ID: 933215829

View in Genome Browser
Species Human (GRCh38)
Location 2:79629083-79629105
Sequence ATAAGGGGAAGGGACGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1147
Summary {0: 1, 1: 0, 2: 6, 3: 89, 4: 1051}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933215829_933215841 14 Left 933215829 2:79629083-79629105 CCACTTCCGTCCCTTCCCCTTAT 0: 1
1: 0
2: 6
3: 89
4: 1051
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
933215829_933215836 3 Left 933215829 2:79629083-79629105 CCACTTCCGTCCCTTCCCCTTAT 0: 1
1: 0
2: 6
3: 89
4: 1051
Right 933215836 2:79629109-79629131 TTCCCCTATGCCAGCCATATTGG 0: 1
1: 0
2: 2
3: 7
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933215829 Original CRISPR ATAAGGGGAAGGGACGGAAG TGG (reversed) Intronic
900663564 1:3798562-3798584 ATGATGGGAAGGGTCGGATGTGG + Intergenic
901209537 1:7516669-7516691 AAAAGAGGAAGGGACTGAGGTGG + Intronic
901233986 1:7657559-7657581 AAAAGGGGAAGGGGCCGAGGGGG + Intronic
901735827 1:11311561-11311583 ATAAGGGGAAGGGACTCTGGAGG - Intergenic
901953908 1:12770435-12770457 ATAAGGGAGAAGGAGGGAAGTGG - Intergenic
902042790 1:13504757-13504779 GGGAGGGGAAGGGAGGGAAGGGG + Intronic
902072466 1:13751963-13751985 ATATGGGGAGGGGAGGGGAGGGG - Intronic
902733493 1:18384769-18384791 ATGAGGAGATGGGATGGAAGGGG + Intergenic
902767433 1:18626740-18626762 AGAAAAGGAAGGGAAGGAAGAGG + Intergenic
903047238 1:20574054-20574076 AGGAGGGGAAGGGAGGGAAGGGG + Intergenic
903134857 1:21302812-21302834 ATTTGGGGAAGGTACGGGAGGGG - Intronic
903144119 1:21358923-21358945 AACAGGAGAAGGGACGGGAGAGG + Intergenic
903805691 1:26004202-26004224 GGAAGGGGAGGGGAGGGAAGCGG - Intergenic
903935263 1:26890811-26890833 CCAAGGGGAGGGGACGGGAGGGG + Exonic
903964329 1:27077042-27077064 AGAAGGGGATGGGAAGGGAGGGG - Intergenic
904014397 1:27408826-27408848 GGAAGGGGAGGGGAGGGAAGAGG + Intronic
904318141 1:29679399-29679421 ATAAGGGGGACGGAATGAAGAGG + Intergenic
904375566 1:30080190-30080212 AGAAGGGAAGGGGAGGGAAGGGG - Intergenic
904440082 1:30524515-30524537 AGAAGGGGAGGGGAGGGGAGGGG + Intergenic
904484262 1:30814459-30814481 ATAAGAGGAAGGGAAAGGAGGGG - Intergenic
904626426 1:31807389-31807411 AAAAGGGGAGGGGAGGGGAGGGG + Intronic
904770956 1:32881185-32881207 ATTAGGGGAAAGGAAGGTAGAGG + Intergenic
905256407 1:36688369-36688391 AAAAGGGGAGGGGAAGGGAGGGG + Intergenic
905269637 1:36778988-36779010 AGAAGGGGAGGGGAGGGAAGGGG + Intergenic
905341667 1:37282385-37282407 AGGAGGGGAAGGGAGGGGAGGGG + Intergenic
905366193 1:37452926-37452948 ATGAGGGGAGGGGAGGGGAGAGG - Intergenic
905731070 1:40299918-40299940 AGGAGGGGAAGGGGGGGAAGGGG - Intergenic
905807714 1:40888885-40888907 GTGAGGGGAGGGGAGGGAAGGGG - Intergenic
906073412 1:43034443-43034465 GGAAAGGGAAGGGAGGGAAGCGG - Intergenic
906517815 1:46449800-46449822 AGCAGGGGCAGGGAGGGAAGGGG + Intergenic
906527050 1:46500064-46500086 GTTAGGGGAAGGGAAAGAAGAGG + Intergenic
906627828 1:47340010-47340032 GGAAGGGGAGGGGAGGGAAGAGG - Intronic
906765512 1:48427873-48427895 AAAAGGTGAAGGGAAGGAAAGGG - Intronic
906986239 1:50686550-50686572 AGGAGGGGAGGGGAGGGAAGAGG + Intronic
907222534 1:52917476-52917498 ATAAGCAGAAAGGAAGGAAGAGG + Intronic
908082730 1:60598407-60598429 GAAAGGGGATGGGAGGGAAGGGG + Intergenic
908082802 1:60598612-60598634 AGAAGAGGACGGGAGGGAAGGGG + Intergenic
908254183 1:62289144-62289166 ATAAGTGGAAAAGACGGATGAGG + Intronic
908262387 1:62349341-62349363 AGGAGGGGAAGGGAGGGGAGGGG + Intergenic
908625059 1:66030958-66030980 AGAAGAGGGAGGGAGGGAAGAGG + Intronic
908899742 1:68942819-68942841 ATAAGGGGAAGGGATTGTAGAGG - Intergenic
908965983 1:69763583-69763605 ACAAGGGGAAGGGGTGGAAAGGG + Intronic
910486101 1:87715926-87715948 AGGAGAGGAAGGGACGGGAGAGG + Intergenic
910613645 1:89172189-89172211 ATTAGGGGAAGCCAGGGAAGTGG - Intronic
910993603 1:93080057-93080079 ATAAGGGGAACACACTGAAGTGG + Intronic
911086513 1:93982233-93982255 AGAGGGGGCAGGGAGGGAAGGGG - Intergenic
911620880 1:100065583-100065605 AAAAGGGGAAGGGAAGGGAAGGG - Intronic
911764386 1:101656587-101656609 ATAATGGGAAGGGATGGGAAAGG + Intergenic
911767964 1:101701740-101701762 AGAAAGGGAAGGGAAGGGAGGGG - Intergenic
912228702 1:107766814-107766836 ATAAGGGGAAGGCAGAGGAGAGG + Intronic
912454636 1:109789285-109789307 GTAAGGGGTAGTGAGGGAAGTGG - Intergenic
912917110 1:113826393-113826415 AGAAGGGGAAGGGAAGGGAAGGG + Intronic
913484335 1:119320144-119320166 AGAAGGGGAAGGGAGGGGAGGGG - Intergenic
913647227 1:120869927-120869949 AGAGGGTGAAGGGATGGAAGGGG - Intergenic
914079415 1:144392935-144392957 AGAGGGTGAAGGGATGGAAGGGG + Intergenic
914099764 1:144573567-144573589 AGAGGGTGAAGGGATGGAAGGGG - Intergenic
914174314 1:145261481-145261503 AGAGGGTGAAGGGATGGAAGGGG + Intergenic
914299225 1:146364114-146364136 AGAGGGTGAAGGGATGGAAGGGG + Intergenic
914528981 1:148502665-148502687 AGAGGGTGAAGGGATGGAAGGGG + Intergenic
914637410 1:149564443-149564465 AGAGGGTGAAGGGATGGAAGGGG - Intergenic
914703583 1:150154103-150154125 CTTAGGGGAAGGGAAGGAAAGGG - Intronic
915474738 1:156147001-156147023 ATATGGGGGAGGGGAGGAAGTGG + Intergenic
915564563 1:156706400-156706422 GTAGGGGGAAGGGAGGGAGGCGG + Intergenic
915604589 1:156942556-156942578 ACAAGGGGTTGGGAAGGAAGTGG - Intronic
915712929 1:157918528-157918550 AAAAGGGGAAGGGCAGGCAGTGG - Intergenic
915756655 1:158267495-158267517 ATGTGGGGAAGGGAAGGAAGTGG + Intergenic
916648431 1:166812361-166812383 AGAGGGAGAAGGGAGGGAAGAGG + Intergenic
917330776 1:173878419-173878441 GAAAGGAGAAGGGAAGGAAGGGG + Intronic
917414994 1:174799716-174799738 TGAAGGGGTAGGGAAGGAAGGGG - Intronic
917734703 1:177909764-177909786 AGAAGGGGAGGGGAGGGGAGGGG + Intergenic
917907458 1:179601414-179601436 ATGAGGGGAAGGGTAGGAAGGGG - Intronic
918243146 1:182637485-182637507 ATATGGGGAAGAGATGGGAGTGG - Intergenic
918331401 1:183464254-183464276 GGAAGGGGAAGGGAGGGAAGGGG + Intergenic
918953581 1:191174446-191174468 AGAAGTGGAAGAGACAGAAGAGG + Intergenic
919161051 1:193831857-193831879 AGATGGGGAAGGGAGGGAGGAGG + Intergenic
919638236 1:200024778-200024800 AGAGGGGGAAGGGAGGGGAGGGG + Intergenic
919982017 1:202647603-202647625 AAGAGGGGAAGGGAGAGAAGAGG + Intronic
920267553 1:204735293-204735315 ACAAGGGGAAGGGGCAGAAAAGG + Intergenic
920330247 1:205202113-205202135 AGAAGGGGAAGGGAAGGGAAGGG + Intronic
920353943 1:205356583-205356605 AGAAGGGGAGGGGCCGGGAGAGG + Intronic
920609997 1:207426562-207426584 AGAAGGGGAGGGGAGGGGAGGGG + Intergenic
920652727 1:207850929-207850951 AGAAGGTGAAGGTACTGAAGTGG + Intergenic
920773316 1:208910788-208910810 ATAAGAGGCAGGGCCAGAAGAGG - Intergenic
921299889 1:213741869-213741891 AGAAATGGAAGGGAAGGAAGAGG + Intergenic
921377647 1:214490883-214490905 GGAAGGGGAGGGGAGGGAAGGGG + Intronic
921440114 1:215175642-215175664 AGAGTGGGAAGGGAGGGAAGGGG - Intronic
922168266 1:223133852-223133874 AAAAGGGGCAGGGACCGAGGGGG + Intronic
922776456 1:228216340-228216362 CAGAGGGGAATGGACGGAAGGGG - Intronic
922925025 1:229341507-229341529 AGGATGGGGAGGGACGGAAGGGG + Intronic
923017883 1:230140722-230140744 AAAAGGGGAAGGGAGGGGTGAGG - Intronic
923404363 1:233645441-233645463 AAAAGGGGAAGAGACAGAGGGGG + Intronic
923930659 1:238692198-238692220 AGAGGGGGAAGGGAGGGAGGGGG + Intergenic
924424100 1:243934198-243934220 AGGAGGGGAATGGAGGGAAGGGG - Intergenic
924424112 1:243934229-243934251 GGAAGGGGAAGGGAAGGCAGGGG - Intergenic
924754807 1:246931555-246931577 GTAGGGGGAAGGGAGGGAGGGGG - Intronic
1062833634 10:622374-622396 AGAAGGGGGAGGGAGGGAGGAGG + Intronic
1063225738 10:4013324-4013346 TGAAGGGGAGGGGAGGGAAGGGG - Intergenic
1063692108 10:8296815-8296837 AGGAGGGGAGGGGAGGGAAGCGG - Intergenic
1064150115 10:12855831-12855853 ATAAGGGGTAGGGGTGGGAGAGG - Intergenic
1064154705 10:12894352-12894374 GGAAGGGGAAGGGAGGGGAGGGG - Intergenic
1064558714 10:16574143-16574165 ATAAGGGGAACAGAAGGGAGTGG + Intergenic
1064818708 10:19298486-19298508 AGAAAGGGAAGGGAAGCAAGGGG + Intronic
1065220491 10:23491481-23491503 GGAAAGGGAAGGGAGGGAAGGGG - Intergenic
1065245373 10:23750956-23750978 AGAAAGGGAAGGGAGGGGAGGGG - Intronic
1065373852 10:25016854-25016876 GAAAGGGGAAGGGACGGTACGGG - Intronic
1065727535 10:28680092-28680114 ATAAAGGTAAGGGTGGGAAGAGG + Intronic
1065972437 10:30816204-30816226 AGAAGGGGAAGGGGGGGAACAGG + Intergenic
1066306077 10:34142562-34142584 ACAAGGGAAAGGAAAGGAAGCGG + Intronic
1066367775 10:34793335-34793357 ATCAGGGAGAGGGAAGGAAGGGG + Intronic
1067283483 10:44890790-44890812 ATGAGTGGAAGAGAAGGAAGAGG - Intergenic
1067293518 10:44961039-44961061 GAAAGAGGAAGGGAGGGAAGAGG + Intronic
1067364011 10:45608141-45608163 GGAAGGGAAAGGGAAGGAAGGGG + Intergenic
1067488898 10:46679242-46679264 ATAAGTGGAAAGGAGGGATGAGG - Intergenic
1067557889 10:47285059-47285081 AGGAAGGGAAGGGAGGGAAGGGG + Intergenic
1067605770 10:47661134-47661156 ATAAGTGGAAAGGAGGGATGAGG + Intergenic
1067922667 10:50476280-50476302 AAAAAGGGAAGGGAAGGGAGGGG + Intronic
1068054096 10:51989390-51989412 ATGACTGGAAGGGACGGATGAGG + Intronic
1068293364 10:55033948-55033970 AGAAGGTGAAGGGACAAAAGGGG - Intronic
1068756395 10:60658966-60658988 GGAAGGGGAAGGGACGGGAGGGG + Intronic
1068777411 10:60883085-60883107 ATAAAGTGAAGGGACGGGAAGGG + Intronic
1069448273 10:68494471-68494493 AGGAGGGGAGGGGAGGGAAGGGG + Intronic
1069474030 10:68717541-68717563 AGAAGGGGAGGGGAGGGGAGAGG - Intergenic
1071222786 10:83489410-83489432 AAAAAGGGAAGGGAGGGGAGGGG - Intergenic
1071342687 10:84663181-84663203 AAAAGGGGAACGGAGGGAAGGGG + Intergenic
1071621329 10:87122493-87122515 ATAAGTGGAAAGGAGGGATGAGG + Intronic
1072161477 10:92771193-92771215 GGAAGGGGAAGGGAGGGGAGGGG - Intergenic
1072203376 10:93180852-93180874 AGCAAGGGAAGGGGCGGAAGTGG - Intergenic
1072645654 10:97251575-97251597 GGAAGGGGAAAGGAAGGAAGGGG + Intronic
1073136701 10:101224376-101224398 AGAGGGGGAAGGGAGGGGAGGGG + Intergenic
1073857804 10:107697519-107697541 GGAAGGGGAGGGGAGGGAAGGGG - Intergenic
1073977751 10:109119546-109119568 GGAAGGGGAGGGGAGGGAAGGGG + Intergenic
1074828002 10:117228508-117228530 AAAAGAGGGAGGGAAGGAAGGGG - Intergenic
1074874029 10:117600631-117600653 AGAAGGAGAAGGGAGGGAAGTGG - Intergenic
1074924439 10:118053168-118053190 GGAAGGGGAAGGGAAGGGAGGGG - Intergenic
1075148054 10:119900027-119900049 ATGAGGGGAAGGGAGGGAAGAGG - Intronic
1075382180 10:122028740-122028762 AGAAGGGGAAGGGAGGAGAGGGG - Intronic
1075575225 10:123572819-123572841 AGAAGGGGAAGGGAGGGGAGGGG + Intergenic
1076232414 10:128832558-128832580 GGAAGGGGAGGGGAGGGAAGGGG + Intergenic
1076274128 10:129182236-129182258 ACCAGGGGAAGGGAAGGGAGAGG - Intergenic
1076296154 10:129386395-129386417 AGAAGGGGAGGGGAGAGAAGGGG + Intergenic
1076441559 10:130484342-130484364 ACAAGGGGAGGGGAGGGGAGGGG + Intergenic
1077232129 11:1462545-1462567 AAAAGGGGAAGGCAAGCAAGAGG - Intronic
1077571933 11:3346518-3346540 AGGAGGGGAGGGGACTGAAGGGG + Intronic
1078191847 11:9097576-9097598 ATAATGGGAAGGGACCCAAAGGG - Intronic
1078198455 11:9156809-9156831 AGAAGGGGAGGGGAGGGAAAGGG + Intronic
1078492171 11:11779531-11779553 ATAAGGGGAAGGGAGGGTGAAGG + Intergenic
1078710085 11:13782929-13782951 ATCAGGGGAAGGGAGGGAAGTGG + Intergenic
1078826524 11:14935476-14935498 GGAAGGGGAGGGGAGGGAAGGGG + Intronic
1078968342 11:16373910-16373932 AGAAGGGGAAGGGAGGGAGAAGG + Intronic
1079501479 11:21105815-21105837 GAGAGGGGAAGGGAGGGAAGGGG - Intronic
1079532568 11:21472832-21472854 AGAAGAGGAAGGGAAGGAAAGGG - Intronic
1079754820 11:24244214-24244236 GGGAGGGGAAGGGAGGGAAGGGG - Intergenic
1079827484 11:25214905-25214927 GGGAGGGGAAGGGATGGAAGGGG - Intergenic
1079893989 11:26095516-26095538 AGAAGAGAAAGAGACGGAAGGGG + Intergenic
1080550343 11:33369123-33369145 AGAAGGGGAGGGGAAGGAAAGGG - Intergenic
1080843693 11:36007511-36007533 ATAAAGGTGAGGGAGGGAAGAGG + Intronic
1081060587 11:38470556-38470578 AGGAGGGGAAGGGAAGGGAGAGG - Intergenic
1081245974 11:40766846-40766868 AGGAAGGGAAGGGAGGGAAGGGG + Intronic
1081461511 11:43276610-43276632 CTCAGGGGAAGGGAGGGAAAGGG - Intergenic
1082062170 11:47870511-47870533 AGAAGGGGAGGGGAGGGGAGGGG - Intergenic
1082188191 11:49209281-49209303 GGAAGGGAAAGGGAAGGAAGGGG + Intergenic
1082284933 11:50307852-50307874 ATAAGGGGATGGGGAGGCAGGGG + Intergenic
1083202840 11:61130882-61130904 AGAAGGGGAGGGGAAGGGAGGGG + Exonic
1083244582 11:61416366-61416388 ATCAGGGGAAGGGCCGAAGGAGG + Exonic
1083250564 11:61464077-61464099 AGAAGGGGAGGGAAGGGAAGAGG - Intronic
1084176114 11:67423208-67423230 ATAAATGGAAGGGGCAGAAGTGG - Intronic
1084963814 11:72733025-72733047 AGAAGAGGAAGAGAAGGAAGAGG + Intronic
1085170347 11:74444519-74444541 ATAAGGAGAAAAGACAGAAGAGG - Intergenic
1085331851 11:75658703-75658725 AGAATGGCAAGGGACAGAAGAGG - Intronic
1085904939 11:80749049-80749071 CTAAGGGAAAGGGAGGGGAGAGG + Intergenic
1086518749 11:87646065-87646087 GGAAGGGGAGGGGAAGGAAGGGG - Intergenic
1086810769 11:91307470-91307492 ATAAGGGGAAGGAAAGTAGGAGG + Intergenic
1086938045 11:92766000-92766022 ATAAGAGGAAGGGCAGGAAATGG + Intronic
1087001890 11:93429570-93429592 ATGAGGGGCAGGGAGTGAAGAGG - Intronic
1087036194 11:93758668-93758690 AGAAGGGGCCGGGACGGCAGGGG - Intronic
1087272283 11:96123735-96123757 AGATGGGGAAGGGAGGGAGGAGG + Intronic
1087431577 11:98062844-98062866 GGAAGGGGAGGGGAAGGAAGAGG + Intergenic
1087474821 11:98622111-98622133 AGAAGGGGAGGGGAGGGAAGGGG - Intergenic
1087754090 11:102036856-102036878 AGAAGGGGAGGGGAGGGGAGGGG + Intergenic
1087910247 11:103744177-103744199 ATAAGGGGTAGGAAGAGAAGGGG - Intergenic
1088047622 11:105472810-105472832 GTAAGGGGAAGGGGAGGAGGAGG + Intergenic
1088275608 11:108082238-108082260 GGAAGGGAAAGGGAGGGAAGGGG - Intronic
1088596423 11:111444281-111444303 AGAAGGGGAGGGGAAGGCAGGGG + Intronic
1088646343 11:111919567-111919589 AGAAGGGGAAAGGGAGGAAGAGG - Intronic
1088677482 11:112209237-112209259 GAAAGGGGAAGGGACGAATGGGG - Intronic
1089227534 11:116938337-116938359 AGAAGGGGACGGGAGGGGAGGGG + Intronic
1089227562 11:116938429-116938451 AGAAGGGGACGGGACGGGAGGGG + Intronic
1089227584 11:116938521-116938543 AGAAGGGGACGGGACGGAAGGGG + Intronic
1089306854 11:117531898-117531920 AGAAAGGGAAGGGAAGGAAAGGG + Intronic
1090062621 11:123477253-123477275 GGAGGGGGAAGGGAAGGAAGGGG - Intergenic
1090167960 11:124571245-124571267 AAAAGAGGGAGGGAAGGAAGAGG - Intergenic
1090274510 11:125410107-125410129 GGAAGGGGAAAGGACGGAAGAGG + Intronic
1090319880 11:125833057-125833079 ATATGGGGCAGGGAAGGCAGAGG + Intergenic
1090519112 11:127459759-127459781 ATAAGGGGAGGGAACAGAGGTGG + Intergenic
1090635235 11:128686789-128686811 AAAAGGGGTAGGGGTGGAAGTGG + Intronic
1091192655 11:133707606-133707628 AAAAGGGGAAGGGAAAGAAAGGG + Intergenic
1091192753 11:133707887-133707909 GGAAGGGGAAGGGAAGGAAAAGG + Intergenic
1091493574 12:952968-952990 GGAAGGGGAAGGGAGGGGAGGGG + Intronic
1091649161 12:2296685-2296707 ATAAGGGAAAGGGAAGCCAGGGG + Intronic
1092019266 12:5187244-5187266 ATAAGGAGAGGGAATGGAAGAGG - Intergenic
1092058138 12:5523861-5523883 ATAAGAGGGAGGGATGGCAGGGG + Intergenic
1092274343 12:7047972-7047994 GGAAGGGGAGGGGAGGGAAGGGG - Intronic
1092388040 12:8050970-8050992 GGAAGGGGAAGGGAAGGGAGGGG - Intronic
1092461010 12:8686255-8686277 AGGAGGGGAGGGGAGGGAAGGGG - Intronic
1092671024 12:10860790-10860812 GGAAGGGAAAGGGAGGGAAGGGG + Intronic
1093119018 12:15245038-15245060 AGAAGGGGAGGGGAGGGGAGGGG + Intronic
1093206620 12:16259275-16259297 AAAAGGGGAGGGGAGAGAAGAGG - Intronic
1094230207 12:28094081-28094103 GGGAGGGGAAGGGAGGGAAGGGG - Intergenic
1094349213 12:29504600-29504622 AAAAGGGGTAGGGAAGGATGGGG + Intronic
1094502239 12:31032032-31032054 AAAAAGGGAAGGGAGGAAAGTGG - Intergenic
1095540666 12:43305329-43305351 ATAATGGGAGGGGAGGGGAGGGG + Intergenic
1095905002 12:47368652-47368674 AGAAGTGGAGGGGAGGGAAGGGG + Intergenic
1095982844 12:47982700-47982722 ATGGGAGGAAGGGAAGGAAGAGG - Intronic
1096076509 12:48809062-48809084 AGAAGTGGAAGGGACCTAAGAGG + Intergenic
1096417572 12:51426808-51426830 ACAAGGGGAAGCCACTGAAGGGG + Intronic
1097005229 12:55911848-55911870 AGAAGGGGAGGGGAGGGGAGGGG + Intronic
1097342432 12:58454386-58454408 GGAAGGGGAGGGGAGGGAAGGGG - Intergenic
1097680030 12:62640282-62640304 ATAAAGGGAAGGGAGGGGATGGG - Intergenic
1097967353 12:65595370-65595392 GGAAGTTGAAGGGACGGAAGTGG - Intergenic
1098534852 12:71582982-71583004 AGAAGGGGAAGGGAAGGGAGGGG + Intronic
1099121889 12:78700671-78700693 AGGAGGGGAAGGGAAGGGAGGGG + Intergenic
1099148044 12:79072916-79072938 GTAAGGGGAAGGAAGGGAAACGG + Intronic
1100552792 12:95662195-95662217 AGAAGGAGAGGGGAGGGAAGGGG - Intronic
1100627231 12:96347561-96347583 GAAAGGGGAAGGGAAGGGAGGGG + Intronic
1100876487 12:98967630-98967652 AAGAGGGGAGGGGAGGGAAGAGG + Intronic
1100931458 12:99614460-99614482 AGGAGGGGAGGGGAGGGAAGGGG + Intronic
1101053866 12:100892576-100892598 ATCTGGGGAAGGGAGGGAGGTGG - Intronic
1101054428 12:100897487-100897509 AGAAGGAAAAGGGACTGAAGGGG + Intronic
1101157365 12:101940530-101940552 AGGAGGGGAAGGGAGGGGAGAGG + Intronic
1101245071 12:102877394-102877416 GTAAGAGGAAGGGAGGGGAGTGG + Intronic
1101859164 12:108468673-108468695 AGGAGGGGAAGGGAGGGGAGGGG + Intergenic
1101952627 12:109188388-109188410 GGGAGGGGAAGGGATGGAAGGGG - Intronic
1102559808 12:113754165-113754187 AGAAGGGGAGGGGAGGGGAGGGG + Intergenic
1102976000 12:117207648-117207670 AGAAGGGGAGGGGAAGGAGGAGG - Intergenic
1102991940 12:117322101-117322123 AAAAGGGGAAGGGAGGAGAGAGG - Intronic
1103030091 12:117606281-117606303 AGAAAGGGAAGGGAAGGAGGAGG - Intronic
1103138101 12:118525322-118525344 TTAGAAGGAAGGGACGGAAGAGG - Intergenic
1103304213 12:119951665-119951687 GGAAGGGGAGGGGAGGGAAGGGG + Intergenic
1103304238 12:119951729-119951751 GGAAGGGGAGGGGAGGGAAGGGG + Intergenic
1103304265 12:119951805-119951827 GGAAGGGGAGGGGAGGGAAGGGG + Intergenic
1103304288 12:119951869-119951891 GGAAGGGGAGGGGAGGGAAGAGG + Intergenic
1103304311 12:119951933-119951955 GGAAGGGGAGGGGAGGGAAGAGG + Intergenic
1103582403 12:121925065-121925087 AGAAGGGGAAGGGGTGGAATTGG - Intronic
1103587362 12:121966201-121966223 GGAAGGGGAGGGGAGGGAAGGGG - Intronic
1103814474 12:123642675-123642697 ACATGGGGAAGGGGTGGAAGTGG - Intronic
1103831387 12:123782338-123782360 AGAAGGGGAGGGGAGGGGAGGGG - Intronic
1104091457 12:125521231-125521253 AGGAGGGGAAGTGAAGGAAGAGG - Intronic
1104413177 12:128576258-128576280 AGAAGGGGAGGGGAGGGGAGGGG + Intronic
1104498981 12:129266593-129266615 AGAAAGGGAAGGGAGGGGAGGGG - Intronic
1104667247 12:130656267-130656289 CACAGGGGAAGGGAGGGAAGAGG + Intronic
1104956836 12:132470835-132470857 AGAAGGGGAGGGGAGGGAAGGGG + Intergenic
1104956844 12:132470850-132470872 GGAAGGGGAGGGGAGGGAAGGGG + Intergenic
1104956852 12:132470865-132470887 GGAAGGGGAGGGGAGGGAAGGGG + Intergenic
1104956860 12:132470880-132470902 GGAAGGGGAGGGGAGGGAAGGGG + Intergenic
1105403176 13:20113277-20113299 AACAGGAGAAGGGAAGGAAGAGG + Intergenic
1105415187 13:20205916-20205938 AGAAAGGGAAGGGAAGGCAGAGG - Intergenic
1105471424 13:20698314-20698336 GGAAGAGGAGGGGACGGAAGGGG + Intergenic
1105471434 13:20698339-20698361 AGAAGGGGAGGGGAGGGGAGAGG + Intergenic
1105709998 13:22998279-22998301 AGAAGGGGAAGGGAGGGGAAGGG + Intergenic
1106088356 13:26562863-26562885 CGAAGGGGAAGGGAGGGAGGAGG - Intronic
1106132769 13:26953248-26953270 TTAAGGAGAAGGGAAGGGAGGGG + Intergenic
1106147597 13:27063874-27063896 AGAGGAGGAAGGGAAGGAAGAGG + Intergenic
1106168016 13:27266168-27266190 GAAAGGGGAAGGGAGGGGAGGGG - Intergenic
1106737426 13:32602234-32602256 GTGAGGGGAAGGGAGGGGAGAGG - Intronic
1107124264 13:36829280-36829302 ATAATGGGAAAGGAGGGAAATGG + Intergenic
1107376274 13:39808247-39808269 AAAAGGGGAAGGAAAGGAAAGGG - Intergenic
1107592640 13:41924390-41924412 AGGAGGGGAAGGGAGGGGAGGGG + Intronic
1107795442 13:44046875-44046897 GGAAGGGGAAGGGGAGGAAGAGG - Intergenic
1107820019 13:44277474-44277496 GGGAGGGGAAGGGAGGGAAGGGG + Intergenic
1107820048 13:44277554-44277576 GGAAAGGGAAGGGAGGGAAGAGG + Intergenic
1107892137 13:44923435-44923457 ATCAGGTGAAGGGAAGGTAGGGG - Intergenic
1108299634 13:49061421-49061443 AGAAGGGGAGGGGAGGGGAGGGG - Intronic
1108396663 13:49996953-49996975 GGAGGGGGAAGGGACGGGAGGGG + Intronic
1108396674 13:49996974-49996996 GGAGGGGGAAGGGACGGGAGGGG + Intronic
1108526395 13:51289009-51289031 TTAGGGGGAAAGGAGGGAAGGGG + Intergenic
1108578385 13:51808371-51808393 AAAAGGGGAGGGGACAGTAGTGG - Intergenic
1109114734 13:58367192-58367214 AGAAGGGAAAGAGAAGGAAGGGG + Intergenic
1109450385 13:62506812-62506834 AGAAGGGGAAGGGAGAGAGGAGG - Intergenic
1109552208 13:63917980-63918002 GGAAGGGGAAGGGAGGGGAGGGG - Intergenic
1109585636 13:64398878-64398900 ATCAGAGGAAGGAAGGGAAGAGG + Intergenic
1109710492 13:66152609-66152631 CTAAGGGGAGGGGAGGGGAGAGG + Intergenic
1110087802 13:71404406-71404428 ATAAGGGCAAGGGAAGGGACAGG - Intergenic
1110512739 13:76370567-76370589 AAAAGAGGAAGGGAAGGAACAGG + Intergenic
1110552883 13:76827964-76827986 AGAAGGGGAGGGGAGGGGAGGGG + Intergenic
1110552923 13:76828070-76828092 GGGAGGGGAAGGGAGGGAAGGGG + Intergenic
1110983365 13:81932554-81932576 TGGAGGGGAAGGGACGGAAGGGG + Intergenic
1111009525 13:82293367-82293389 AGAAGGGGAAGGGAAGGCTGTGG - Intergenic
1111462677 13:88566995-88567017 AGAAGGGGAGGGAAGGGAAGGGG + Intergenic
1112015738 13:95330055-95330077 GGAAGGGGAAGGGAGGAAAGAGG + Intergenic
1112177095 13:97036564-97036586 AAAAGGGGAGGGGAGGGGAGGGG + Intergenic
1112231660 13:97593763-97593785 CTTAGGGGAAGGGGCGGCAGTGG + Intergenic
1112723462 13:102273999-102274021 AGAAAGGGAAGGAAGGGAAGGGG + Intronic
1113030899 13:105992728-105992750 GAAAGGGGAGGGGAGGGAAGGGG - Intergenic
1113644045 13:111979895-111979917 ATGAGGGGAGGGGAGGGAAGGGG + Intergenic
1115299960 14:31874078-31874100 AGAAGGGGAAGGAAGGGGAGAGG + Intergenic
1115512061 14:34147404-34147426 ATAAGGAGGAGGGAAGGGAGGGG + Intronic
1116362284 14:44015017-44015039 AAAAGGGAAGGGGAGGGAAGGGG + Intergenic
1116475100 14:45331029-45331051 GGAAGGGGAAGGGACGGGAAGGG - Intergenic
1116951614 14:50883385-50883407 ATGAGGGGAGGGGACAGGAGAGG - Intronic
1117765215 14:59074936-59074958 GTAAAGGGAGGGGAGGGAAGGGG + Intergenic
1118906164 14:70024971-70024993 GTAAGGGGAATGGAGAGAAGTGG + Intronic
1118984826 14:70744930-70744952 ATAAAGGGGAGGTAGGGAAGAGG - Intronic
1119192871 14:72695695-72695717 AAAGGGGGAAGGGAAGGAAGAGG + Intronic
1119673781 14:76539024-76539046 AGAAAGGGAAGGGAAGGAAAAGG - Intergenic
1119764232 14:77178410-77178432 AGGAGGGGAGGGGAAGGAAGAGG - Intronic
1119847436 14:77840894-77840916 AGGAGGGGAGGGGAGGGAAGAGG + Intronic
1120544359 14:85792399-85792421 AGAAGGGGGAGGGAGGGAAGTGG + Intergenic
1120910556 14:89662898-89662920 ATTATGGGAAGGGAGCGAAGAGG - Intergenic
1121165349 14:91791136-91791158 AAAAGGGGAAGGGAAGGGAGGGG + Intronic
1121227173 14:92329487-92329509 AAAGGGGGAAGGGAAGGGAGGGG - Intronic
1121276445 14:92671294-92671316 ATAACGGGAAGGTAGGGAGGGGG + Intronic
1121451699 14:94012295-94012317 AGAAGGGGAGGGGAGGGGAGAGG - Intergenic
1121551412 14:94805229-94805251 AGAAAGGGAAGGGAAGGGAGCGG - Intergenic
1121581051 14:95030943-95030965 ACAAGGGGAAGAGAGGGAGGTGG + Intergenic
1121613627 14:95298198-95298220 GGAAGGGGAAGGGAAGGGAGAGG - Intronic
1122007755 14:98719247-98719269 AGAAGGGGAGGAGAAGGAAGAGG + Intergenic
1122033491 14:98930966-98930988 AGAAGGAAAATGGACGGAAGAGG + Intergenic
1122096459 14:99376490-99376512 GGAAGGGGAAGGGAGGGGAGCGG + Intergenic
1122612451 14:102994822-102994844 ACAAGGGGAACGGATGGAAGTGG - Intronic
1122730417 14:103793074-103793096 AAAAGGGGAAGGGAAGGAAGGGG + Intronic
1122730425 14:103793089-103793111 GGAAGGGGAGGGGAGGGAAGGGG + Intronic
1122803131 14:104242670-104242692 AGGAGGGGAGGGGACAGAAGAGG - Intergenic
1122874054 14:104655140-104655162 AGAAGGGAAGGGGAGGGAAGGGG + Intergenic
1122982494 14:105197937-105197959 ATTAGGGCAAGGGCCGGGAGGGG + Intergenic
1123067691 14:105626752-105626774 CTAAGGGGAAAGGAGGGGAGAGG - Intergenic
1123071710 14:105645477-105645499 CTAAGGGGAAAGGAGGGGAGAGG - Intergenic
1123091374 14:105743753-105743775 CTAAGGGGAAAGGAGGGGAGAGG - Intergenic
1123097145 14:105772094-105772116 CTAAGGGGAAAGGAGGGGAGAGG - Intergenic
1202903864 14_GL000194v1_random:57624-57646 AGAAGGGGAAGGGAGGGAGGAGG + Intergenic
1123466111 15:20517297-20517319 AAAAGGGGAGGGGCTGGAAGAGG - Intergenic
1123539245 15:21271679-21271701 GGAAGAGGAAGGGAAGGAAGGGG - Intergenic
1123652003 15:22483742-22483764 AAAAGGGGAGGGGCTGGAAGAGG + Intergenic
1123742423 15:23292602-23292624 AAAAGGGGAGGGGCTGGAAGAGG + Intergenic
1123760902 15:23431884-23431906 AAAAGGGGAGGGGCTGGAAGAGG - Intergenic
1124227658 15:27908605-27908627 ATAAGGGGAAAAGACGAATGTGG + Intronic
1124276835 15:28333273-28333295 AAAAGGGGAGGGGCTGGAAGAGG - Intergenic
1124305865 15:28578333-28578355 AAAAGGGGAGGGGCTGGAAGAGG + Intergenic
1125178428 15:36852582-36852604 AAAAGGGGAGGGGATGGGAGGGG + Intergenic
1125375094 15:39020269-39020291 ATAAGAGAAAGGGAGAGAAGAGG + Intergenic
1125697579 15:41651892-41651914 AGAAGGGAAAGGGAGGGGAGAGG - Intronic
1125887175 15:43237830-43237852 AGACAGGGAAGGGAAGGAAGTGG - Intronic
1126175188 15:45729418-45729440 AGAAAGGGAAGGGAGGGAGGAGG + Intergenic
1126434393 15:48621268-48621290 ATAAAGGGAGGGGGAGGAAGTGG + Intronic
1126769040 15:52036821-52036843 AAAAGGGGAGGGGAGGGGAGAGG - Intronic
1127267518 15:57374074-57374096 AGAAGGGGAAGGGAAGGAGAAGG - Intergenic
1127267541 15:57374155-57374177 AAACGGGGAAGGGAGGGAAAAGG - Intergenic
1127267561 15:57374211-57374233 AAAAGGGGAAGGGAAGAAAAAGG - Intergenic
1128522906 15:68387149-68387171 ATAAGAGGGAGAGAGGGAAGGGG + Intronic
1128669441 15:69563447-69563469 ATAAGGGGAGAGGAGGGAACAGG + Intergenic
1128806410 15:70534301-70534323 AGAAGAGGAGGGGAAGGAAGAGG + Intergenic
1129031142 15:72618736-72618758 AAGAGGGGAGGGGAGGGAAGGGG + Intergenic
1129244334 15:74270547-74270569 ATTAGGGAAAGGAACAGAAGTGG + Intronic
1129442104 15:75588916-75588938 AAAAGGGGAAGGGAGGAAAAGGG + Intergenic
1129496924 15:75992137-75992159 ATAAAGGGAAGGGAAGTAAAGGG - Intronic
1130181629 15:81635201-81635223 TTAAGGGGAAGGGTGGGAAAGGG - Intergenic
1130345438 15:83040234-83040256 AAAAGAGGAAGGGACAGAAGGGG + Intronic
1130359723 15:83171737-83171759 AAAAGGGGATGGGAGGGAGGGGG + Intronic
1130565613 15:84992356-84992378 ATAAGGGGAAGGAAGGGTACGGG + Intronic
1130571508 15:85049345-85049367 ACAAGGGGAAGGGAAGAATGGGG - Intronic
1131690097 15:94817484-94817506 TTCAGGGGAAGGGAGGGAAGGGG + Intergenic
1131759141 15:95600953-95600975 GGAAGGGAAAGGGAGGGAAGAGG + Intergenic
1131793328 15:95988379-95988401 AAGAAGGGAAGGGAGGGAAGAGG + Intergenic
1132101082 15:99024123-99024145 GGAAGGGGAAGGGAAGGGAGGGG - Intergenic
1133211569 16:4266082-4266104 TTGCGGGGAAGGGACGGAAGAGG - Intronic
1133237043 16:4392248-4392270 GTAAAGGGAAGGGGCGGCAGTGG + Intronic
1133551218 16:6856114-6856136 GTAAAGGGAAGGGAAGGAAAGGG - Intronic
1133599206 16:7322828-7322850 AGAAGGGGAAGGAACGCAGGAGG - Intronic
1133810597 16:9158377-9158399 GGAAGGGGAGGGGAGGGAAGGGG - Intergenic
1133810634 16:9158463-9158485 AGAAAGGGAAGGGAGGGGAGGGG - Intergenic
1133962956 16:10510396-10510418 GAGAGGGGAAGGGAGGGAAGGGG + Intergenic
1133964379 16:10519761-10519783 GGAAGGGGAAGGGAGGGGAGGGG - Intergenic
1134060828 16:11198555-11198577 GAAAGGGGAGGGGAGGGAAGGGG + Intergenic
1134626475 16:15726211-15726233 GTAAGGGGAAGGGAAGGGAAGGG - Exonic
1134650265 16:15903076-15903098 AGAAGGGGAGGGGAGGGGAGGGG - Intergenic
1134799642 16:17071835-17071857 AAAAGGGGAGGGGAGGGGAGTGG - Intergenic
1134925853 16:18159046-18159068 AGGAGGGGAGGGGATGGAAGGGG + Intergenic
1135088117 16:19490900-19490922 AGAAGGGGAAGGGAAGGGAGGGG - Intronic
1135088143 16:19490963-19490985 AGAAGGGGAAGGGAAGGGAAGGG - Intronic
1135089057 16:19497997-19498019 ATAAGGGGAGGAGACGAAAATGG + Exonic
1135435583 16:22424857-22424879 ATAAGACGAAGGGAAGGGAGCGG - Intronic
1135478643 16:22801851-22801873 CTAAGGGTAAGGGATTGAAGCGG - Intergenic
1135778820 16:25280696-25280718 AAAAGAGGAAGGGAGGGAGGGGG + Intergenic
1136096295 16:27959517-27959539 GGAAGGGGAGGGGAGGGAAGGGG + Intronic
1136128230 16:28200953-28200975 CTAATGGGAAGGGAAGGAAATGG - Intronic
1137401335 16:48156386-48156408 ATCAGGGGAAGGGAAGGGAGGGG + Intergenic
1137424130 16:48363259-48363281 ATGAGGGGAAGGGTCACAAGGGG + Intronic
1137424900 16:48370202-48370224 TTAAGGGAAAGGGAAGGGAGTGG - Intronic
1137588224 16:49677311-49677333 AGGAGGGGAAGGGAGGGGAGGGG + Intronic
1137588242 16:49677344-49677366 AGGAGGGGAGGGGAGGGAAGGGG + Intronic
1137679966 16:50332980-50333002 AAAGGGGGCAGGGAGGGAAGGGG + Intronic
1137824104 16:51475020-51475042 GGGAGGGGAAGGGATGGAAGGGG - Intergenic
1138200046 16:55081866-55081888 GGGAGGGGAAGGGAGGGAAGGGG - Intergenic
1138498413 16:57423119-57423141 GAAAGGGGAAGGAAGGGAAGAGG + Intergenic
1138532053 16:57639822-57639844 AGAAGGGGAATGCACGGGAGAGG - Intronic
1138532530 16:57642411-57642433 CAAAGGGGAAGGGAGGGGAGGGG + Intronic
1138819096 16:60236934-60236956 GTAAGGGGAAGGGACATGAGTGG + Intergenic
1139317504 16:66086248-66086270 GAAAGGGAAAGGGAAGGAAGTGG + Intergenic
1139320444 16:66109795-66109817 AGAAGGGGAAGGGAGGGAAGGGG + Intergenic
1139363625 16:66419294-66419316 AGGAGGGGAGGGGAGGGAAGGGG + Intergenic
1139759299 16:69171616-69171638 ATTGGGGGAAGGGAAGGGAGGGG + Intronic
1140151880 16:72375716-72375738 ATAAGGGAAAGAGGCGCAAGGGG + Intergenic
1140352868 16:74279514-74279536 TTTGGGGGAAGGGATGGAAGTGG + Intergenic
1140553435 16:75892869-75892891 AAACGGGTAAGGGACAGAAGGGG - Intergenic
1140777680 16:78264968-78264990 AGAAAGGGAAGGGAAGGGAGGGG - Intronic
1141263066 16:82471317-82471339 AGAAGGGGAAGGGGAGGAGGAGG - Intergenic
1141478179 16:84287922-84287944 AGATGGGGAAGGGAGGAAAGGGG + Intergenic
1141537752 16:84694659-84694681 AGAGGGGGAAGGGAGGGAGGGGG + Intergenic
1141769831 16:86083142-86083164 ATAAGAGAAAGGAACGGAAATGG + Intergenic
1142044787 16:87918662-87918684 ATAAGAGAAAGGGAAGGGAGCGG - Intronic
1142248169 16:88979184-88979206 ATAAGGGGCTGGGGAGGAAGTGG + Intergenic
1142358909 16:89617023-89617045 AGAAGGGGAAGGGAGGGGTGGGG + Intronic
1142362695 16:89634913-89634935 GGAAGGGAAAGGGAAGGAAGGGG - Intronic
1142362725 16:89635025-89635047 GGAAGGGAAAGGGAAGGAAGGGG - Intronic
1142362759 16:89635153-89635175 GGAAGGGAAAGGGAAGGAAGGGG - Intronic
1142872620 17:2830937-2830959 GGGAGGGGAAGGGAGGGAAGGGG - Intronic
1142872633 17:2830962-2830984 GGTAGGGGAAGGGAGGGAAGGGG - Intronic
1142872647 17:2830992-2831014 AGGAGGGGAGGGGAGGGAAGTGG - Intronic
1143173944 17:4945877-4945899 TGAAGGGGAAGGGACAGACGAGG + Exonic
1143565041 17:7716086-7716108 GTAGGGGGAAGGGACGAAGGCGG - Intergenic
1143661050 17:8324844-8324866 ATATGGGAAAGGAACGGATGTGG + Intergenic
1143737621 17:8924058-8924080 GGAAGGGGAAGGGAGGGGAGGGG - Intronic
1144510801 17:15874317-15874339 ATAAGGGAAAGGTAGGGAGGGGG + Intergenic
1145174964 17:20692011-20692033 ATAAGGGAAAGGTAGGGAGGGGG + Intergenic
1145279658 17:21458102-21458124 AGCAGGGGAAGTGAGGGAAGGGG + Intergenic
1145293896 17:21573493-21573515 ATAAGGGGAGGGGTGCGAAGCGG + Intronic
1145816670 17:27799806-27799828 AGAAAGGGAAGGGAAGGGAGGGG + Intronic
1145918506 17:28591908-28591930 AGGAGGGGAAGGGATGGGAGGGG + Intronic
1146500972 17:33364107-33364129 ATAAGGAGAAGGGTCACAAGTGG + Intronic
1146675904 17:34773657-34773679 ATAAGGGAGAGGAAGGGAAGAGG + Intergenic
1146725656 17:35153828-35153850 AGAAGGGGAAGGGGAGGAGGTGG - Intronic
1147514266 17:41101538-41101560 ATGAGGGGAGGGGAGGGGAGGGG + Exonic
1147594078 17:41705551-41705573 AAAGGAGGAAAGGACGGAAGCGG + Intergenic
1147765707 17:42834106-42834128 ACAGGAGGAAGGGAGGGAAGGGG + Intronic
1148326425 17:46785838-46785860 GAAAAGGGAAGGGAGGGAAGGGG + Intronic
1148462070 17:47844594-47844616 AGCAGGGGAAGGGAAAGAAGGGG + Intergenic
1148478872 17:47946874-47946896 ATAAGGGGTAGGGAGGGAAATGG - Exonic
1148905930 17:50912052-50912074 AGAAGGGAAGGGGAGGGAAGGGG + Intergenic
1148908179 17:50924901-50924923 ATAAAGGGAAGTGAATGAAGTGG - Intergenic
1148955683 17:51351810-51351832 ATCACGGGAAAGGAAGGAAGGGG - Intergenic
1149315176 17:55431944-55431966 GGAAGGGGAGGGGAGGGAAGGGG + Intergenic
1150466579 17:65398287-65398309 ATAATGGGAAGGAATGCAAGAGG - Intergenic
1150906812 17:69347007-69347029 CTGAGGGGAGGGGAGGGAAGAGG + Intergenic
1150947597 17:69765364-69765386 AGGAGGGGAAGGGAGGGAAGGGG - Intergenic
1151155818 17:72122474-72122496 AGAAGGGGAGGGGAGGGAGGGGG + Intronic
1151297158 17:73193800-73193822 ATAAGGGGAAGGTTGGGATGAGG - Intronic
1151303354 17:73245628-73245650 CTAAGGGGAAGGGCCTGATGTGG - Intronic
1151365700 17:73614725-73614747 AAAAGGGGGAGGGAGGGAGGGGG + Intronic
1151365713 17:73614758-73614780 AAAAGGGGGAGGGAGGGAGGGGG + Intronic
1151383933 17:73743825-73743847 AAAGGGGGGAGGGAAGGAAGAGG - Intergenic
1151386462 17:73758003-73758025 AGGAGGGGAAGGGAAGGGAGGGG - Intergenic
1151559623 17:74863262-74863284 AAAAGGGGAAGGGAGGGAGGTGG + Intronic
1151579947 17:74972201-74972223 ATGAGGGGCAGGGAGGGGAGCGG + Intronic
1151707053 17:75774659-75774681 ATAGGGGTGAGGGAAGGAAGAGG + Intergenic
1152233372 17:79125841-79125863 AAATGGGGAAGGGAGGGAGGGGG + Intronic
1152417260 17:80170787-80170809 AGGAGGGGAGGGGACGGGAGGGG - Intronic
1152913068 17:83016589-83016611 AGAAGGGGAGAGGACTGAAGAGG + Intronic
1153836621 18:8969752-8969774 AAAGGTGGAAGGGAGGGAAGGGG - Intergenic
1154005384 18:10523215-10523237 AGAAGGGGAGGGGAAGAAAGTGG + Intergenic
1154032640 18:10767007-10767029 GGAAGGGGAGGGGAGGGAAGGGG - Intronic
1154323745 18:13375074-13375096 AGAAGGGAAGGGGACGGTAGTGG + Intronic
1156491379 18:37498422-37498444 GAAAGGGGAAGGGAGGGGAGGGG - Intronic
1156495930 18:37525101-37525123 TTAAGAGGAAGGGAAGAAAGGGG - Intronic
1157544619 18:48539232-48539254 GGAAGGGGAAGGGAGGGACGAGG - Exonic
1158048025 18:53180268-53180290 ATTAATTGAAGGGACGGAAGAGG + Intronic
1158484188 18:57850272-57850294 GCAAGGAGAAGGGAAGGAAGAGG + Intergenic
1158642987 18:59219502-59219524 AGGAGGGGAAGGGAGGGGAGAGG + Intergenic
1158643000 18:59219532-59219554 AGGAGGGGAAGGGAGGGGAGAGG + Intergenic
1159085825 18:63790710-63790732 ACATGGGGTAGGGAGGGAAGGGG + Intronic
1159571512 18:70119425-70119447 GAAAGGGGAGGGGAGGGAAGAGG + Intronic
1159623460 18:70667215-70667237 GGAAGGGGAGGGGAAGGAAGGGG - Intergenic
1160983289 19:1826499-1826521 AGAGGGGGAAGGGAGGAAAGGGG + Intronic
1161634231 19:5377203-5377225 AGAAGGGGAGGGCAGGGAAGGGG + Intergenic
1161734129 19:5979941-5979963 AGAAAGGGAAGGGAAGGAAAGGG - Intergenic
1162138006 19:8568003-8568025 AAGAGGGGAAGGGCAGGAAGAGG - Intronic
1162625834 19:11884269-11884291 AGAAGGAGAAGAGAAGGAAGGGG - Intergenic
1162876804 19:13626641-13626663 AGAATGGGAAGGGAAGGGAGGGG + Intergenic
1162878615 19:13639853-13639875 AGAAGGGAAAGGGAAGGAGGAGG - Intergenic
1163038436 19:14585067-14585089 GAAAGGAGAAGGGATGGAAGGGG - Intronic
1163039130 19:14589328-14589350 GAAAGGGGAAGGGATGGAAGGGG - Intronic
1163276086 19:16285201-16285223 AGAAGGGGAAGGGGAAGAAGAGG + Intergenic
1163276096 19:16285246-16285268 AGAAGGGGAAGGGGAGGAAGAGG + Intergenic
1163336709 19:16677561-16677583 GGGAGGGGAAGGGAGGGAAGGGG - Intronic
1163341571 19:16711184-16711206 AGAAGGGGAGGGGAAGGGAGGGG - Intergenic
1163351072 19:16777223-16777245 GGAAGGGGAGGGGAGGGAAGGGG + Intronic
1163351374 19:16777996-16778018 GGAAGGGAAAGGGAAGGAAGGGG + Intronic
1163351385 19:16778021-16778043 GGAAGGGAAAGGGAGGGAAGGGG + Intronic
1163738949 19:18998991-18999013 ATGACGGGTAGGGAAGGAAGGGG + Intronic
1164662925 19:29994309-29994331 ATGAGGGGAAGGGAAGGGAGGGG - Intronic
1164777074 19:30861302-30861324 ATCCGGGGAAGGGAATGAAGAGG + Intergenic
1164812409 19:31167855-31167877 CTAAAGGGAAGCGACGGGAGGGG - Intergenic
1164833410 19:31340493-31340515 AAAGGGGAAAGGGAGGGAAGGGG + Intronic
1164882876 19:31750046-31750068 GTAAGGGGAAGAGGAGGAAGTGG + Intergenic
1164893048 19:31841174-31841196 ATTAGGGGGAGGGTGGGAAGTGG - Intergenic
1165140198 19:33694930-33694952 AGAAGGGGAAGGGAGGGGAGGGG - Intronic
1165367747 19:35379625-35379647 AAAAGGGGAGGGGAGGGAAAAGG - Intergenic
1165440653 19:35825113-35825135 GTAAGGGGAGGGGAGGGAAGGGG + Intergenic
1165491514 19:36126087-36126109 AGAAAGGGAAGGGAAGGGAGGGG + Intergenic
1166208610 19:41290523-41290545 ATAAGGGGCTGGGACTGAAGTGG - Intronic
1166312837 19:41972765-41972787 AAAAGGGGAGGGGAGGGGAGGGG + Intronic
1166572942 19:43810568-43810590 AGGAGGGGAAGGGAGGGGAGGGG - Intronic
1166652169 19:44582772-44582794 GTAAGGGGAAGGGGAGGAGGAGG + Intergenic
1166652176 19:44582799-44582821 AGAAGGAGAAGGAGCGGAAGGGG + Intergenic
1166668657 19:44697001-44697023 AGCAGGGGAAGGGATGGAGGTGG - Intergenic
1167004508 19:46766868-46766890 ATATGGGGAACAGACGGAAGAGG + Intronic
1167114210 19:47479677-47479699 AAGAGGGGAGGGGAGGGAAGAGG + Intronic
1167121655 19:47520959-47520981 AGAAGTGGAAGGGAAAGAAGGGG + Exonic
1167200393 19:48061274-48061296 ATGAGGGGAGGGGAAGGGAGGGG + Intronic
1167240775 19:48342034-48342056 GGAAGGGGAAGGGAGGGGAGCGG + Intronic
1167270267 19:48502196-48502218 ATGAGGGGAAGGGCCAGGAGAGG - Intronic
1167579121 19:50331651-50331673 AGGAGGGAAAGAGACGGAAGAGG - Intronic
1167764203 19:51469359-51469381 AGAAGGGGAAGGGATTGGAGGGG + Intergenic
1167772874 19:51531655-51531677 AGAAGGGGAAGGGAGTGGAGGGG + Exonic
1167980675 19:53272644-53272666 ATGAGGGGAAGGGAAGTAACAGG + Intergenic
1168191359 19:54740764-54740786 TATAGGGGAAGGGACTGAAGGGG + Intronic
1168204062 19:54836336-54836358 TATAGGGGAAGGGACTGAAGGGG + Intronic
1168249740 19:55134832-55134854 ACGAGGGGAAGGGAGGGGAGGGG + Intronic
1168251576 19:55145324-55145346 AGAAGGGGAAGGGGAAGAAGAGG + Intronic
1168290906 19:55357062-55357084 AGAAGAGGAAGGGAGGGGAGAGG + Intronic
1168296151 19:55378146-55378168 CGAGGGGGAAGGGACGGAGGAGG + Exonic
1168348419 19:55661935-55661957 AGGAGGGGCAGGGACGGGAGGGG - Intronic
925035158 2:679535-679557 GGAAGGGGAAGGGAGGGGAGGGG - Intergenic
925097589 2:1219679-1219701 AGAAAGGGAAGGGAGGGGAGTGG + Intronic
925452298 2:3980024-3980046 ATGAAGGGAAGGGAAGGATGAGG - Intergenic
925548285 2:5041736-5041758 AGAAGGGGAAGGGAAGGGAAAGG - Intergenic
925881038 2:8352928-8352950 GGAAAGGGAAGGGAGGGAAGAGG + Intergenic
925881043 2:8352943-8352965 GGAAGAGGAAGGGAGGGAAGAGG + Intergenic
925984385 2:9204283-9204305 AGAAGGAGAAGGAAAGGAAGAGG - Intergenic
926292027 2:11538961-11538983 AGGAGGGGAAGGGAGGGGAGAGG - Intronic
926337489 2:11875224-11875246 AGGAGGGGAAGGAAGGGAAGAGG - Intergenic
926619483 2:15034115-15034137 AGAAGGAGAAGGAAAGGAAGAGG + Intergenic
927559516 2:24059966-24059988 ACAGAGGGAAGGGAAGGAAGGGG + Intronic
927772739 2:25878143-25878165 GTAAGGGGGAGGGAGCGAAGGGG - Intronic
927866185 2:26589185-26589207 GGAAGGGGAAGGGGAGGAAGAGG - Intronic
927920888 2:26971018-26971040 GGAAGGGGAGGGGAGGGAAGGGG - Intronic
927961169 2:27241491-27241513 ATAAGGGGACGGGATGGCAGGGG - Intronic
928164769 2:28962760-28962782 GGAAGGGGAGGGGAGGGAAGGGG - Intronic
928219722 2:29393555-29393577 AGAAGGGGATGGGACAGAAAGGG - Intronic
928264743 2:29802292-29802314 AGAAGAGGAGGGGAGGGAAGGGG + Intronic
928268267 2:29831050-29831072 AGAAGAGGAAGGGGAGGAAGGGG + Intronic
928689012 2:33779680-33779702 AAAAAGGGAAGGGAAGGGAGGGG - Intergenic
929034069 2:37673797-37673819 GGAAGGGGAGGGGAGGGAAGCGG - Intronic
929214597 2:39398485-39398507 CTAAGGAGAAGGGACAGATGGGG + Intronic
929246745 2:39710474-39710496 GAAAGGGGAGGGGATGGAAGAGG + Intronic
929379977 2:41337954-41337976 GGAAGGGGAAGGGAGGGGAGCGG + Intergenic
929444601 2:41992206-41992228 AGGAGGGGAAGGGAGGGAAAGGG + Intergenic
929618825 2:43334438-43334460 ATGAGGGGAAGAGATGGTAGAGG - Intronic
929779571 2:44949192-44949214 GCTAGGGGCAGGGACGGAAGAGG - Intergenic
929859651 2:45666066-45666088 ATCAGGGGAGGAGAAGGAAGCGG - Intronic
929986252 2:46736003-46736025 AGAAGGGGAGGGAAGGGAAGGGG - Intronic
930205964 2:48586929-48586951 ATGAGGGAAAGGGAGGGAATGGG + Intronic
930330866 2:49981388-49981410 ATGAAGGGGAGGGAGGGAAGAGG + Intronic
930506041 2:52283900-52283922 ACAAGCAGAAGGGAAGGAAGGGG + Intergenic
931074826 2:58698964-58698986 ATATGGGGAAGGAACTGAAAGGG - Intergenic
931796196 2:65712255-65712277 AAAAGGGGATGGGAGGGGAGGGG - Intergenic
933059940 2:77725059-77725081 GGAAGGGGAAGGGAGGGGAGGGG + Intergenic
933083974 2:78031448-78031470 AGAAGGGGAGAGGAGGGAAGGGG + Intergenic
933215829 2:79629083-79629105 ATAAGGGGAAGGGACGGAAGTGG - Intronic
933240570 2:79916559-79916581 AAAAGGAGAAGGGAGGGGAGGGG - Intronic
933379773 2:81527730-81527752 AGGAGGAGAAGGGAAGGAAGTGG - Intergenic
933734737 2:85486849-85486871 GGAAGGGGAGGGGACGGGAGGGG + Intergenic
933936568 2:87208926-87208948 AGGAGGGGAAGGGAGGGAAGGGG - Intergenic
935063273 2:99626490-99626512 GGAAAGGGAAGGGAAGGAAGGGG - Intronic
935230270 2:101090000-101090022 AGAAGGGGAGAGGAAGGAAGAGG + Intronic
935308380 2:101759604-101759626 GAATGGGGAAGGGAGGGAAGGGG - Intronic
935357599 2:102218409-102218431 ATAAGGGAAAGAGAGGGAAAGGG + Intronic
935570075 2:104650331-104650353 GGAAGGGGAGGGGAAGGAAGAGG + Intergenic
935690267 2:105724968-105724990 ATAGGGGAAAGGGTGGGAAGGGG + Intergenic
935789796 2:106580558-106580580 AGAAGGGGACGGGAGGGGAGGGG - Intergenic
936083984 2:109453915-109453937 ATGAGGGCCAGGGACGGGAGAGG + Intronic
936144227 2:109968754-109968776 CTGAGGGGAAGGGACAGAGGAGG - Intergenic
936180911 2:110266714-110266736 CTGAGGGGAAGGGACAGAGGAGG - Intergenic
936200461 2:110402715-110402737 CTGAGGGGAAGGGACAGAGGAGG + Intergenic
936225542 2:110646350-110646372 AGAAGGGGAGGGGAGGGGAGGGG + Intronic
936261846 2:110966550-110966572 TTAGGGGGCAGGGAGGGAAGAGG - Intronic
936263601 2:110982420-110982442 AGAAGAAGAAGGGAGGGAAGAGG - Intronic
936356576 2:111756900-111756922 AGGAGGGGAAGGGAGGGAAGGGG + Intergenic
936437749 2:112522758-112522780 TTGAGGGGAAGGGAAGGCAGAGG - Intronic
936516609 2:113185267-113185289 AGAAGGGGAAAGGAGGGGAGGGG - Intronic
936894205 2:117408036-117408058 GGAAGGGGAAGGGAAGGAAAGGG - Intergenic
937027604 2:118712287-118712309 AGGAGGGGAGGGGAGGGAAGGGG + Intergenic
937424788 2:121789824-121789846 AGGAGGGGAAGGGAGGGGAGGGG - Intergenic
937442056 2:121924370-121924392 ATAAGGGGAAAAGATAGAAGAGG - Intergenic
937739925 2:125339271-125339293 ATTAGGGAAAGGTAAGGAAGAGG - Intergenic
938573765 2:132585452-132585474 AAGCGGGGAGGGGACGGAAGGGG - Intronic
938614426 2:132982655-132982677 ATAGGGGAAAGGGAGGGAGGGGG - Intronic
938957667 2:136314482-136314504 GAAAGGGAAAGGGAAGGAAGGGG - Intergenic
938957680 2:136314515-136314537 AGAAGGGAAAGGGAAGGAAGGGG - Intergenic
938957746 2:136314700-136314722 AGGAGGGGAGGGGAGGGAAGGGG - Intergenic
939205565 2:139098163-139098185 AGATGGGGAAGGCAGGGAAGTGG + Intergenic
939643575 2:144669749-144669771 AGAATGAGAAGGGAAGGAAGGGG - Intergenic
939766103 2:146252098-146252120 GGAAGGGGAAGGGAAGGAAGGGG + Intergenic
939766109 2:146252113-146252135 GGAAGGGGAAGGGAAGGAAGGGG + Intergenic
939766115 2:146252128-146252150 GGAAGGGGAAGGGAAGGAAGGGG + Intergenic
939766121 2:146252143-146252165 GGAAGGGGAAGGGAAGGAAGGGG + Intergenic
939828235 2:147041240-147041262 ATCAGGAGAAGAGAAGGAAGGGG + Intergenic
939969376 2:148643275-148643297 AAAAGGGGGAGGGGAGGAAGTGG + Intergenic
941105965 2:161353550-161353572 AAAAGGGGGAGGGAGGGAAAAGG - Intronic
942447044 2:176085173-176085195 CAAAGGGGAAGGGAGGGCAGCGG - Intergenic
942482304 2:176402845-176402867 AGAAAGGGAAGGGAGGGAGGGGG - Intergenic
942482315 2:176402873-176402895 AGAAAGGGAAGGGAGGGAGGGGG - Intergenic
942655270 2:178208654-178208676 AGGAGGGGATGGGAGGGAAGGGG - Intronic
943051158 2:182914894-182914916 TTAAAGGGAAGGGATGGAAAAGG - Intronic
943058188 2:183009355-183009377 ACAAGGGGAGGGGAAGGGAGGGG + Intronic
943190658 2:184674608-184674630 ATAAGGGAAAGGAGAGGAAGAGG + Intronic
943394258 2:187312979-187313001 ATACGGGGAGGGGAGGGGAGGGG + Intergenic
943521457 2:188955940-188955962 AGAAAGGGAAAGGAAGGAAGGGG + Intergenic
943561062 2:189462931-189462953 ATAAAGGGAAGGTTTGGAAGTGG + Intronic
943661778 2:190566624-190566646 GGAAGGGGAAGGGAAGGGAGGGG + Intergenic
944486830 2:200215687-200215709 AAGTGGGGAAGGGAGGGAAGAGG - Intergenic
944674518 2:202023920-202023942 ATAAGGGGGAGGCAGGGAAAGGG + Intergenic
945242258 2:207686856-207686878 GGAAGGGGAAGGGTGGGAAGGGG + Intergenic
945468172 2:210195936-210195958 ATAATGTGAAGGGATGAAAGAGG - Intronic
946066248 2:216989832-216989854 TTGAGGGGAAGGGAGGAAAGTGG + Intergenic
946079650 2:217106551-217106573 AGGAGAGGAAGGGAGGGAAGAGG - Intergenic
946285170 2:218697358-218697380 AGATGGGGAAGGGACTGAATAGG + Intronic
946299984 2:218817035-218817057 ATAAGGGGAAGGGAAGAGAAGGG + Intergenic
946372838 2:219290933-219290955 GAAAGGGGGAGGGACGGAGGAGG + Intronic
946430042 2:219621146-219621168 AAAAAGGAAAGGGACTGAAGGGG - Intergenic
946971276 2:225094589-225094611 ATAGGGGGAAGGGAGGGATAGGG - Intergenic
947020980 2:225675288-225675310 AGACGGGGAAGGGAGGGAGGTGG - Intergenic
947270920 2:228334102-228334124 AAAAGGGGAAGGAAAGGAGGGGG - Intergenic
947422931 2:229956878-229956900 ATAAGGGGAAGAGACCCCAGGGG - Intronic
947827025 2:233113391-233113413 AAAAAGAGAAGGGAGGGAAGAGG + Intronic
947975039 2:234358031-234358053 AGAAGGGGAGGGGAGGGGAGGGG - Intergenic
948761123 2:240191687-240191709 AGAAGGGGAAGGGGAGAAAGGGG - Intergenic
1168896763 20:1328994-1329016 GGAAGGGGCAGGGAGGGAAGGGG + Intronic
1169178651 20:3542619-3542641 GGAAGGGGAAGGGAAGGAAAAGG - Intronic
1169522769 20:6390984-6391006 AAATGGGGAAGGGAGGAAAGGGG - Intergenic
1169766774 20:9155095-9155117 AGAAGGGGAAGGGTGGGAGGGGG - Intronic
1170041598 20:12045260-12045282 GGAAGGGGAAGGGAGGGGAGGGG - Intergenic
1170593069 20:17786068-17786090 ATAAGGGGAAAGGGAAGAAGAGG - Intergenic
1170700006 20:18695434-18695456 AGAAGGGGAAGGGGAAGAAGGGG - Intronic
1170700012 20:18695449-18695471 AGAAGGGGAAGGGAAAGAAGGGG - Intronic
1170917555 20:20642142-20642164 AGAAGGGGAGGGGAGGGGAGGGG + Intronic
1170952976 20:20953429-20953451 ACAATGGGAATGGAGGGAAGTGG - Intergenic
1171327846 20:24311474-24311496 GGAAGGGGAAGGGAAGGGAGCGG + Intergenic
1171990066 20:31689245-31689267 GGAAGGGAAAGGGAGGGAAGGGG + Intronic
1172569779 20:35960886-35960908 AAAAGGGGAGGGGAGGGGAGAGG - Intronic
1172754561 20:37274060-37274082 AGAAGGGGAGGGGAGGGGAGAGG + Intergenic
1173065087 20:39703018-39703040 GGAAGGGGAAGGGAGGGTAGGGG + Intergenic
1173112243 20:40202953-40202975 AGAAGGAGAAGGAAGGGAAGGGG + Intergenic
1173145434 20:40520466-40520488 AAAAGGGGAAGGAAGGGAGGAGG - Intergenic
1173201642 20:40959430-40959452 GGAAGGGAAAGGGAGGGAAGGGG + Intergenic
1173229669 20:41184273-41184295 ACATGGGGTAGGGACGTAAGTGG - Exonic
1173541642 20:43857166-43857188 AGAGGAGGAAGGGAGGGAAGAGG + Intergenic
1174261837 20:49301703-49301725 AGAAGGGGAAGAGAGGGATGGGG - Intergenic
1174398407 20:50262093-50262115 ATGAGGGGAGGGGAGGGGAGGGG - Intergenic
1174701567 20:52614557-52614579 GGAAGGGGAGGGGAGGGAAGGGG - Intergenic
1174701580 20:52614582-52614604 AGAAGGGGAGGGGAGGGGAGGGG - Intergenic
1175142798 20:56873322-56873344 AGAAGGGGAGGGTATGGAAGAGG - Intergenic
1175755690 20:61528390-61528412 AGGAGGGGAAGGGAGGGGAGGGG + Intronic
1175755709 20:61528426-61528448 AGGAGGGGAAGGGAGGGGAGGGG + Intronic
1176218142 20:63957827-63957849 ATGAGGGGAGGGGAGGGGAGGGG - Exonic
1176623235 21:9072392-9072414 AGAAGGGGAAGGGAGGGAGGAGG + Intergenic
1176705176 21:10111354-10111376 GCAAGGGGAAGGAAAGGAAGTGG + Intergenic
1177264947 21:18770446-18770468 ATGAAGGGAAGGGGAGGAAGAGG - Intergenic
1177512842 21:22112678-22112700 AGAAGGTGAAGGGTGGGAAGAGG - Intergenic
1177567107 21:22838176-22838198 AGAGGGGGAAGGGAAGGAAGGGG + Intergenic
1177729287 21:25007316-25007338 AGAAGGGGAAGGGAGGGGAAGGG + Intergenic
1178094775 21:29202783-29202805 AGAAGAGGAAGGGAGGGAGGGGG + Intronic
1178401204 21:32286240-32286262 GGAAGGGGAGGGGAGGGAAGAGG + Intergenic
1178847684 21:36187194-36187216 AGGAGGGGAAGGGAGGGGAGGGG - Intronic
1178957849 21:37039688-37039710 AAAGGGGGAAGGGAAGGGAGAGG - Intergenic
1179296500 21:40067703-40067725 ATGAGGGGAGGGGAGGGGAGGGG - Intronic
1179434748 21:41352444-41352466 AAAAAGGGAAGGGAGGGGAGGGG + Intronic
1179531421 21:42022167-42022189 ATCAAGTGAAGGGACGGAACAGG + Intergenic
1179774614 21:43653180-43653202 AAAAGGGAAAGGAAGGGAAGGGG + Intronic
1180129283 21:45816514-45816536 AAAAGGGGAGGGGAGGGGAGGGG - Intronic
1181138795 22:20788357-20788379 AAAGGGAGTAGGGACGGAAGGGG + Intronic
1181380320 22:22497161-22497183 ATAGGAGGAAGGGAAGGAAAAGG - Intronic
1181666516 22:24402141-24402163 AGAAGGGAAGGGGAGGGAAGGGG - Intronic
1181912866 22:26254358-26254380 AGGAAGGAAAGGGACGGAAGAGG + Intronic
1182106813 22:27695544-27695566 AGAAAGGGAAGGGAAGGGAGAGG + Intergenic
1182221347 22:28761440-28761462 ATAAGGGGAGGGGACCCAAAGGG - Intergenic
1182408341 22:30158556-30158578 GGAAGGGGAAGGGAGGGGAGGGG - Intronic
1182886414 22:33777682-33777704 AGAAGGGGAAGGGAAGGCAGGGG + Intronic
1182905556 22:33932904-33932926 ATAAGAGAAAGGGAAGGAAAGGG - Intergenic
1183031680 22:35111144-35111166 AGAAGGGGAGGGGAGGGGAGGGG + Intergenic
1184064125 22:42106353-42106375 AGAAGGAGAAGAGAGGGAAGAGG + Intergenic
1184152056 22:42645034-42645056 TTTAGGGCAAGGGAGGGAAGTGG - Intronic
1184173384 22:42772510-42772532 AGGAGGGGAAGGAAGGGAAGGGG - Intergenic
1184328602 22:43811359-43811381 GAAAGGGGAAGGGAAGGGAGGGG + Intronic
1184600246 22:45539144-45539166 AGAAGGGGAAGGGAAGGAGGGGG - Intronic
1184836955 22:47029495-47029517 GTGAAGGGAAGGGAGGGAAGAGG - Intronic
1185300226 22:50075775-50075797 ATAAGGGGAAGTGAAGGCACTGG + Intronic
1185345253 22:50307910-50307932 AGGAGGGGAGGGGACGGGAGGGG + Intergenic
1185397007 22:50597643-50597665 TTAAGAGGGAGGGAAGGAAGGGG + Intronic
949250112 3:1973344-1973366 AGAAAGGGAAAGGAAGGAAGGGG + Intergenic
949457095 3:4250273-4250295 AAAGGGGGAAGGAAGGGAAGAGG + Intronic
949493497 3:4610892-4610914 AGAAGGAGAAGGGGGGGAAGGGG - Intronic
949551495 3:5115958-5115980 AGAAGGGGAGGGGAGGGAAGGGG - Intergenic
949883558 3:8678770-8678792 CTAAGTGGCAGGGAGGGAAGAGG - Intronic
950332832 3:12170038-12170060 GTAAAGGGAAGGGAAGGAAGAGG - Intronic
950491037 3:13305268-13305290 AAACGGGGAAGAGAGGGAAGGGG + Intergenic
952197821 3:31094532-31094554 ATAAGGTGTAGGGAAGGAGGAGG + Intergenic
952579793 3:34819347-34819369 AGAGGGGGAAGGGAGGGAAGTGG - Intergenic
952870039 3:37890833-37890855 ATAACAGGAAGGGAGGAAAGAGG + Intronic
953341020 3:42134228-42134250 GAAAGGGGAGGGGAGGGAAGGGG - Intronic
953771160 3:45779586-45779608 AGAAGGGGACGGGGAGGAAGAGG + Intronic
954344655 3:49986756-49986778 AGAAGGGGAGGGGAGGGGAGGGG - Intronic
954428115 3:50454258-50454280 AGAAGGGGAAGGGACCGAGCCGG + Intronic
954755198 3:52835431-52835453 TCCAGGGGAAGGGATGGAAGAGG - Exonic
954783203 3:53075146-53075168 AGCAGGGGAAGGGAAGGGAGTGG - Intronic
955099246 3:55831322-55831344 AAGAGGGGAGGGGAAGGAAGGGG + Intronic
955250584 3:57278038-57278060 AAAATGGGAAGGGATGGTAGTGG + Intronic
955281710 3:57600409-57600431 AAAAGGGAAAGGAAAGGAAGGGG - Intergenic
955286302 3:57644724-57644746 AGGAGGGGAAGGGAGGGGAGGGG + Intronic
955458812 3:59156887-59156909 CTTAGGTGAAGGGATGGAAGTGG - Intergenic
955619532 3:60847680-60847702 GAAAGGAGAAGGGACGGAAAAGG - Intronic
956042056 3:65155135-65155157 GTAGGGGGAAGGGAGGGAAAGGG - Intergenic
957499505 3:81035407-81035429 TGAAGGGGAAGGGATGGATGAGG - Intergenic
957717846 3:83954353-83954375 ATGAGAGGAAGAGAAGGAAGGGG + Intergenic
958445607 3:94211010-94211032 AGATTGGGAAGGGACGGGAGTGG + Intergenic
958828169 3:99057444-99057466 TTAAGGGGAAGGGTTGGAATGGG - Intergenic
959259178 3:104052984-104053006 ATAAGAGTTAGGGAAGGAAGTGG + Intergenic
959449692 3:106483560-106483582 AAATGGGGAAGGAAAGGAAGGGG - Intergenic
959784412 3:110276654-110276676 ATGAGGGGAGGGGAAGGGAGGGG - Intergenic
960141535 3:114155930-114155952 AGAAGGAGAAGAGGCGGAAGGGG - Intronic
960683999 3:120279151-120279173 ACAGGGGGAAGGGAGGGAGGGGG + Intronic
961115031 3:124322056-124322078 ATGAGGGGAAGGGGCTAAAGAGG + Intronic
961501250 3:127337526-127337548 AATAAGGGAAGGGAGGGAAGTGG - Intergenic
961532432 3:127547701-127547723 AGGAGGGGAGGGGAAGGAAGAGG - Intergenic
961570584 3:127795394-127795416 AGAGGGGGAAGGGAGGGAGGGGG + Intronic
961940918 3:130636858-130636880 GGAAGGGGAAGGGAAGGAAGGGG - Intronic
962231843 3:133672755-133672777 GGAAGGGGAGGGGAGGGAAGGGG + Intergenic
962390651 3:134969392-134969414 AGAAGGGGAAGGAAGGGAAAAGG + Intronic
962390951 3:134972201-134972223 AGAAGGGGAAGGAAGGGAAAAGG - Intronic
962426692 3:135275250-135275272 GTAGGGGGAAGGAAGGGAAGGGG - Intergenic
962778644 3:138689331-138689353 AAATGGGGAGGGGAGGGAAGGGG - Intronic
963089354 3:141467853-141467875 AAAAGGGGAAGGGAGGAAGGGGG - Intergenic
963626374 3:147679270-147679292 GGAAGGGGAAGGGAGGGGAGGGG - Intergenic
963908727 3:150796655-150796677 ATAAGAGGAAGAGGAGGAAGAGG - Intergenic
964002787 3:151796084-151796106 AAAAGGGGAGGGGAGGGGAGGGG + Intergenic
964130727 3:153283322-153283344 ATATGGGGAAGGGAGTGAATAGG - Intergenic
964833358 3:160910310-160910332 AAAAGGGGAGGGGAGGGGAGGGG - Intronic
964837839 3:160959291-160959313 ATAAGGGGGAGGGTGGGAAGGGG + Intronic
965323312 3:167273097-167273119 AGAAGGAGAAGAGAAGGAAGGGG - Intronic
966060530 3:175749185-175749207 AGGAGGGGAAGGGAGGGGAGGGG + Intronic
966140565 3:176752078-176752100 GGAAGGGGAAGGGAAGGGAGGGG + Intergenic
966140629 3:176752378-176752400 AGAAGGGAAAGGGAAGGGAGGGG + Intergenic
966543688 3:181120441-181120463 AGGAGGGGAAGGGAGGGGAGGGG - Intergenic
967188613 3:186966241-186966263 ACAAAGGGAAGGAAGGGAAGAGG + Intronic
967712401 3:192724041-192724063 GGAAGGGAAAGGGAGGGAAGAGG + Intronic
967909278 3:194527862-194527884 AGAAGGGGAGGGGAGGGGAGGGG - Intergenic
968222495 3:196948888-196948910 GGGAGGGGAAGGGAAGGAAGGGG - Intronic
968889181 4:3358935-3358957 AGAAGGGGAGGGGGAGGAAGGGG - Intronic
968909703 4:3471381-3471403 CTTAGGGGAAGGGAGTGAAGGGG + Intronic
969232948 4:5844368-5844390 GGAAGGGGAATGGAGGGAAGGGG + Intronic
969345731 4:6568680-6568702 GGAAGGGGGAGGGAAGGAAGAGG - Intergenic
970079634 4:12265681-12265703 AGAAGGGGAGGGGAGGGGAGGGG + Intergenic
970166451 4:13243233-13243255 AAAATGGGAAGGGAAGGGAGGGG + Intergenic
970178078 4:13359310-13359332 ATCAGAGTAAGGGACAGAAGGGG + Intergenic
970542779 4:17096074-17096096 AAAAGGGGAGGGGAGGGAAGGGG - Intergenic
970565527 4:17328498-17328520 TTGGGGGGAAGGGAGGGAAGAGG + Intergenic
970609989 4:17716275-17716297 ATGAGGGGAAGGGAGTGGAGAGG - Intronic
970852428 4:20617273-20617295 AGAAGGGGAGGGGACGGGAAGGG + Intronic
970873980 4:20848333-20848355 ACAAGGGGAAGAGACAGAAGAGG + Intronic
971045586 4:22801733-22801755 TTGAGGGGAAGGAAGGGAAGGGG - Intergenic
971054300 4:22895507-22895529 CTAAGGGGTAGGGATGGAAATGG + Intergenic
971196996 4:24479197-24479219 AGAAGGGGAAGGGAAGGGAATGG + Intergenic
971392347 4:26197815-26197837 AGGAGGGGAAGGGAAGGGAGGGG + Intronic
971448487 4:26778061-26778083 AGAAGGGGAGGGGAAGGGAGGGG + Intergenic
971472798 4:27044912-27044934 AAAAGGAGAAGGGAGGGAATGGG + Intergenic
971554022 4:27988999-27989021 GGAAGGGGAAGGGAGGGGAGGGG - Intergenic
971784610 4:31084679-31084701 AAAGGGGGAGGGGAGGGAAGGGG + Intronic
972659201 4:41098015-41098037 TTAATGGGAGGGGACGGGAGGGG - Intronic
972859423 4:43149199-43149221 ACAAGGGAAAGGGAAGGAAAGGG + Intergenic
972902972 4:43708007-43708029 AGGAGGGGAGGGGAGGGAAGAGG + Intergenic
972902982 4:43708039-43708061 AGAAGGGGAGGGGAGGGAAGAGG + Intergenic
973572197 4:52252021-52252043 ATAAGGGCAGGGTAAGGAAGAGG + Intergenic
973604741 4:52575482-52575504 GGAAGGGGAAGGGAAGGGAGGGG + Intergenic
973739010 4:53901646-53901668 AGAAAGGGAAGGGAAGGAAATGG + Intronic
973907560 4:55546673-55546695 AGGAGGGGAAGGGAAGGGAGGGG - Intronic
973971609 4:56218579-56218601 GGAAGGGGAAGGGAGGGGAGGGG - Intronic
974192402 4:58523068-58523090 GGAAGGGGAGGGGAGGGAAGGGG - Intergenic
974483011 4:62470339-62470361 AGAAGGGAAGGGGACGGGAGGGG - Intergenic
974880877 4:67756208-67756230 GGAAGGGGAAGGGAAGGAATGGG - Intergenic
975185653 4:71399441-71399463 CGGAGGGGAGGGGACGGAAGGGG - Intronic
975450722 4:74522898-74522920 TTCAGGGGAAGGCAAGGAAGTGG - Intergenic
975687230 4:76929170-76929192 AAAAGGGGAAAGGAAGGGAGAGG + Intergenic
976307199 4:83572210-83572232 ATAAGGGAAAGGGAGAGAAAAGG - Intronic
976458110 4:85273667-85273689 AGAAGGGGAAGGGAAGGAGGCGG + Intergenic
976501914 4:85800531-85800553 AGAGGGGGAAGGGAAGGAAGAGG + Intronic
976753866 4:88477555-88477577 GGAAGGGGAAGGGAGGGGAGGGG + Intronic
977579262 4:98706317-98706339 TTGAGGGGAAGGGGAGGAAGTGG + Intergenic
977870163 4:102081598-102081620 GGAAGGGGAAGGGAAGGAAAGGG + Intergenic
977954364 4:103010320-103010342 ATAAGGGTAAGGGACGCAAATGG + Intronic
978070340 4:104459761-104459783 ATAAAGGAAAGAGAAGGAAGAGG - Intergenic
978243854 4:106548932-106548954 AGAAAGGGAAGGGAAGGAAAGGG - Intergenic
978655922 4:111065332-111065354 AAAAGGAGAAAGGAAGGAAGGGG - Intergenic
978739242 4:112119018-112119040 AGGAGGGGAGGGGACGGGAGAGG + Intergenic
979222078 4:118238874-118238896 ATAAGGGAAAGATACGTAAGGGG + Intronic
979241742 4:118453093-118453115 TTGAGGGGAAGGGAGGGGAGGGG + Intergenic
979543661 4:121915551-121915573 AAAAGAGGACGGGAGGGAAGTGG - Intronic
979774933 4:124578387-124578409 ATAAGGGGAAGGGGAGGATAGGG + Intergenic
980377438 4:131968047-131968069 AGAAGGGGAAGGAAAGGAAGTGG + Intergenic
980896953 4:138869035-138869057 AGGAGGGGAGGGGAGGGAAGTGG + Intergenic
981086468 4:140689461-140689483 AAAAGGGGAAGGGAAGGGAAGGG - Intronic
981086483 4:140689497-140689519 AAAGGGGGAAGGGAAGGAAAGGG - Intronic
981086562 4:140689702-140689724 GGAGGGGGAAGGGAAGGAAGGGG - Intronic
981574520 4:146190810-146190832 AGATTGGGAAGGGAGGGAAGAGG - Intronic
981990047 4:150907308-150907330 AGAGGGGGAAGGGAGGGAGGGGG + Intronic
982452501 4:155569937-155569959 AAAAGGGGAAGGGAAGGGAAGGG + Intergenic
983217888 4:165019161-165019183 ATAAGAGGAAGGGAGGGATAGGG - Intergenic
983336099 4:166394548-166394570 AGAGGGGGAAGGGAGAGAAGAGG + Intergenic
984858925 4:184219790-184219812 GAAAGGGGAGGGGAAGGAAGGGG + Intronic
984911308 4:184676618-184676640 GGAAGGGGAGGGGAAGGAAGGGG - Intronic
984926208 4:184809210-184809232 ATAAGGGGATGGGCAGGGAGTGG - Intronic
984949429 4:184995880-184995902 CTAAGGGGAAGGGACCAATGAGG + Intergenic
986221777 5:5774963-5774985 AGAAGGAGAAGGGGAGGAAGGGG - Intergenic
986946645 5:13029237-13029259 AGAAGGGGAAGGGGAAGAAGGGG + Intergenic
986946651 5:13029252-13029274 AGAAGGGGAAGGGGAAGAAGGGG + Intergenic
986946664 5:13029286-13029308 AGAAGGGGAAGGGGAAGAAGGGG + Intergenic
986946694 5:13029367-13029389 AGAAGGGGAAGGGGAAGAAGGGG + Intergenic
987539031 5:19229565-19229587 AAAAGGGAAAGGGAGGTAAGAGG - Intergenic
988193464 5:27968794-27968816 TTAATGGGAAGGGAAGGAAAGGG - Intergenic
989216968 5:38914831-38914853 AGAAGGGGAAGGAAGGGAGGGGG + Intronic
989978492 5:50613322-50613344 AGAGGGGGACGGGATGGAAGGGG - Intergenic
990063001 5:51675267-51675289 ATAAGGGGAAGGGTGGAAAAAGG - Intergenic
990407232 5:55503808-55503830 GGAAGGGGAGGGGAGGGAAGAGG + Intronic
990641796 5:57793946-57793968 AGAGGGGGAAGGGAGGGAGGGGG - Intergenic
990953825 5:61324193-61324215 AGAAGGGGAAAGAAGGGAAGGGG + Intergenic
990953831 5:61324208-61324230 GGAAGGGGAGGGGAGGGAAGTGG + Intergenic
992349659 5:75916213-75916235 AGAAGGGGAAGGGGAGGAAGAGG - Intergenic
992374509 5:76175053-76175075 AGAAGGGGAAGGGAAGGAGAGGG + Intronic
992542989 5:77782886-77782908 ACAAGTGGAAGGGAAGGAAGGGG - Intronic
992594964 5:78336964-78336986 AGAAAGGGAAGGGAAGGATGTGG + Intergenic
993012237 5:82496165-82496187 AAAAGGGGAAGAGGGGGAAGGGG + Intergenic
993076789 5:83242025-83242047 AGAAGTGGAAGAGAAGGAAGGGG + Intronic
993095528 5:83474230-83474252 AGAAAGGGAAGGAAGGGAAGTGG + Intronic
993797102 5:92281429-92281451 CTCAGAGGAAGGGGCGGAAGTGG + Intergenic
995376523 5:111480358-111480380 ATAGGTGGGAGGGACTGAAGGGG - Intronic
995453003 5:112323198-112323220 ATAACTGGAAAGGAGGGAAGAGG + Intronic
995840596 5:116440064-116440086 ATAAGGGGAAGCTAATGAAGGGG - Intergenic
996150984 5:120034732-120034754 AAAAGGAGAAGGGAGGGGAGGGG - Intergenic
996339395 5:122419201-122419223 AAAAGGGGAAGGGGAGGGAGTGG + Intronic
996886591 5:128363167-128363189 AGGAAGGGAAGGGAGGGAAGGGG - Intronic
997039751 5:130238038-130238060 TGAAGGGGAAGGGAGGGATGTGG - Intergenic
997679923 5:135742993-135743015 GGAAGGGGAAGGGAGGGGAGAGG - Intergenic
997679951 5:135743053-135743075 ATGAAGGGAAGGGAAGGGAGGGG - Intergenic
997759149 5:136428193-136428215 AAAAGGGGAGGGGAAGGGAGGGG - Intergenic
997917722 5:137944949-137944971 AGAGGGGGAAGGGAGGGAGGGGG + Intronic
998798407 5:145843137-145843159 AGAAGGGGAAAGGAGAGAAGGGG + Intergenic
998809623 5:145953300-145953322 ATGAGAGGAAGGCAGGGAAGTGG + Intronic
999132554 5:149295611-149295633 GAAAGAGGAAGGGAGGGAAGTGG + Intronic
999289732 5:150416287-150416309 GTAGGGGGAAGGGAGGGACGGGG + Intergenic
999366544 5:151027355-151027377 ATGAGAGGAAGGGACAGAACAGG - Intronic
999467622 5:151822576-151822598 AGAAGGGGAACGGAGGGAGGGGG - Intronic
999517315 5:152314477-152314499 AGAAAGGGAGGGGAGGGAAGAGG - Intergenic
1000057490 5:157620054-157620076 AGAAGGGGAGGGGAGGGGAGGGG + Intergenic
1001253508 5:170166484-170166506 GCAAGGGGAAGGGAAGGGAGAGG + Intergenic
1001582166 5:172806297-172806319 ATCAGGGGCAGGAAGGGAAGGGG - Intergenic
1001686338 5:173597554-173597576 AGGAGGGGAAGGGAGGGGAGGGG - Intergenic
1001837278 5:174843056-174843078 ATGAGGAGAATGGACAGAAGGGG + Intergenic
1001868332 5:175125674-175125696 GAGAGGGGAAGGGAGGGAAGTGG - Intergenic
1002208782 5:177583139-177583161 AAAAGGGGAGGGGAGGGGAGAGG - Intergenic
1002453193 5:179331248-179331270 AGAAGGGGCAGGGAGGGGAGAGG + Intronic
1002485722 5:179534914-179534936 AAAAAGGGAAGGGAAGGAATTGG + Intergenic
1002607541 5:180391897-180391919 ATAAGGAGAAGGGAGTGAGGAGG - Intergenic
1002904696 6:1438861-1438883 AGCAGGAGAAGGGAGGGAAGAGG - Intergenic
1002990146 6:2230946-2230968 ATTAGGGGAAGGAACGGGGGGGG - Intronic
1003012471 6:2438569-2438591 AGAAGGGGAAGGGAGGGAAGAGG - Intergenic
1003158305 6:3615049-3615071 AGGAGGGGAGGGGAGGGAAGGGG + Intergenic
1003289521 6:4767591-4767613 ATGAGGGGAGGGGAGGGGAGGGG + Intronic
1003322289 6:5062897-5062919 AGGAGGGGAAGGGAAGGAGGAGG + Intergenic
1003801862 6:9679032-9679054 GAAAGGGGAGGGGACGGGAGAGG - Intronic
1003887616 6:10535396-10535418 TTAAGGGTAAAAGACGGAAGTGG - Intronic
1004127392 6:12887015-12887037 ACAAGGGGAAGAGGAGGAAGAGG - Intronic
1005142294 6:22646708-22646730 ATAAGAGTAAGAGGCGGAAGGGG + Intergenic
1005144347 6:22670634-22670656 AAAAGAGGAAGGGAAGGAAAAGG - Intergenic
1005371345 6:25136980-25137002 AGAAGGGGAAGGGACAGTAGAGG + Intergenic
1005402682 6:25450827-25450849 GGAAGGGGAGGGGAGGGAAGGGG - Intronic
1006342277 6:33453212-33453234 GTAGGGGGATGGGACTGAAGGGG - Exonic
1006921872 6:37632828-37632850 AGAAGGGTCAGGGAGGGAAGGGG - Exonic
1007040363 6:38715757-38715779 AGAAGGGGAAGGGTGGGAGGGGG + Intronic
1007040680 6:38719377-38719399 AGAAGGGGAAGGGAAGGATGGGG - Intronic
1007088522 6:39167472-39167494 ACATGGGGAAGGGCAGGAAGAGG + Intergenic
1007275839 6:40673040-40673062 AGAAGGAGAAAGGAAGGAAGAGG - Intergenic
1007924917 6:45643015-45643037 AGAAGGGGAAAGGAAGGGAGAGG - Intronic
1008192017 6:48470930-48470952 ATAAGGATAAGAGATGGAAGAGG + Intergenic
1008490068 6:52077398-52077420 ATTGGGGGAGGGGAGGGAAGGGG - Intronic
1008893356 6:56522438-56522460 GTAAGGGGAAGGGAGTGAAAAGG - Intronic
1009803995 6:68578743-68578765 AAAAGGGGAGGGGAGGGAAGGGG + Intergenic
1011152120 6:84286214-84286236 AGGAGGGGAAGGGAGGGGAGGGG - Intergenic
1011238666 6:85246815-85246837 GGAGGGGGAAGGGAGGGAAGGGG - Intergenic
1011308182 6:85952501-85952523 AGAAGGGGAAGGGTGGGAGGGGG - Intergenic
1011509162 6:88080967-88080989 ATAAGGAAAAGGGATGGGAGAGG - Intergenic
1011804586 6:91057930-91057952 AGGAGGGGAAAGGAGGGAAGGGG - Intergenic
1012424859 6:99102693-99102715 AAAAGGAGCAGGGAGGGAAGAGG + Intergenic
1013693497 6:112673027-112673049 AAGAGGGGAAAGGAGGGAAGGGG - Intergenic
1014513572 6:122354844-122354866 AGAAGGGGAGGGGAGGGGAGAGG + Intergenic
1014729337 6:125013293-125013315 ATAAGAGGAAGGGTAGGAATAGG + Intronic
1014755941 6:125301989-125302011 ACAAGGGGAAGGGGAGGAGGAGG - Intronic
1014877976 6:126684736-126684758 AGAAGGGGGAGGGAGGGAAGAGG + Intergenic
1015218411 6:130776836-130776858 ATGAGGGGAAGGAACTGAAAGGG + Intergenic
1015281512 6:131439803-131439825 AAAGGGGGAAGGAAGGGAAGGGG + Intergenic
1015888553 6:137945924-137945946 ATAAGTGGAGGGGAGGAAAGAGG + Intergenic
1015895701 6:138014433-138014455 ACAAGGGGAATGGAAGGAAATGG + Intergenic
1016439027 6:144064594-144064616 AAAAGGGGAAGGGGAGGAAGGGG + Intronic
1016623522 6:146139994-146140016 GTGAGGGGAGGGGAGGGAAGCGG - Intronic
1016830091 6:148425681-148425703 AGAAGGGGAGGGGAGGGGAGGGG - Intronic
1016922085 6:149306039-149306061 ATAAGATGAAGGGAAAGAAGTGG + Intronic
1017293233 6:152765588-152765610 GTTAGGGGAGGGGAGGGAAGGGG - Intergenic
1017494742 6:154973616-154973638 AGAAGGGGAGGGGAGGGGAGGGG + Intronic
1017988979 6:159469930-159469952 GGAAGAGGAAGGGAGGGAAGAGG + Intergenic
1018839416 6:167507822-167507844 AACAGGGGAAGGGAGGGAATGGG - Intergenic
1018964545 6:168474270-168474292 ATAAGGGGGAGGGACGATAAGGG + Intronic
1019124264 6:169828684-169828706 ATAAGGCTAAGGGAGGGAAGGGG - Intergenic
1019343519 7:519256-519278 GTAGGGGGTGGGGACGGAAGGGG + Exonic
1019352931 7:563369-563391 AGAAGGGAAAGGAAAGGAAGGGG + Intronic
1020579863 7:9983302-9983324 ATAAGGGGTAGTTAGGGAAGAGG + Intergenic
1020877250 7:13713483-13713505 GAAGGGGGAAGGGAAGGAAGGGG + Intergenic
1020877257 7:13713499-13713521 GAAGGGGGAAGGGAAGGAAGGGG + Intergenic
1020965907 7:14868253-14868275 ATAGGGGGCAGTGACAGAAGGGG - Intronic
1021059978 7:16099408-16099430 GGAAGGGGAGGGGAGGGAAGGGG + Intronic
1021352989 7:19617854-19617876 AGAAGGGGAGGGGAGGGATGGGG - Intergenic
1021950513 7:25769579-25769601 AGAAGGGGAAGGGAAGGAGAAGG + Intergenic
1021998413 7:26201906-26201928 AGAAGGGGAGGGGAGGGGAGCGG - Intronic
1022045609 7:26620054-26620076 ACATGGGGCAGGGACTGAAGAGG - Intergenic
1022073506 7:26941530-26941552 AGAAGGGGAGGGGAGGGGAGGGG + Intronic
1022161724 7:27717718-27717740 AAAAGGGGAAGGGAAGGGAAGGG - Intergenic
1022274439 7:28841851-28841873 GGAAGGGGAAGGGAGGGAAGGGG + Intergenic
1022840354 7:34158302-34158324 AGAGAGGGAAGGGAAGGAAGAGG + Intergenic
1022854115 7:34298704-34298726 ATAAGGGGAAGGGGTGGAGGGGG + Intergenic
1023116769 7:36870219-36870241 ATAAGGGTAAGAGACGTAAAAGG + Intronic
1023156404 7:37256605-37256627 AAAAGGGGAGGGGAGGGCAGAGG + Intronic
1023577815 7:41648255-41648277 ATAAGGGAAATGGAAGGAGGTGG - Intergenic
1024090256 7:45933411-45933433 TTAAGGGGAAGGGTAGGAAGAGG - Intergenic
1024171341 7:46791074-46791096 ATAAGGGGGAAGAAGGGAAGGGG + Intergenic
1024577109 7:50773441-50773463 GAAAGGGGAAGGGAGGGGAGGGG + Intronic
1024725436 7:52189302-52189324 AAGAGGGGAAGGGAAGGGAGAGG + Intergenic
1024999558 7:55303687-55303709 AGCAGGGGAGGGGAAGGAAGAGG + Intergenic
1025814076 7:64893700-64893722 GGAAGGGGAAGGGAGGGGAGGGG - Intronic
1026040625 7:66865554-66865576 AGAAGGGGAAGGGAAGAAAAAGG - Intergenic
1026155000 7:67818902-67818924 GGGAGGGGAAGGGAGGGAAGTGG - Intergenic
1026155011 7:67818927-67818949 GGAAGGGGAAGGGAAGGGAGGGG - Intergenic
1026225489 7:68436581-68436603 GGGAGGGGAGGGGACGGAAGAGG - Intergenic
1026228464 7:68462952-68462974 AAAAGGGTAGGGGATGGAAGGGG - Intergenic
1026245063 7:68612304-68612326 AGAAAGGGAAGGGAGGGGAGTGG - Intergenic
1026529547 7:71185137-71185159 GGAAGGGGAGGGGACGGGAGGGG - Intronic
1026583091 7:71634122-71634144 AAAAGGGGGAGGGAAGGAGGGGG - Intronic
1026678693 7:72449173-72449195 AGAAAGGGAAAGGAAGGAAGGGG + Intergenic
1026721986 7:72839940-72839962 AGGAGGGGTAGAGACGGAAGAGG + Intergenic
1026727140 7:72878988-72879010 ATAAGGAGAAGGAAAGGAAAGGG - Intergenic
1026803669 7:73416068-73416090 AGAAGGGGAAGGGAAGGGAAGGG + Intergenic
1027116692 7:75486632-75486654 ATAAGGAGAAGGAAAGGAAAGGG + Intergenic
1027122009 7:75528445-75528467 ATAAGGAGAAGGAAAGGAAAGGG + Intergenic
1027275113 7:76548965-76548987 ATAAGGAGAAGGAAAGGAAAGGG - Intergenic
1027408098 7:77884378-77884400 AGAAGGGGTAGGGTGGGAAGGGG - Intronic
1027454601 7:78373741-78373763 AGAAGGTGAAGGGAAGGAGGGGG - Intronic
1028018046 7:85739476-85739498 AGAAGGAGAAGAGAGGGAAGGGG + Intergenic
1028403173 7:90446576-90446598 AGAAGGGGAGGGGAGGGAAGGGG - Intronic
1028529039 7:91817813-91817835 AAAAGGGGACAGGAAGGAAGGGG - Intronic
1028584642 7:92440541-92440563 AAATGGGGAAGGGAGGGAAATGG - Intergenic
1029503718 7:100949686-100949708 GTAAGGGGGAGAGGCGGAAGGGG + Intronic
1029720804 7:102363435-102363457 ATAAGGAGAAGGAAAGGAAAGGG - Intergenic
1030299376 7:107959961-107959983 ATGAGCGGAAGGGAAGAAAGGGG + Intronic
1030386039 7:108869485-108869507 ATAAGAGAAGGGGAAGGAAGTGG + Intergenic
1030432810 7:109472866-109472888 ATAAGAGGAAGAGGAGGAAGAGG + Intergenic
1030697715 7:112603981-112604003 GGAAGGGGAAGGGAGGGGAGGGG - Intergenic
1030997712 7:116378300-116378322 AGGAGGGGAGGGGAAGGAAGGGG + Intronic
1031562954 7:123260395-123260417 GGAAGGGGAAGGGAGGGGAGGGG + Intergenic
1031866105 7:127039931-127039953 GGAAGGGGAAGGGAGGGGAGGGG + Intronic
1031912494 7:127532746-127532768 GGAAGGGGAAGGGAGGGGAGGGG + Intergenic
1032423654 7:131802976-131802998 ATTAGAGAAAGGGATGGAAGAGG - Intergenic
1032431944 7:131869579-131869601 AGGAGGGGAAGGGAGGGGAGGGG - Intergenic
1032521797 7:132551042-132551064 CTAAGTGGAAGGGAAGGCAGAGG - Intronic
1033354954 7:140592011-140592033 AGAAGGGGAGGGGAGGGGAGAGG - Intronic
1033356220 7:140602223-140602245 AGAATGGGAAGGGAAGAAAGAGG - Exonic
1034467575 7:151238909-151238931 AGAAGGGGAAGGGAAGAAGGTGG - Intronic
1034625172 7:152487188-152487210 AGAAGGGAAAGGAAAGGAAGAGG - Intergenic
1034653711 7:152712735-152712757 AGGAGGGGAAGGGAGGGGAGAGG - Intergenic
1034653754 7:152712817-152712839 AGGAGGGGAAGGGAGGGGAGAGG - Intergenic
1034653778 7:152712868-152712890 AGGAGGGGAAGGGAGGGGAGAGG - Intergenic
1034653787 7:152712888-152712910 AGGAGGGGAAGGGAGGGGAGAGG - Intergenic
1034653812 7:152712939-152712961 AGGAGGGGAAGGGAGGGGAGAGG - Intergenic
1034653821 7:152712959-152712981 AGGAGGGGAAGGGAGGGGAGAGG - Intergenic
1034865075 7:154634656-154634678 AGAAGGGGAAGAGGAGGAAGAGG - Intronic
1035179057 7:157076301-157076323 AAGAAGGGAAGGGAAGGAAGGGG - Intergenic
1035368784 7:158365383-158365405 AGAAGGGGAAGGGAGGGGTGAGG - Intronic
1035971271 8:4251878-4251900 AAGAGGGGAAGGGAGGGGAGGGG + Intronic
1036176780 8:6546767-6546789 ATTGGGGGAAGGGGAGGAAGAGG - Intronic
1037323155 8:17662869-17662891 AAAGGAGGAAGGGAGGGAAGGGG + Intronic
1037760185 8:21736906-21736928 ATGAGGGGAGGGGAGGGGAGGGG + Intronic
1037926846 8:22850358-22850380 ATGGTGGGAAGGGACTGAAGAGG + Intronic
1038037442 8:23698451-23698473 ATTAGGGGAAGGGAAGGGAAGGG + Intergenic
1038053170 8:23832569-23832591 TTAAGGGCAAGGGTTGGAAGGGG - Intergenic
1038647355 8:29372890-29372912 AGGAGGAGAAGGGAAGGAAGTGG + Intergenic
1038884959 8:31653007-31653029 AGAAGGGGAGGGGAGGGGAGGGG - Intronic
1039564682 8:38542529-38542551 AGAAGGGGAGGGGAGGGGAGGGG - Intergenic
1039644080 8:39261206-39261228 TTAAGGGGAAGGGAGGGATAAGG - Intronic
1039954516 8:42196725-42196747 ATTGGCGGAAGGGATGGAAGAGG + Intronic
1040983439 8:53268730-53268752 AGAAGGAGGAGGAACGGAAGGGG + Intergenic
1041191688 8:55361593-55361615 CCAAGGAGAAGGGAAGGAAGAGG - Intronic
1041289676 8:56296927-56296949 AGAAAGGGAGGGGAAGGAAGGGG - Intergenic
1041501742 8:58546498-58546520 AAATGGGGAAGGGAGGAAAGAGG - Intergenic
1041746148 8:61211309-61211331 GAAAGGGGAAGAGAAGGAAGAGG - Intronic
1041852663 8:62410094-62410116 AGAGGGGGAAGGGAGGGAGGAGG - Intronic
1042061135 8:64819257-64819279 AGAAGAGAAAGGGAGGGAAGTGG - Intergenic
1042067388 8:64893207-64893229 ATATGGGGGAGGGAGGAAAGTGG - Intergenic
1042327986 8:67548197-67548219 AAGAGGGGAAGGGAGGGGAGGGG - Intronic
1042389830 8:68221009-68221031 AAAAGGGGAGAGGAAGGAAGGGG - Intronic
1042564559 8:70099047-70099069 AAAAGGAGAGGGGAGGGAAGGGG + Intergenic
1043085035 8:75819359-75819381 TTAAGGGGAAGAGACTGAAAAGG + Intergenic
1043912150 8:85875580-85875602 ATAAAGAGAAAGGAAGGAAGTGG - Intergenic
1044153772 8:88817183-88817205 AAAAGGGGAGGGGAGGGGAGGGG - Intergenic
1044670119 8:94671486-94671508 ATAATGGGAGGGGTTGGAAGTGG - Exonic
1044975350 8:97659267-97659289 ATATGGGGGAAGGAAGGAAGAGG - Intronic
1045516442 8:102864275-102864297 AAAAGGGAGGGGGACGGAAGAGG + Exonic
1046108438 8:109693104-109693126 GGAAGGGGAGGGGAGGGAAGGGG - Intergenic
1046225073 8:111267669-111267691 TCGAGGGGAAGGGATGGAAGGGG - Intergenic
1046936173 8:119887471-119887493 GGAAGGGGAAGGGAGGGGAGGGG - Intronic
1047370697 8:124253495-124253517 AGATGGGGAAGGGAGGGAAAAGG - Intergenic
1047437772 8:124849016-124849038 AGAAAGGGAAGGGAAGGAAAGGG - Intergenic
1047629547 8:126692143-126692165 ATGAGGGGAGGGGAGGGGAGAGG - Intergenic
1047696227 8:127406257-127406279 AGGAAGGGAAGGGAAGGAAGGGG + Intergenic
1047826559 8:128582248-128582270 AAAAGGGGAGGGGATGGACGGGG - Intergenic
1048132550 8:131713762-131713784 AGGAGGGGAGGGGAGGGAAGGGG + Intergenic
1048183134 8:132214556-132214578 ATATGGAGAAGGGAGGGGAGAGG - Intronic
1049440414 8:142607122-142607144 GGAAGGGGAGGGGAGGGAAGGGG + Intergenic
1049870525 8:144971776-144971798 AAAAGAGGAAGGGAGGGAGGGGG - Intergenic
1050169723 9:2802797-2802819 CTACTGGGAAGGGAGGGAAGAGG + Intronic
1050302835 9:4276397-4276419 GGAAGGGGAGGGGAGGGAAGGGG + Intronic
1050302843 9:4276412-4276434 GGAAGGGGAGGGGAGGGAAGGGG + Intronic
1050302861 9:4276447-4276469 GGAAGGGGAGGGGAGGGAAGGGG + Intronic
1050302878 9:4276482-4276504 GGAAGGGGACGGGAGGGAAGGGG + Intronic
1051440231 9:17075412-17075434 AAAAGGGGAGGGGAGGGAAGGGG - Intergenic
1051785278 9:20735490-20735512 AGGAGGGGAAGGGAGGGGAGGGG - Intronic
1051895192 9:21979275-21979297 ATAATGGGATGGCAAGGAAGTGG + Intronic
1052087517 9:24286433-24286455 GGGAGGGGAAGGGAGGGAAGGGG - Intergenic
1052357132 9:27516731-27516753 ATATGGGGAATGGAATGAAGTGG - Intronic
1052475738 9:28956746-28956768 GGAAGGGGAGGGGAGGGAAGGGG - Intergenic
1052688427 9:31782534-31782556 AGAAGGTGGAGGGATGGAAGAGG + Intergenic
1052695556 9:31872925-31872947 AAAAGAGGAAAGGAAGGAAGGGG - Intergenic
1053135896 9:35650140-35650162 AAAAGGGGGAGGGAAGGAAGTGG - Intronic
1053233777 9:36434236-36434258 GAAAGGGGAAGGGAGGGGAGGGG + Intronic
1053287786 9:36861027-36861049 AGGAGGGGAGGGGAGGGAAGAGG + Intronic
1053320098 9:37090416-37090438 ATAAGGGGAAGAGCAGGAACAGG - Intergenic
1053324854 9:37134610-37134632 ATAAGGGGAAGGGCAGGAACAGG - Intronic
1053642434 9:40098421-40098443 AGAAGGGGAAGGAAAGGAAGTGG + Intergenic
1053763705 9:41367055-41367077 AGAAGGGGAAGGAAAGGAAGTGG - Intergenic
1054323306 9:63695711-63695733 AGAAGGGGAAGGAAAGGAAGTGG + Intergenic
1054542321 9:66278223-66278245 AGAAGGGGAAGGAAAGGAAGTGG - Intergenic
1055316552 9:75039841-75039863 GGAAGGGGAAGAGAGGGAAGAGG - Intergenic
1055786963 9:79881549-79881571 AGAAGGAGAGGGGAGGGAAGAGG - Intergenic
1055874374 9:80924534-80924556 AAAAGGGGAAGGGGCAGGAGAGG + Intergenic
1056380860 9:86056109-86056131 CTAAGGGGAATGGACAGAAAAGG - Intronic
1056496626 9:87161736-87161758 AGAAGGGGAAGAGAGAGAAGGGG + Intergenic
1056772282 9:89486920-89486942 AAAAGGGAAAGGAAGGGAAGGGG + Intronic
1056961913 9:91132625-91132647 GGAAGGGGAAGGGAGGGGAGGGG + Intergenic
1057013875 9:91633103-91633125 AGGAGGGGAAGGGAAGGGAGAGG + Intronic
1057450566 9:95155270-95155292 GAAAGGGGAGGGGAAGGAAGGGG + Intronic
1057633035 9:96736284-96736306 AGGAGGGGAGGGGAGGGAAGGGG - Intergenic
1058136577 9:101314298-101314320 ATATTGGGGAGGGAAGGAAGAGG - Intronic
1058139443 9:101342384-101342406 AGGAGGGGAAGGGGGGGAAGGGG + Intergenic
1058640542 9:107079633-107079655 GGAAGGGGAGGGGAAGGAAGGGG + Intergenic
1058945738 9:109854243-109854265 ATAAGAAGAAGGGCAGGAAGAGG + Intronic
1059048053 9:110892676-110892698 AGAGGGGGAAGGGAGGGGAGGGG + Intronic
1059048069 9:110892725-110892747 GAAAGGGAAAGGGAAGGAAGAGG + Intronic
1059321224 9:113471629-113471651 AGGGGAGGAAGGGACGGAAGAGG - Intronic
1059353534 9:113682939-113682961 ACACTGGGAAGGGAGGGAAGGGG + Intergenic
1059382634 9:113938858-113938880 ATAATGGGACGGAACGGATGTGG - Intronic
1059433977 9:114265546-114265568 ATAAGGAGAAGGGTTGGAAAGGG + Intronic
1059592760 9:115679892-115679914 AGAAGGGGAAGGAGAGGAAGAGG - Intergenic
1059801131 9:117750559-117750581 ATAATGAGAAGGAAGGGAAGGGG - Intergenic
1060108697 9:120891258-120891280 AGAAGGGGAAAGGAGGGGAGAGG - Intronic
1060301029 9:122374804-122374826 ATTTGGGGAAGGGATGGAAAGGG - Intronic
1060473890 9:123970918-123970940 TAGAGGGGAAGGGAGGGAAGGGG - Intergenic
1060756902 9:126220084-126220106 ATAATGGGAGGGGAGGGAGGAGG + Intergenic
1060833232 9:126733194-126733216 ACCAGTGGAAGGGACCGAAGGGG + Intergenic
1061423286 9:130483816-130483838 GGAAGGGCAAGGGAGGGAAGAGG - Intronic
1061517252 9:131096961-131096983 CCCAGGGGAAGGGAAGGAAGAGG - Intronic
1061559420 9:131393689-131393711 AGAGGGGGAAGGGATGGAGGGGG - Intergenic
1061625267 9:131837628-131837650 GTCTGGGGAAGGGACGGGAGCGG + Intergenic
1061840662 9:133356819-133356841 ATCAGGGGAGGAGAGGGAAGGGG + Intronic
1061942532 9:133891361-133891383 ATAAAGGGGAGGGATGGAGGGGG + Intronic
1061947176 9:133914809-133914831 AGAAGGGGAGGGGAGGGGAGAGG + Intronic
1062355811 9:136161735-136161757 GGAAGGGAAAGGGAGGGAAGGGG - Intergenic
1202790208 9_KI270719v1_random:81451-81473 GCAAGGGGAAGGAAAGGAAGTGG + Intergenic
1203746421 Un_GL000218v1:42819-42841 AGAAGGGGAAGGGAGGGAGGAGG + Intergenic
1203563685 Un_KI270744v1:76661-76683 AGAAGGGGAAGGGAGGGAGGAGG - Intergenic
1185537286 X:872744-872766 AGGAGGGGAAGGGAAGGGAGGGG - Intergenic
1185602346 X:1348988-1349010 AGGAGGGGAAGGGAGGGGAGGGG - Intronic
1185640395 X:1587610-1587632 AGGAGGGGAAGGGAGGGGAGGGG - Intergenic
1185640416 X:1587655-1587677 AGGAGGGGAAGGGAGGGGAGGGG - Intergenic
1185820206 X:3195842-3195864 AAAAGGGGAAGGAAGGGAGGGGG + Intergenic
1185825310 X:3243704-3243726 AGAAAGGGAAGGAAGGGAAGGGG + Intergenic
1185869196 X:3649728-3649750 AGAATGGGAGGGGAGGGAAGGGG + Intronic
1185871007 X:3664809-3664831 AAAAGGGGAAGGCTGGGAAGGGG + Intronic
1186264590 X:7818629-7818651 AGGAGGGGGAGGGAGGGAAGAGG + Intergenic
1186423971 X:9448998-9449020 GGAAGGGGAGGGGATGGAAGGGG - Intergenic
1187772147 X:22711511-22711533 AGAAGGGGAAGAGAGGGATGAGG + Intergenic
1187957710 X:24536006-24536028 GGAAGGGGAAGGGAGGGGAGGGG + Intronic
1188327430 X:28822771-28822793 ATAAGGACAAGGGATGGAAGGGG + Intronic
1188452231 X:30319795-30319817 ATAAGGGGATGGAACAGAAGTGG + Intergenic
1188697721 X:33216444-33216466 AGAGGGGGAATGGAGGGAAGCGG + Intronic
1188786345 X:34351442-34351464 AGAAGGGGAGGGAAGGGAAGGGG + Intergenic
1189286129 X:39853687-39853709 AGAAGAGGAAGGGAGGGGAGGGG + Intergenic
1189463682 X:41262320-41262342 AGAAAGGGAAGGGAGGGGAGGGG - Intergenic
1189953496 X:46255959-46255981 AGATGGGGAAGGGTAGGAAGAGG + Intergenic
1190191498 X:48280735-48280757 AAAAAGGGAAGGGAAGGGAGGGG + Intergenic
1190239249 X:48644588-48644610 AGAAGGAGAAGGGGAGGAAGGGG - Intergenic
1190431966 X:50386663-50386685 ATATGGGGAAGGGTAGGGAGGGG + Intronic
1190544237 X:51508473-51508495 TTAAAGGGCAGGGACAGAAGGGG + Intergenic
1190936484 X:55002896-55002918 GTATGGGGAAGGGACAGAAGGGG + Intronic
1191690633 X:63934419-63934441 AAAAGGGAAGGGGAGGGAAGGGG + Intergenic
1191965620 X:66754014-66754036 TCAAGGGGAAGGGTGGGAAGGGG - Intergenic
1192160443 X:68782486-68782508 AGAAGGGGAGGGGAGGGGAGGGG - Intergenic
1192190976 X:68990991-68991013 AGAAGGCGAAGGGCAGGAAGTGG - Intergenic
1192292475 X:69811951-69811973 AAAAGGGGAAGGGACAGGAGTGG + Intronic
1192730078 X:73794253-73794275 AAAAAGGGAAGGGAAGGAAAGGG + Intergenic
1192796918 X:74431468-74431490 AGATGGGGAAGGGTGGGAAGGGG + Intronic
1192830850 X:74749604-74749626 GAAAGGGGAAGGGAAGGAATGGG - Intronic
1193507157 X:82358962-82358984 AGAAGGGGATGGGAGGGGAGGGG + Intergenic
1193794921 X:85862602-85862624 AAAAGGGGAAGTGAGGGAAAGGG + Exonic
1194646879 X:96468666-96468688 AGAAGAGGAAGGGAGGGGAGGGG + Intergenic
1194869781 X:99115025-99115047 ATAAAGAAAAGGGAGGGAAGTGG + Intergenic
1195256559 X:103096651-103096673 ACAAGGGGAGGGGACCGAAAGGG - Intergenic
1195751864 X:108167904-108167926 CTGAGAGGAAGGGAAGGAAGAGG - Intronic
1195802867 X:108733337-108733359 CTGAGGGGAAGGGGAGGAAGTGG + Exonic
1196210097 X:112986420-112986442 GGGAGGGGAAGGGAGGGAAGAGG + Intergenic
1196210114 X:112986467-112986489 CTAAGGGGAGGGGAGGGGAGGGG + Intergenic
1196237577 X:113300054-113300076 AGGAGGGGAAGGGAGGGGAGCGG - Intergenic
1196303142 X:114069357-114069379 AGAAGGGGAGGGGAAGGGAGGGG - Intergenic
1196428422 X:115596487-115596509 ATATGGGGAAGGGGAGGAACGGG + Intronic
1196727054 X:118905247-118905269 GGAAGGGGAAGGGGAGGAAGAGG - Intergenic
1196745315 X:119066534-119066556 TGGAGGGGAAGGCACGGAAGAGG - Intergenic
1197852430 X:130877424-130877446 ATCTGGGGAAAGGACAGAAGAGG - Intronic
1197874635 X:131090075-131090097 ATAAAGGGGAGGGAGTGAAGTGG + Intergenic
1197969221 X:132097447-132097469 TGATGGGGAGGGGACGGAAGAGG - Intronic
1198082419 X:133252361-133252383 AGAAGGGGAGGGGAGAGAAGAGG + Intergenic
1198734791 X:139773376-139773398 ATAAGAGGAAGAGACAGCAGAGG + Intronic
1198787966 X:140312071-140312093 AGAAGGGGGAGGGAGGGAAAGGG + Intergenic
1199090360 X:143684382-143684404 AGAAGGGCAAGGGAAGGAAAGGG + Intergenic
1199102050 X:143813708-143813730 TTGAGGGGAAGGGTGGGAAGGGG + Intergenic
1199284584 X:146041968-146041990 AGAAAGGGAAGGGAGGGGAGAGG + Intergenic
1199715756 X:150506349-150506371 AGAAGAGGAAGAGAAGGAAGAGG - Intronic
1199772168 X:150982234-150982256 ATAAGAGGAAGGAACGGCCGGGG - Intronic
1199945137 X:152659199-152659221 GTAAGGGGAAGGGAAAGTAGTGG + Intergenic
1200757034 Y:6999789-6999811 AGGAGGGGAAGGGAGGGGAGGGG - Intronic
1200793081 Y:7316703-7316725 AAAAGGGGAAGGCTGGGAAGGGG - Intergenic
1200942052 Y:8794262-8794284 AGATGGGGAAAGGAGGGAAGGGG + Intergenic
1201132901 Y:10968283-10968305 GTGAGTGGAAGGGACTGAAGTGG - Intergenic
1201159752 Y:11157833-11157855 AGAAGGGGAAGGGAGGGAGGAGG + Intergenic
1201918297 Y:19206268-19206290 TGAAGGGGAAGGGAAGGGAGAGG - Intergenic
1202389451 Y:24354923-24354945 TTGAGGGGAAGGGAGGGGAGGGG + Intergenic
1202481336 Y:25315196-25315218 TTGAGGGGAAGGGAGGGGAGGGG - Intergenic