGGGAGGGAAGGGGAGAGAAGG - Intergenic
1079564463 11:21864902-21864924 AGGGGAGGGAAGGGGAGAGAAGG - Intergenic
1079564471 11:21864922-21864944 AGGGGAGGGAAGGGGAGAGAAGG - Intergenic
1079564479 11:21864942-21864964 AGGGGAGGGAAGGGGAGAGAAGG - Intergenic
1079564487 11:21864962-21864984 AGGGGAGGGAAGGGGAGAGAAGG - Intergenic
1079788862 11:24710983-24711005 AAGGGAGGGAGGTAGAGAGGGGG + Intronic
1079914359 11:26350017-26350039 AAGAGACGGGAAAGGAGAGTTGG + Intronic
1080388732 11:31825681-31825703 ATGGGATAGGAGTGGAGAGTGGG + Intronic
1080833247 11:35916031-35916053 CAGGGAAGGAAGTGGGGAGGTGG + Intergenic
1081245977 11:40766854-40766876 AAGGGAGGGAAGGGGAGGGAAGG + Intronic
1081623093 11:44630725-44630747 CAGGGAAGGAAGAGGAGAGGTGG + Intergenic
1081846848 11:46246953-46246975 AAGGAAAGGAAATGGAGAGAGGG - Intergenic
1081903608 11:46651416-46651438 AAGGCACAGAAGTGGAGGGCAGG + Intronic
1081965523 11:47166856-47166878 ACCGGAGGGAAGTGGAGAGCCGG - Exonic
1082915675 11:58433893-58433915 AAGGGTAGGAAGTGGGGAGGGGG + Intergenic
1083755641 11:64790280-64790302 CAGGGAAGGAATTGGTGAGTGGG + Intronic
1084249914 11:67889676-67889698 AAGGGAAGGAAGAGGAGAGGAGG - Intergenic
1084352009 11:68608856-68608878 AAGGGAAAGGAGTGGAGAATGGG + Intronic
1084463754 11:69310340-69310362 TAGGGACGGCAGTGGAGATATGG - Intronic
1084822885 11:71705803-71705825 AAGGGAAGGAAGAGGAGAGGAGG + Intergenic
1085076448 11:73597092-73597114 CAGGGATGGAAATGGAGTGTGGG - Intronic
1085730541 11:78994671-78994693 AAGGGTGGGAAATGGAGAATCGG + Intronic
1086461940 11:87014661-87014683 AAAGGATGGAAGAGGAGAGTAGG - Intergenic
1088031917 11:105261960-105261982 AAGGGAGGGAAGAAGAGAGGCGG + Intergenic
1088339345 11:108745178-108745200 AAGGGAAGGAAGGGGAGGGGAGG - Intronic
1088394093 11:109347969-109347991 AAGGGAGGGAAGGGGAGGGAAGG - Intergenic
1088596414 11:111444264-111444286 GAGGGAGGGAAGAGGAGAGAAGG + Intronic
1088634657 11:111808257-111808279 AAGGGACGGTTGGGGAGAGGAGG - Intronic
1089032807 11:115350401-115350423 AAGGCAGGGAAGGGGAGAGGTGG + Intronic
1089203348 11:116738985-116739007 AAGGGAGGGAAGCAGAGAGCAGG - Intergenic
1089227588 11:116938529-116938551 ACGGGACGGAAGGGGAGGGGAGG + Intronic
1089690267 11:120182775-120182797 AAGGAAGGGAAGGGGAGAGGAGG + Intronic
1090231667 11:125111490-125111512 AAGGGAGAAAAGTGGAGGGTCGG - Intronic
1090851986 11:130578854-130578876 AAGAGAAGGCAGAGGAGAGTGGG - Intergenic
1091172593 11:133531708-133531730 AAGGGAGGGAGGAGGAGAGTGGG + Intronic
1091581177 12:1790941-1790963 AAAGGACGGAATTGGAGCGAGGG - Intergenic
1091823896 12:3495100-3495122 AATGGGCTGAAGAGGAGAGTGGG - Intronic
1092420223 12:8325086-8325108 AAGGGAAGGAAGAGGAGAGGAGG - Intergenic
1092671027 12:10860798-10860820 AAGGGAGGGAAGGGGAGGGAAGG + Intronic
1093565729 12:20600920-20600942 AAGGTACAGAATTGGAGAGAGGG + Intronic
1095196848 12:39329250-39329272 AAGGGTCAGAAGCAGAGAGTAGG - Intronic
1095327125 12:40908285-40908307 AGGGGAAGGAAGGGGAGAGGAGG - Intronic
1095492249 12:42746821-42746843 AAGGGACTGAATTGGGTAGTGGG + Intergenic
1095745407 12:45652862-45652884 AGGGGAGGGAAGTGGAGGGGAGG + Intergenic
1097816550 12:64080696-64080718 AAGGGAAGGAAGAAGAGACTGGG - Intronic
1098769675 12:74537780-74537802 GAGGGGCGGAAGCGGAGAGGCGG + Intergenic
1098918923 12:76285210-76285232 AAGGGTAGGAAGTGGAAACTGGG + Intergenic
1099053724 12:77811750-77811772 AAGGGAAAGAAGTGGATAGGTGG + Intergenic
1099434488 12:82627294-82627316 AAGGCAAGGAAGTGGAGAGTTGG + Intergenic
1100256312 12:92886573-92886595 AAGGGAGGGGAGGGGAGAGAAGG + Intronic
1100373345 12:93990106-93990128 AGGAGACGGAAATGGAGAGTTGG + Intergenic
1100951056 12:99850321-99850343 CAGGGAAGAAAGGGGAGAGTAGG - Intronic
1101157388 12:101940583-101940605 AAGGGAGGGGAGGGGAGAGGAGG + Intronic
1101858373 12:108462965-108462987 AGGGGAAGGAAGGGGAGGGTAGG + Intergenic
1101877801 12:108607081-108607103 AAGGGAGGGAAGGGAAGAGAAGG - Intergenic
1101952623 12:109188380-109188402 AAGGGATGGAAGGGGAGGGGAGG - Intronic
1101975248 12:109352368-109352390 GGGGGAAGGAGGTGGAGAGTGGG - Intronic
1102584093 12:113911070-113911092 GAAGGAAGGAAGTGGAGACTGGG - Intronic
1102781626 12:115570555-115570577 GAGGGACGGAGGGGGAGAGGCGG + Intergenic
1102902255 12:116647461-116647483 AAGGAAAGGAAGGGGAGAGGAGG - Intergenic
1103023272 12:117553821-117553843 AGGGGAGGGAAGGGGAGAGGAGG - Intronic
1103304234 12:119951722-119951744 AAGGGAGGGAAGGGGAGGGGAGG + Intergenic
1103304286 12:119951862-119951884 AAGGGAGGGAAGGGGAGGGGAGG + Intergenic
1103304309 12:119951926-119951948 AAGGGAGGGAAGGGGAGGGGAGG + Intergenic
1104084742 12:125464046-125464068 AAGGGAGGGATCTGGAGAGGGGG - Intronic
1105471425 13:20698322-20698344 AGGGGACGGAAGGGGAGAGAAGG + Intergenic
1105567081 13:21560020-21560042 AAGGGACAGAAGTAGTAAGTAGG - Intronic
1106022471 13:25928710-25928732 AAGGGAGGGAAGAAGAGAGCTGG - Intronic
1106409679 13:29502684-29502706 AAAGGAGGGAAGCGGAGAGCTGG - Intronic
1107820049 13:44277562-44277584 AAGGGAGGGAAGAGGAAAGAAGG + Intergenic
1107949871 13:45452327-45452349 CAGGAAAGGAAGTGAAGAGTAGG - Intergenic
1109070237 13:57756507-57756529 AAGGGACAAAAGTGGAGAATAGG + Intergenic
1109886663 13:68553597-68553619 AATGGATGGAATTGGAGAGATGG + Intergenic
1110321456 13:74164907-74164929 TGGGGAGGGTAGTGGAGAGTAGG + Intergenic
1110608749 13:77465094-77465116 AAAGGATGGAAAGGGAGAGTTGG - Intergenic
1110983368 13:81932562-81932584 AAGGGACGGAAGGGGATGGGAGG + Intergenic
1111086430 13:83380732-83380754 AAGGGAGGGAAGGAGGGAGTGGG - Intergenic
1112033220 13:95475549-95475571 AAGGGAGGGAAGTGGCCAGCAGG + Intronic
1115078634 14:29422775-29422797 AAGGGAAGGGAGGGGAGAGGAGG - Intergenic
1115164402 14:30431441-30431463 AAGGGAAGGAAGGGGATGGTTGG - Intergenic
1115805369 14:37045031-37045053 ATGGGTGGGAAGAGGAGAGTGGG - Intronic
1116095548 14:40362415-40362437 AAGAGAAGGAAGAGGAGGGTTGG - Intergenic
1117765203 14:59074912-59074934 AAGGAAGGGAAGGGGAGAGGAGG + Intergenic
1118709982 14:68510973-68510995 ATGGGAGGGAGGTGGAGACTGGG - Intronic
1119143221 14:72286787-72286809 AAGGGAGGGAAGGGGAGGGGAGG - Intronic
1119437764 14:74609426-74609448 AAGGTGGGGAAGTGGAGCGTGGG - Intronic
1120705859 14:87744806-87744828 ATGGGGAGGAAGTGGAGAGGGGG - Intergenic
1120880758 14:89413831-89413853 AAGGGAGGGGAGAGGAGAGGAGG + Intronic
1121260349 14:92561357-92561379 CAGGGAGGGAGGTGGATAGTGGG - Intronic
1122444416 14:101758956-101758978 AAGGGATGCAAGTGGAGGGCAGG - Intergenic
1122730421 14:103793082-103793104 AAGGGAAGGAAGGGGAGGGGAGG + Intronic
1124332623 15:28833126-28833148 ACGGGAGTGAAGTGGAGAGAGGG - Intergenic
1124852995 15:33359370-33359392 AAGGGAGGAAGGTGAAGAGTCGG - Intronic
1125011483 15:34880865-34880887 ATGGGACGGATGAGCAGAGTGGG + Intronic
1125179322 15:36863749-36863771 AACATACTGAAGTGGAGAGTAGG - Intergenic
1125193817 15:37023723-37023745 AAGGCACGGAAATGCAGACTTGG - Intronic
1126937094 15:53722755-53722777 AAGGGAAGGAAATGGAGAAGGGG + Intronic
1127591963 15:60433833-60433855 AAGCGAGGCAGGTGGAGAGTAGG + Intronic
1127635209 15:60862602-60862624 AAAGGAAAGAAATGGAGAGTGGG + Intronic
1127658717 15:61080175-61080197 GAGGTAGGGAAGTGGGGAGTTGG - Intronic
1127797908 15:62454284-62454306 AAGGGAAGGAAGAGGTGAGGGGG + Intronic
1127951812 15:63815151-63815173 AAGAGACGAATGTGGAGAGTTGG - Intronic
1127960588 15:63887650-63887672 AAAGGACGGAAGTGGAGAGCAGG - Intergenic
1129234133 15:74213755-74213777 AAGGGAAGGGAGTGGGAAGTGGG + Intergenic
1129271936 15:74423573-74423595 AAGAGAGGGAAGGGTAGAGTAGG - Intronic
1129760635 15:78127398-78127420 AAGGGAGGGAAGGAGAGAGGGGG + Intronic
1130226483 15:82062421-82062443 AAGGGAAGGAAGAGGAGGGAAGG + Intergenic
1130910419 15:88266734-88266756 GAGGGACAGAAGAGAAGAGTGGG - Intergenic
1131871560 15:96769539-96769561 AAGGAAGGGAAGTGGAGGCTCGG + Intergenic
1131978825 15:97975224-97975246 GAGGGAAGGAAATGGAGAGGAGG - Intergenic
1132220682 15:100102888-100102910 GAGGGTCGGAAGTGAAGAGTGGG - Intronic
1132299500 15:100767344-100767366 AAGGGAGGGAAGGGGAAAGGAGG - Intergenic
1132915623 16:2341763-2341785 ACGGGACGGGAGTGGGGAGGTGG + Intergenic
1133605162 16:7379816-7379838 AAGGGAAGGAAGAGGAGGGAGGG - Intronic
1133846184 16:9455813-9455835 TAGGGAAGGAAGAGGAGAGTCGG - Intergenic
1134242028 16:12513301-12513323 AAGGGAGAGAAGGGGAGAGGAGG - Intronic
1134340517 16:13340861-13340883 AAGAGAGTGGAGTGGAGAGTGGG - Intergenic
1134754059 16:16650741-16650763 AAGGGAGGGAAGAGGAGGGGAGG - Intergenic
1134992000 16:18708303-18708325 AAGGGAGGGAAGAGGAGGGGAGG + Intergenic
1135168756 16:20164656-20164678 AAGGGAAGGAAGGAGAGAGAAGG - Intergenic
1135200775 16:20436237-20436259 AGGGGAGGGGAGAGGAGAGTGGG - Intronic
1136450388 16:30351384-30351406 AAGGTCCGGAAGTGGAAAGCAGG - Exonic
1137588245 16:49677352-49677374 AGGGGAGGGAAGGGGAGGGTAGG + Intronic
1137947815 16:52751156-52751178 AGGGGAAGGAAGGGGAGAGGTGG + Intergenic
1138656450 16:58494388-58494410 AAGGGAGGGAAGGGGGGAGGTGG - Intronic
1139305294 16:65980692-65980714 AAGGGAAGGAGGTGGGGAGATGG - Intergenic
1139332236 16:66202282-66202304 AAAGGTGGGAAGTGGAGGGTGGG + Intergenic
1139358827 16:66383852-66383874 AAGGGGAGGAAGTGGAGACAGGG - Intronic
1139475875 16:67202322-67202344 AGGGGACGGAAGGGCAGAGAGGG + Intronic
1140553431 16:75892861-75892883 AAGGGACAGAAGGGGAAAGGGGG - Intergenic
1141223404 16:82092295-82092317 CAGGGAGGGGAGTGGAGAGAAGG - Intronic
1141647089 16:85373411-85373433 AAGGGAGGGAAGAGCAGAGGAGG + Intergenic
1141920031 16:87129511-87129533 AATGGAAGGAAGTGGAGACGTGG - Intronic
1142526928 17:549466-549488 ACGGGGCAGAAGTGGAGGGTGGG + Intronic
1142872618 17:2830929-2830951 AAGGGAGGGAAGGGGAGTGGAGG - Intronic
1142872629 17:2830954-2830976 AAGGGAGGGAAGGGGAGGGGAGG - Intronic
1142872644 17:2830984-2831006 AGGGGAGGGAAGTGGAGGGAAGG - Intronic
1143021252 17:3918128-3918150 AAGGGAGGGAAGGGAAGAGAGGG + Intergenic
1143129968 17:4671934-4671956 CAGGGACGGAGGAGGAGCGTGGG - Exonic
1143292140 17:5839315-5839337 AAGGGAATGAAGTGGAGAGAGGG - Intronic
1143484934 17:7248917-7248939 AAGGGACAGAAGTGGACAGGTGG - Intronic
1143532149 17:7511781-7511803 AGGGGAGGGAAGTGGAGGGGAGG - Intronic
1143611570 17:8020781-8020803 AAGGGTCAGAGGTGGAGTGTGGG - Intergenic
1143985831 17:10913141-10913163 CAGGGACGGAAGTGTGGAGGTGG + Intergenic
1144259043 17:13499860-13499882 ATGGGATGGGTGTGGAGAGTTGG + Intronic
1145878612 17:28338330-28338352 TTGGGAGGGAAGAGGAGAGTAGG + Intronic
1146569504 17:33940512-33940534 AAGGGATGGATGTGGAGTGAAGG - Intronic
1146639515 17:34529516-34529538 CAGGGAAGGAAGTGGAGGGTGGG - Intergenic
1146642229 17:34550124-34550146 GAGGGAGGGAGGTGGACAGTTGG + Intergenic
1147702986 17:42407534-42407556 AAGGGAAGGAAGTTGGGAGAGGG - Intronic
1148047249 17:44751699-44751721 AAGGGAAGGAGGTGAAGAGGAGG - Exonic
1148189593 17:45669284-45669306 GAGGGAAGGAAGTGGAGGGAGGG - Intergenic
1148653745 17:49268089-49268111 AGGGGACAGCAGGGGAGAGTCGG - Intergenic
1149206000 17:54248918-54248940 AAGGCACTGAAGTAGACAGTGGG - Intergenic
1150750083 17:67853348-67853370 AAAGGAAGGAAGTGCAGAGGAGG - Intronic
1151007105 17:70450385-70450407 AAAGGAGGGAAGTGGAGGGGAGG + Intergenic
1151007119 17:70450426-70450448 AAGGGAAAGAAGTGGGGAGTGGG + Intergenic
1151229568 17:72674140-72674162 AAGGGAGGGAAGGAGGGAGTAGG - Intronic
1151386429 17:73757915-73757937 AGGGGATGGAAGGGGAGAGGAGG - Intergenic
1151386458 17:73757990-73758012 AAGGGAGGGGAGGGGAGAGAAGG - Intergenic
1152358950 17:79821329-79821351 AGGAGAAGGAAGTGGAGAGAAGG - Intergenic
1152851356 17:82638213-82638235 AAGGGAGGGGAGGGGAGAGGAGG + Intronic
1153538816 18:6133499-6133521 GAGGGAGGGAAGGGGAGAGGAGG - Intronic
1154323714 18:13374959-13374981 AAGGGAAGGGAGTGGAGGCTGGG - Intronic
1155243721 18:23887296-23887318 AAGGGAAGGATGTGGGGAGTGGG + Intronic
1155996147 18:32333231-32333253 AAGGAAGGGGAGTGGAGAGGGGG + Intronic
1156076741 18:33288244-33288266 AGGGGAGGGAAGGGGAGAGGAGG - Intronic
1156390537 18:36646575-36646597 AAGATACTGAAGTGGAGAGAAGG + Intronic
1157204031 18:45683281-45683303 AAGAAATGGAGGTGGAGAGTGGG - Exonic
1158230925 18:55254212-55254234 AAGGGCTGGAAGTGGAGGGATGG + Intronic
1159343608 18:67169376-67169398 GAGGGAGGGAAGAGGAGAGGAGG + Intergenic
1159442118 18:68494821-68494843 AAGGAAGGGAAATGGAGGGTGGG - Intergenic
1159453109 18:68626974-68626996 AAGGGAGGGGAGGGGAGAGGAGG + Intergenic
1159550818 18:69894465-69894487 AAGGGAAGGGAGGGGAGAGAAGG + Intronic
1159943427 18:74426174-74426196 GAGGGTGGGAAGTGGAGAGGGGG - Intergenic
1159954105 18:74507409-74507431 AAGGCCCAGAAGTGGAGAGCAGG - Intronic
1161256168 19:3311003-3311025 AAGGGAGGGAGGGGGAGAGAGGG - Intergenic
1161401544 19:4067796-4067818 GAGGGGCGGAGGTGGGGAGTGGG + Intergenic
1162011713 19:7820500-7820522 AAGGGAGGGCAGTGGCAAGTGGG - Intergenic
1162412212 19:10513356-10513378 CAGGGACGGAGGGGGAGAATGGG - Exonic
1162876806 19:13626649-13626671 AAGGGAAGGGAGGGGAGAGGAGG + Intergenic
1163336705 19:16677553-16677575 AAGGGAGGGAAGGGGAGGGGAGG - Intronic
1163351098 19:16777288-16777310 AAGGGAGGGAAGAGAAGAGGAGG + Intronic
1163351377 19:16778004-16778026 AAGGGAAGGAAGGGGAGGGAAGG + Intronic
1163607364 19:18282268-18282290 AAGAGACGGGAGGGGAGAGGAGG + Intergenic
1165065272 19:33225003-33225025 AAGGGACGGAGGTTCAGAGCAGG - Intronic
1166347462 19:42175508-42175530 AAGGGAAGGAGGTGGAGATAAGG + Intronic
1166985041 19:46654728-46654750 GAGGGAGGGAAGTGGGGAGGAGG + Intronic
1166987461 19:46669900-46669922 AGGGGATGGAAGTGGATAGTAGG + Intergenic
1166999828 19:46739195-46739217 CAGGGATGGCAGTGGAGAGGAGG + Intronic
1167004478 19:46766716-46766738 AAGAGAGGGAGGAGGAGAGTGGG + Intronic
1167236439 19:48318754-48318776 AAGTGATGGAAGGGGAGAGGCGG - Exonic
1167293352 19:48636131-48636153 AAGGGACGGAGACGCAGAGTGGG + Intronic
1167687254 19:50964082-50964104 GAGGGAGAGAAGGGGAGAGTGGG - Intronic
1168079881 19:54002032-54002054 AGGGGAAGGAAGGGGAGAGAAGG - Intronic
1168517185 19:57017845-57017867 AAGGGAGGGAAGGGGGGAGATGG - Intergenic
925097593 2:1219687-1219709 AAGGGAGGGGAGTGGAGGGGAGG + Intronic
925405479 2:3603216-3603238 AAGGGACAGGAGGGGAGAGAGGG - Intronic
925542001 2:4976586-4976608 GAGGGACCGAAGTGGAGAGCTGG + Intergenic
925733277 2:6938230-6938252 AAGGGAGGGGAGGGGAGAGGGGG - Intronic
925868669 2:8250845-8250867 GAGGGACGAAATAGGAGAGTGGG - Intergenic
925881062 2:8352998-8353020 AGGGGAGGGAAGAGGAGAGGAGG + Intergenic
925881071 2:8353018-8353040 AGGGGAGGGAAGGGGAGAGGAGG + Intergenic
925881080 2:8353038-8353060 AGGGGAGGGAAGGGGAGAGGAGG + Intergenic
925881097 2:8353078-8353100 AAGGGAGGGAAGGGGAGAGGAGG + Intergenic
925881106 2:8353098-8353120 AGGGGAGGGAAGGGGAGAGGAGG + Intergenic
925895423 2:8468027-8468049 AAGTTCCGGAGGTGGAGAGTGGG - Intergenic
926017882 2:9470332-9470354 AAGCGGGGGAAGTGGGGAGTGGG - Intronic
927204553 2:20598992-20599014 TAGGGAGGGCAGTGGGGAGTGGG + Intronic
927434097 2:23052487-23052509 CAGGGACTGAAGTGTAGAGGAGG - Intergenic
927733723 2:25499231-25499253 AAAGGGGGGCAGTGGAGAGTGGG + Intronic
927989052 2:27434646-27434668 AAGGGACGGAAGGAGCTAGTGGG + Intronic
928133877 2:28673490-28673512 AAGGGAGGGAAGGGGAGGGAAGG + Intergenic
928164773 2:28962767-28962789 AAGGGAGGGAAGGGGAGGGGAGG - Intronic
928921624 2:36533968-36533990 AAGGGAAGGAAGGAGAGAGGGGG + Intronic
930389665 2:50745402-50745424 AAGGGAGGGAAGGGGAGGGGAGG - Intronic
932383990 2:71313697-71313719 AGGGAAGGGAAGGGGAGAGTAGG - Intronic
932416473 2:71576511-71576533 AAGGGCCAGAGGTGGACAGTGGG + Intronic
933215827 2:79629075-79629097 AAGGGACGGAAGTGGAGAGTGGG - Intronic
933715705 2:85358499-85358521 AAGGGATGGAAGTGAGGAGAGGG + Intronic
934077277 2:88439052-88439074 AGGGAACGGAAGTGGAGGCTGGG - Intergenic
934494015 2:94782005-94782027 ATGGGAGGGATGGGGAGAGTTGG - Intergenic
935038649 2:99404300-99404322 AGGGGAGGGGAGGGGAGAGTGGG - Intronic
936263597 2:110982412-110982434 AAGGGAGGGAAGAGGAGGGGAGG - Intronic
936447443 2:112607194-112607216 AAGGGAGGGGAGGGGAGAGAAGG - Intergenic
938555853 2:132423613-132423635 AGGGGATGGAAGTGGGGAGCAGG - Intronic
938783465 2:134605703-134605725 AAGGGAAGGAAGAGGAGGGGAGG + Intronic
938957708 2:136314612-136314634 AGGGGAGGGAAGGGGAGAGGAGG - Intergenic
938957717 2:136314632-136314654 AGGGGAGGGAAGGGGAGAGGAGG - Intergenic
938957726 2:136314652-136314674 AGGGGAGGGAAGGGGAGAGGAGG - Intergenic
938957735 2:136314672-136314694 AGGGGAGGGAAGGGGAGAGGAGG - Intergenic
938957744 2:136314692-136314714 AGGGGAGGGAAGGGGAGAGGAGG - Intergenic
938957756 2:136314717-136314739 AGGGGAGGGAAGGGGAGAGGAGG - Intergenic
938957765 2:136314737-136314759 AGGGGAGGGAAGGGGAGAGGAGG - Intergenic
939029010 2:137047834-137047856 AAGGGAAGGGAGTGGAGTTTTGG + Intronic
939591107 2:144064934-144064956 AAGGGACTGAGGAGGAGAGGGGG + Intronic
939634122 2:144560491-144560513 AGGGGAGGGAAGGGGAGGGTAGG - Intergenic
939960107 2:148558829-148558851 GAAAGAGGGAAGTGGAGAGTGGG + Intergenic
940344921 2:152619218-152619240 AAAGGACAGAAGTGGACAGTTGG - Intronic
940616578 2:156056064-156056086 AAGGAAGGGAAGTGGAAAATAGG + Intergenic
941095745 2:161238262-161238284 GAGGGACGGGAGGGGAGAGTTGG - Intergenic
941748229 2:169109801-169109823 GAGGGATGGAAGTGGGGAGGGGG - Intergenic
942017938 2:171836051-171836073 AAGGGAGGGAAGGAGAGAGAAGG - Intronic
942939303 2:181597990-181598012 AAGGAACGGATATGGAGAGGGGG + Intronic
944295119 2:198052996-198053018 AAGAGAAGGCAGTGGAGACTTGG + Intronic
944323191 2:198372950-198372972 AGGGGAGGGGAGAGGAGAGTAGG - Intronic
944432988 2:199656525-199656547 AAGGGAGGGAAGGGAAGAATTGG - Intergenic
945367795 2:208977876-208977898 AAGGGAGGGAAGGGGAGGGGAGG - Intergenic
945895428 2:215475990-215476012 CAGGGTCCGAAGGGGAGAGTGGG - Intergenic
946079647 2:217106543-217106565 AAGGGAGGGAAGAGGAGGGAAGG - Intergenic
946430040 2:219621138-219621160 AAGGGACTGAAGGGGGAAGTAGG - Intergenic
948575278 2:238945930-238945952 CAAGGAGGGAAGTGCAGAGTGGG - Intergenic
948683894 2:239658741-239658763 AAGGGACGGAAGGGGAGCAGAGG - Intergenic
948684001 2:239659057-239659079 AAGGGACGGAAGGGGAGCAGAGG - Intergenic
948722719 2:239911715-239911737 AAGAGAGGGAAGGGGAGAGAAGG - Intronic
1168873088 20:1147574-1147596 AAGGCACTGAACTGGAGAGATGG + Intronic
1169022760 20:2341795-2341817 AAGGGAAGGAAGGTGAGAGATGG - Intergenic
1169078847 20:2782066-2782088 AAGGGAAAGAAGTGGAGATGGGG + Intergenic
1169160357 20:3372378-3372400 AAGGGCAGGATGTGGAGAGAGGG + Intronic
1169453974 20:5736049-5736071 AAGAGAAGGAAGGGGAGAGGAGG + Intergenic
1169768027 20:9169666-9169688 AAGGGAAGGAAGTGGGCAGTGGG + Intronic
1169904574 20:10588786-10588808 GAGGGAAGGAAGGGGAGATTTGG + Intronic
1170931131 20:20770345-20770367 AAGGGAGGGGAGGGGAGAGGAGG - Intergenic
1172565502 20:35927108-35927130 CAGGGAAGGAAGTGGAGCCTTGG + Intronic
1172749349 20:37239069-37239091 ATGGGAGGGAAGTGGAGGGAAGG + Intronic
1173065089 20:39703026-39703048 AAGGGAGGGTAGGGGAGAGGAGG + Intergenic
1173175442 20:40761675-40761697 AAGGGAAGGAAGTGGGGGCTAGG - Intergenic
1174017774 20:47502329-47502351 TAGGGACAGAAGGGGAAAGTGGG - Intronic
1175444867 20:59013132-59013154 AGGGGAGGGAAGGGGAGAGGTGG - Intergenic
1175625952 20:60488368-60488390 AAGGGAAGGAAGTGGCCTGTGGG + Intergenic
1175714428 20:61246196-61246218 AGGGGAAGAAGGTGGAGAGTAGG - Intergenic
1175722687 20:61296853-61296875 GAGGGACGGGGGTGGAGAATGGG + Intronic
1179084896 21:38207720-38207742 AAGGGAGAGAAGGGGAGAGAAGG - Intronic
1179084994 21:38208002-38208024 GAGGGAAGGAGGTGGAGAGGAGG - Intronic
1179216851 21:39374895-39374917 AGGGGACAGAAGTGGAGGGGAGG - Intergenic
1179286082 21:39978401-39978423 AATGGAGGGACGTGGAGACTCGG + Intergenic
1179618813 21:42599063-42599085 ATGGGAGCGATGTGGAGAGTGGG - Intergenic
1180252061 21:46596494-46596516 TGAGGACGGAAGTGGAGAGTTGG - Intergenic
1181583227 22:23839145-23839167 TAGGGGCGGAAAGGGAGAGTGGG + Intergenic
1182320537 22:29476026-29476048 AAGGGAATGCAGTGGAGAGAGGG + Intergenic
1182515469 22:30856219-30856241 AAGGGGCAGAAATGGAGAGATGG - Intronic
1182663725 22:31943115-31943137 AAGGGAGGGAACTGGAGACCAGG - Intronic
1183046367 22:35223721-35223743 AAGGGACTGAAGTGCAGAGGAGG - Intergenic
1183698811 22:39438202-39438224 AAGGGAAGGAAGGAGGGAGTGGG - Intergenic
1184695773 22:46138340-46138362 ATGGGATGGAAGTGGAGAGCTGG + Intergenic
1184708262 22:46230667-46230689 AAGGCACGGCTGTGGGGAGTTGG + Intronic
1185055806 22:48577713-48577735 AAGGGAGGGAAGTGGACACCAGG - Intronic
1185144537 22:49123870-49123892 AAGGGATGGAACTGGAGTGTGGG - Intergenic
949107433 3:217589-217611 AGGGGAAGCAAGTGGAGAGGCGG + Intronic
949382820 3:3464997-3465019 AAGGGAGGGAAGAGGGGAGATGG + Intergenic
950108827 3:10405537-10405559 AGGGGAGGGAAGAGGGGAGTGGG + Intronic
950186855 3:10950742-10950764 AATGGACCAAAGTGGAGGGTGGG - Intergenic
950480848 3:13242852-13242874 GAGGGAGGGAAGAGGAGAGGAGG + Intergenic
950576408 3:13834671-13834693 AAGGGAGCCATGTGGAGAGTGGG - Intronic
950667464 3:14506061-14506083 AAAGGCAGGAAGTGGAGGGTGGG - Intronic
951705323 3:25538563-25538585 TAGGGCCTGACGTGGAGAGTAGG + Intronic
952026791 3:29092490-29092512 AAAGGATGGTTGTGGAGAGTGGG + Intergenic
952078814 3:29731951-29731973 AAGGGACGGAGGTACAGAGGGGG - Intronic
952619445 3:35319765-35319787 AAGAAACAGAGGTGGAGAGTAGG + Intergenic
953019233 3:39103377-39103399 AAGGGAGGGAAGGGTAGACTGGG + Intronic
953164491 3:40452934-40452956 AAGGGACGGATGTGAAGGGCTGG - Intergenic
954013356 3:47663156-47663178 AAGGGAGGGTAGGGGAGAGGAGG + Intronic
954036684 3:47854634-47854656 AAGGGAGGAAAGAGGAGAGAGGG + Intronic
954299185 3:49690148-49690170 AAGAGACTGAACTGCAGAGTAGG + Intronic
955099272 3:55831380-55831402 AAGGGAAGGAAGGGGAGGGGAGG + Intronic
956242579 3:67147126-67147148 AAGGGAGGGGAGGGGAGAGGAGG - Intergenic
956328866 3:68082831-68082853 AATGGAAGGAAGTGGAGCTTCGG + Intronic
956463439 3:69494920-69494942 AAGGGAAGGGAGGGGAGAGGAGG + Intronic
956622248 3:71233232-71233254 AGGGGAGGGAAGGGGAGAGGAGG + Intronic
957064170 3:75507628-75507650 AAGGGAAGGAAGAGGAGAGGAGG - Intergenic
957381608 3:79437328-79437350 AAGGAACGGAAGGGAAGAGAAGG - Intronic
957572087 3:81959882-81959904 AAGTTTTGGAAGTGGAGAGTTGG + Intergenic
957876754 3:86156761-86156783 AGGGGAGGGAAGTGGAGGGGAGG - Intergenic
958255907 3:91324567-91324589 AGGGGAAGGAAGTGCAGATTTGG + Intergenic
959128954 3:102327929-102327951 GAGGGACGGCAGGGGAGAGAAGG - Intronic
960040714 3:113147851-113147873 AAGGGAGTGAAGTCTAGAGTTGG - Intergenic
961056054 3:123789680-123789702 AAGGAACGGAAGGGAAGAGATGG + Intronic
961289183 3:125831757-125831779 AATGGAAGGAAGAGGAGAGGAGG + Intergenic
961353137 3:126316572-126316594 TAGGGAAGGAAGTCCAGAGTGGG + Intergenic
961897904 3:130184275-130184297 AAGGGAAGGAAGAGGAGAGGAGG - Intergenic
961940912 3:130636850-130636872 AAGGGAAGGAAGGGGAGGGGGGG - Intronic
961972856 3:130988848-130988870 CAGAGACTGAAGTGGAGACTTGG - Intronic
962076813 3:132090761-132090783 GAGGGAGGAAACTGGAGAGTGGG + Intronic
962302970 3:134259585-134259607 AAGGGGAGGAAAAGGAGAGTGGG - Intergenic
962400953 3:135058350-135058372 AAGGGACAGGAGAGGAGAGGTGG - Intronic
962402927 3:135077174-135077196 CAGGGAGAGAAGGGGAGAGTGGG + Intronic
963103220 3:141624606-141624628 AGGGGAGGGAAGGGGAGAGGAGG + Intergenic
964881250 3:161425854-161425876 AGGGGAGGGAAGGGGAGAGGAGG + Intergenic
966429792 3:179819441-179819463 ATGGGAATGAAGTGGAGACTTGG - Intronic
966882969 3:184360325-184360347 AAGGGACGGAGATGGAGAGGTGG + Intronic
967210785 3:187166628-187166650 AAGTGAAGGAACTGGAGAATGGG + Intronic
968168280 3:196486701-196486723 AAGGAACGGGAGTGGAGAGGTGG + Intronic
968972052 4:3801032-3801054 AGGGCACTGGAGTGGAGAGTGGG + Intergenic
969171671 4:5368892-5368914 AAGGAAGAGAAGAGGAGAGTGGG - Intronic
969516665 4:7651957-7651979 AAGGGAAGGGAGCGGAGAATAGG + Intronic
969804893 4:9599646-9599668 AAGGGAGGGAAGAGGAGAGGAGG + Intergenic
969979014 4:11135070-11135092 AAGGGAAGGGAGGGGAGAGGAGG - Intergenic
970313703 4:14809206-14809228 AAGGGAAGGGAGGGGAGAGAAGG + Intergenic
972771594 4:42202467-42202489 AAGGGAGGGGAGGGGAGAGGAGG + Intergenic
973638050 4:52877891-52877913 AAGGGCCGGATGTGGAGTGCTGG - Intronic
975615586 4:76243654-76243676 GAGGAACAGAAGTGGAGAATAGG - Intronic
976753727 4:88477233-88477255 AAGGGAGGGGAGGGGAGAGGAGG + Intronic
977725858 4:100296330-100296352 AAGGGAAGGAAGTGTTGACTAGG - Intergenic
978285202 4:107069389-107069411 AAGGGAGGAAAGGAGAGAGTTGG - Intronic
981265259 4:142775530-142775552 AAGGAAGGGAAGAGGAGAGTAGG - Intronic
981667619 4:147247183-147247205 AAGGGAAGGAATGGGAGAGAGGG + Intergenic
981672600 4:147304144-147304166 TAGGGAGTGAAGTTGAGAGTTGG - Intergenic
981842300 4:149126641-149126663 AAGAGAAGGAAAGGGAGAGTGGG + Intergenic
982033200 4:151321333-151321355 AAGGGCAAGAAGTGGAGGGTGGG - Intronic
982244271 4:153334281-153334303 AAGCAAGGTAAGTGGAGAGTAGG + Intronic
984233131 4:177124180-177124202 GAGAGAGGGAAGTGGAGAGAGGG - Intergenic
984261981 4:177453416-177453438 AGGGGAGGGGAGGGGAGAGTAGG - Intergenic
984262002 4:177453461-177453483 AAGGGAGGGGAGGGGAGAGCAGG - Intergenic
984699433 4:182809200-182809222 CAGGGAGGGAAGTGGCGAGCAGG + Intergenic
985666946 5:1186246-1186268 AAAGGACAGAAGGGGAGAGAGGG - Intergenic
985911315 5:2885670-2885692 AAGGGATGGAAATGGTGAGAAGG - Intergenic
986229085 5:5845001-5845023 AAGAGACAGAAGTGTAGATTGGG - Intergenic
986391401 5:7290642-7290664 ACGGGAGTGAAGTGGAGAGAGGG - Intergenic
987079796 5:14416730-14416752 AAGGGTGGGAAGGGGAGAGAGGG - Intronic
987615088 5:20262986-20263008 AAGGGAGGGAAGGGGAGGGGAGG + Intronic
988438151 5:31200676-31200698 AAGGGAGGGAAGTTGGGAGAAGG + Intronic
989185277 5:38618711-38618733 GAAGGACGGAAGAGGAGAATTGG - Intergenic
990886074 5:60594847-60594869 AAGGGACGGAAGGGAAGGGAGGG + Intergenic
991032309 5:62095544-62095566 AAGGGAGGGAAGGAGAGAGAAGG + Intergenic
991225553 5:64266738-64266760 AAGGGGAGGGAGTAGAGAGTAGG + Intronic
991540305 5:67720460-67720482 AGGGGAGGGAAGAGGAGAGCAGG - Intergenic
992415298 5:76546877-76546899 AAGAGGTGGGAGTGGAGAGTGGG + Intronic
992423919 5:76635851-76635873 AAGGGAGGGGAGAGGAGGGTAGG + Intronic
994681936 5:102899053-102899075 AGGGGAGGGAAGTGGAGGGGAGG - Intronic
995321503 5:110839618-110839640 AAGGGAAGGAACAGGAGAGGAGG - Intergenic
995365276 5:111352671-111352693 GAGGGAGGGAAGGGGAGAGGGGG + Intronic
995609500 5:113893889-113893911 AAGGGATGTCACTGGAGAGTGGG - Intergenic
996408488 5:123130110-123130132 AGGGGAGGGAAGGGGAGAGGAGG - Intronic
998368578 5:141646766-141646788 AAAGGAGGGAACTGGAGAGAAGG - Intronic
998761357 5:145435445-145435467 AAGGGAGTGATGGGGAGAGTGGG + Intergenic
998983414 5:147729090-147729112 AAGGGAAGGAAGAGGAGAGAAGG + Intronic
999116987 5:149173099-149173121 AAGGGACGGAGTTGGAGTGGTGG + Intronic
999704122 5:154255862-154255884 AAGGGAAGGCAGGGGAGAGGAGG - Intronic
999932698 5:156451039-156451061 AAGGGAAGGGAGGGGAGAGATGG - Intronic
1000958570 5:167571941-167571963 CAGGGAGGGAAGTGGTGACTGGG - Intronic
1000990668 5:167908430-167908452 AGGGGAGGGAAGGGGAGAGGAGG - Intronic
1001123405 5:168997999-168998021 GAGGGAGGGAAGGGGAGAGATGG - Intronic
1001306519 5:170578357-170578379 GAGGGACAGAAGTGGAGGGTGGG + Intronic
1001309725 5:170602266-170602288 AGAGGAGGGAAGTGGTGAGTGGG - Intronic
1001793477 5:174481924-174481946 AAGGGAAGGAAGGGAAGAGAGGG + Intergenic
1003560890 6:7179111-7179133 AAGGGAAGGAAGTGGAGAGGAGG - Intronic
1004125033 6:12865018-12865040 AAGGGCAAGAAGTGGAGGGTAGG + Intronic
1004233334 6:13852059-13852081 AAGGAAGGGAAGTGGAGGGCAGG - Intergenic
1004478721 6:15998945-15998967 AAGGGACGGGGGTGGGGGGTGGG + Intergenic
1004488482 6:16091030-16091052 ATGGGACAGATATGGAGAGTAGG + Intergenic
1004772296 6:18797321-18797343 AAAGAATAGAAGTGGAGAGTGGG + Intergenic
1005073846 6:21888078-21888100 AAGGGAGGGAGGTGGAGAGAAGG - Intergenic
1005608512 6:27500233-27500255 AAGGGAAGGAAGGAGAGAGAAGG + Intergenic
1006589042 6:35141029-35141051 GAGGAGCGGAAGTCGAGAGTGGG + Intronic
1007701978 6:43771002-43771024 AAGAGAAGGAAGAGGAGAGGGGG + Exonic
1007708181 6:43804322-43804344 AAGGGAATGAAGTGAAGAGAGGG + Intergenic
1007828771 6:44622134-44622156 GAGGGAAGGAAGGGGAGAGAAGG - Intergenic
1008490067 6:52077390-52077412 AGGGGAGGGAAGGGGAGACTAGG - Intronic
1008999434 6:57696606-57696628 AGGGGAAGGAAGTGCAGATTTGG - Intergenic
1009187920 6:60596010-60596032 AGGGGAAGGAAGTGTAGATTTGG - Intergenic
1011114335 6:83874120-83874142 AAGGGAGGGGAGGGGAGAGGAGG - Intronic
1011980191 6:93365053-93365075 AAGGGAGAGAAGTGGAGAGATGG - Intronic
1013355387 6:109341680-109341702 AAGGGAAGGAAGTGAAAAGATGG + Intergenic
1014228280 6:118873175-118873197 AAGGGAGGGGAGGGGAGAGGAGG + Intronic
1014310668 6:119797056-119797078 AAGGGAAGGAAGTAAAGGGTTGG + Intergenic
1015041631 6:128727650-128727672 AAGGGAGGGAAGGGAAAAGTAGG + Intergenic
1015392335 6:132696780-132696802 AAGGGAGGGGAGGGGAGAGGAGG + Intronic
1017286386 6:152681212-152681234 AAGGGAGGGGAGGGGAGAGGAGG + Intergenic
1017300043 6:152846517-152846539 AAAAGACAAAAGTGGAGAGTGGG + Intergenic
1017332719 6:153218424-153218446 AGGGGAGGGAAGTGGAGGGGAGG - Intergenic
1017332737 6:153218464-153218486 AAGGGAGGGAAATGGAGGGGAGG - Intergenic
1017536398 6:155351331-155351353 AAGAGAGGGAAGTGGGGAGATGG + Intergenic
1018509151 6:164506309-164506331 AAGGGAGGGGAGTGGAGGGGAGG - Intergenic
1018739310 6:166715096-166715118 AAGGAAAGGCAGTGGAGGGTGGG + Intronic
1019885479 7:3900726-3900748 AGGGGAGGGAAATGGAGAGGGGG - Intronic
1020271579 7:6599759-6599781 AGGGGCGGGAAGTGGAGAGAGGG - Intronic
1020570207 7:9850821-9850843 AAGGGAGGGGAGTGGAGGGAGGG + Intergenic
1020598399 7:10241590-10241612 ATGGGAGAGAAGTGGAGAGAGGG - Intergenic
1020605144 7:10327498-10327520 AAAGGAGGGCAGTGGAGAGAGGG + Intergenic
1020667834 7:11069641-11069663 AAGGGAGGGGAGAGGAGAGGAGG - Intronic
1020752505 7:12160428-12160450 AATGAACGGAAGTGGAAATTTGG + Intergenic
1020950006 7:14663673-14663695 AAGGGAGGGGAGTGGAGGGGAGG - Intronic
1022753191 7:33253765-33253787 AGGGGAGGGAAGTGTATAGTTGG + Intronic
1022795507 7:33728377-33728399 AAGGGAAGGAAGGGAAGGGTAGG - Exonic
1023156416 7:37256630-37256652 AAGGGAGGGGAGGGGAGAGGAGG + Intronic
1023367815 7:39481754-39481776 AAGGGAGGGAAGGGAAGAGTTGG - Intronic
1023673909 7:42609950-42609972 AAGGGAGGGAAATGGAGGGCAGG + Intergenic
1023701948 7:42900956-42900978 AAGGGAGGGAAGGGGAGTGGAGG + Intergenic
1026225485 7:68436573-68436595 AGGGGACGGAAGAGGAGGGGAGG - Intergenic
1026245059 7:68612296-68612318 AAGGGAGGGGAGTGGAGGGGAGG - Intergenic
1026448719 7:70508297-70508319 AAGGGAGGGAAGTGAAGAAAGGG + Intronic
1026580360 7:71611130-71611152 AAGGCACTGGAGTAGAGAGTAGG - Intronic
1029538209 7:101168164-101168186 AAGGGAGGGATGTGGAGTGGGGG - Intergenic
1030562477 7:111107175-111107197 AAGGGAGGGAAGGAGAGAGAGGG - Intronic
1031649660 7:124272315-124272337 AGGGTAAGGAAGTGGAGAATAGG + Intergenic
1031775417 7:125902712-125902734 AAGGGAAGAAAGTGGAAAATAGG + Intergenic
1032449988 7:132022425-132022447 AAGGGAGGGAAGGGGAGGGAAGG - Intergenic
1033825755 7:145187108-145187130 AAGGAAGGGAAGGGGAGAGGAGG - Intergenic
1033843976 7:145410003-145410025 AAGAGCCTGAAGTAGAGAGTTGG + Intergenic
1034451402 7:151139070-151139092 AAGGGACAGGAGAGGAGAGCTGG - Intronic
1034626077 7:152493851-152493873 AAGGGAGGGGAGGGGAGAGGAGG - Intergenic
1034653829 7:152712976-152712998 AAGGGAGGGGAGGGGAGAGGAGG - Intergenic
1034993216 7:155561041-155561063 AAGAGAGGGACGGGGAGAGTAGG + Intergenic
1035049555 7:155990601-155990623 GAGGTAGGGAAGAGGAGAGTTGG + Intergenic
1035960810 8:4135356-4135378 GAGGGAAGGAAGGGGAAAGTGGG + Intronic
1037187482 8:16081529-16081551 AAAGGAAGGGAATGGAGAGTTGG - Intergenic
1037467301 8:19172721-19172743 AAGGGACGGGAGGGGAGAGGGGG + Intergenic
1037983414 8:23271713-23271735 AAAGGAGGGAATTGGAAAGTTGG + Intronic
1038591378 8:28841274-28841296 TAGGGGAGGTAGTGGAGAGTAGG - Intronic
1038789654 8:30657476-30657498 AAATGACGGAAGTGGGGAGGTGG + Intronic
1038945008 8:32349557-32349579 GAGGGATGGAAGTGAAGAGTAGG + Intronic
1040681903 8:49820738-49820760 AGGGGATGGAAGGGGAGAGGAGG + Intergenic
1041008439 8:53518183-53518205 AAGTGAAGGAAGGGGAGAGGTGG + Intergenic
1042063610 8:64848597-64848619 AGGGGACGGAAGGGGAGAGGAGG + Intergenic
1042663980 8:71186026-71186048 AAGGGAGGGAAAGGGAGAGAGGG - Intergenic
1044408673 8:91860439-91860461 AGGGGGAGGAAGTGGAGATTTGG + Intergenic
1045409666 8:101904408-101904430 AAAGGAAGGAAGTGGGGAGATGG - Intronic
1046800087 8:118416750-118416772 AAGGGGTGGAAGAAGAGAGTTGG - Intronic
1046886392 8:119371995-119372017 AAGGGTCCGAAGTGGAAAGGTGG + Intergenic
1047497237 8:125417158-125417180 CTGGGAAGGAAGTGGAGAGAGGG + Intergenic
1047679934 8:127244330-127244352 AAGGGAGGGGAGAGGAGAGGAGG + Intergenic
1049440489 8:142607297-142607319 CAGGGAGGGGAGTGGAGGGTGGG + Intergenic
1049654994 8:143793400-143793422 AAGGGACGGGGGTAGAGAGGGGG + Intronic
1049737690 8:144218655-144218677 AGGGGACGGGAGGGGAGAGGAGG - Intronic
1049968512 9:800611-800633 AGAGGAGGGAAGTGAAGAGTGGG - Intergenic
1050125491 9:2352719-2352741 AAGGGAGGGGAGGGGAGAGGAGG + Intergenic
1050255140 9:3786082-3786104 AAGGGAGGGGAGGGGAGAGGAGG - Intergenic
1050302900 9:4276535-4276557 AGGGGACGGAAGGGGAGGGGAGG + Intronic
1050792083 9:9485847-9485869 AAGGGAAGGCAGTAGAGATTTGG - Intronic
1051664048 9:19451523-19451545 AAGGGCCTAAAGTGGAGTGTAGG - Exonic
1052629483 9:31019144-31019166 AGGGGAAGGAAGGGGAGAGAAGG + Intergenic
1053287912 9:36861751-36861773 CAGGGAGGGAAGTGGGGAGTGGG + Intronic
1053663053 9:40297999-40298021 ATGGGAGGGATGGGGAGAGTTGG + Intronic
1053913558 9:42928529-42928551 ATGGGAGGGATGGGGAGAGTTGG + Intergenic
1054375179 9:64444223-64444245 ATGGGAGGGATGGGGAGAGTTGG + Intergenic
1054521562 9:66078285-66078307 ATGGGAGGGATGGGGAGAGTTGG - Intergenic
1055186035 9:73455312-73455334 AAGGGAGGGGAAGGGAGAGTAGG - Intergenic
1056098180 9:83275263-83275285 AAGGCAGAGAAGTGGAGAGAAGG - Intronic
1056265732 9:84895055-84895077 AAGAGAAGGAAGTGAAGGGTGGG + Intronic
1056618025 9:88185213-88185235 AAGAGGCTGAAGTGAAGAGTTGG + Intergenic
1057450572 9:95155288-95155310 AGGGGACGGAAGGGGAGAGGAGG + Intronic
1058250220 9:102684950-102684972 GAGGGACAGAATTAGAGAGTGGG - Intergenic
1058885555 9:109319784-109319806 TAGGGACGGAAGGGGAGCGCCGG + Intronic
1059450180 9:114366677-114366699 AGGGGAGGGAAGAGGAGAGGAGG + Intronic
1059534569 9:115069484-115069506 AAGGGAGGGAATGGGAGAGGAGG + Intronic
1059780167 9:117517930-117517952 AAGACACGGAAGAGGAGGGTGGG - Intergenic
1060112714 9:120918099-120918121 AAGGCACGGTATTGGCGAGTTGG - Intronic
1060473886 9:123970910-123970932 AAGGGAGGGAAGGGGAGGGGAGG - Intergenic
1061164176 9:128912869-128912891 AAGGGACGGGAGTTGATGGTGGG + Intronic
1061291876 9:129655020-129655042 AAGGAACGACAGGGGAGAGTGGG + Intergenic
1061947160 9:133914771-133914793 AGGGGACGGGAGGGGAGAGGAGG + Intronic
1062037763 9:134390303-134390325 AAGGGACGGCAATGGAGAGGAGG - Intronic
1062181436 9:135193232-135193254 AAGGGAGGGAGGGGGAGAGCTGG - Intergenic
1185726452 X:2425883-2425905 AAGGGAAGGAACAGGCGAGTAGG + Intronic
1186020602 X:5251160-5251182 GAGGGAGGGAAGTGGAGGGCAGG + Intergenic
1186264598 X:7818655-7818677 AGGGGAGGGAAGAGGAGAGAAGG + Intergenic
1186655366 X:11606019-11606041 AAGGGAGGGAAGAGGAGAACAGG + Intronic
1189030074 X:37441417-37441439 AAGGGCCGGAAGTGGGTATTTGG - Intronic
1189539232 X:41969184-41969206 GAGGGACAGAAGTGAAAAGTGGG - Intergenic
1190712573 X:53081302-53081324 AAGGGGCAGAAGTGGAAGGTAGG + Intergenic
1191937745 X:66443102-66443124 AGGGGAGAGAATTGGAGAGTGGG - Intergenic
1191965792 X:66756917-66756939 ATAGGAGGGAAGAGGAGAGTAGG + Intergenic
1192190972 X:68990983-68991005 AAGGGCAGGAAGTGGAGGGGAGG - Intergenic
1194256162 X:91637413-91637435 TAGGGGTGGAGGTGGAGAGTGGG - Intergenic
1194755155 X:97730732-97730754 AAGGGAGGGAAGGAGAGAGAGGG - Intergenic
1194981249 X:100443001-100443023 GAGGGTGGGAAGTGGAGAATGGG + Intergenic
1196886564 X:120251340-120251362 AGGGGACGGAAGGGGAGGATGGG - Intronic
1197064169 X:122219459-122219481 CAGGGACCCAAGTGCAGAGTGGG - Intergenic
1198321270 X:135521107-135521129 AAGGGAGGGGAGGGGAGAGATGG + Intronic
1198618326 X:138481527-138481549 AAGTGAGGGAAGTGGAAGGTTGG - Intergenic
1199039327 X:143092807-143092829 GAGAGAAGGAAGTGGTGAGTAGG + Intergenic
1199338447 X:146646948-146646970 AAGGGAGGCAAGTGCAGAGTCGG - Intergenic
1200246209 X:154527436-154527458 AAGGGATGGGAGTGGAGAAGGGG - Intergenic
1200574892 Y:4876700-4876722 TAGGGGCGGAGGTGGAGAGTGGG - Intergenic