ID: 933215830

View in Genome Browser
Species Human (GRCh38)
Location 2:79629089-79629111
Sequence GAAGCAATAAGGGGAAGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1098
Summary {0: 1, 1: 0, 2: 6, 3: 97, 4: 994}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933215830_933215836 -3 Left 933215830 2:79629089-79629111 CCGTCCCTTCCCCTTATTGCTTC 0: 1
1: 0
2: 6
3: 97
4: 994
Right 933215836 2:79629109-79629131 TTCCCCTATGCCAGCCATATTGG 0: 1
1: 0
2: 2
3: 7
4: 113
933215830_933215841 8 Left 933215830 2:79629089-79629111 CCGTCCCTTCCCCTTATTGCTTC 0: 1
1: 0
2: 6
3: 97
4: 994
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933215830 Original CRISPR GAAGCAATAAGGGGAAGGGA CGG (reversed) Intronic
900474373 1:2869350-2869372 GGAGCACTGAGGGGAAGGGAAGG + Intergenic
900508040 1:3039405-3039427 GGAGGAGGAAGGGGAAGGGAGGG - Intergenic
900756803 1:4441004-4441026 GAAGCAATTTGGGGAAGGTTCGG + Intergenic
900912345 1:5609121-5609143 GAAGCAAAAACGGGAATTGAAGG - Intergenic
900926836 1:5711295-5711317 GAAACTACAAGGGGAAGGGCGGG - Intergenic
901028360 1:6291401-6291423 GAAGCTGGAAGGGGCAGGGACGG + Intronic
901448795 1:9323880-9323902 GCAGATATAAGAGGAAGGGATGG - Intronic
902072470 1:13751969-13751991 GAATGAATATGGGGAGGGGAGGG - Intronic
902178562 1:14670109-14670131 GAATGAAAAAGGGGAGGGGAGGG - Intronic
902558952 1:17265052-17265074 GAAGCAGTGAGGGGCAGGGAGGG - Intronic
902936363 1:19767666-19767688 GAAGCAATGAGAGAAAGGAAGGG + Intronic
903176224 1:21583049-21583071 GAAGCAAGACAGGAAAGGGAAGG + Intergenic
903293709 1:22330461-22330483 GAAGCAATCAGGGACAAGGAAGG + Intergenic
903559861 1:24219234-24219256 AAAGAAGGAAGGGGAAGGGAAGG - Intergenic
903591641 1:24460605-24460627 GTAGCAATAAGGGAGAGAGAGGG - Intronic
903627226 1:24740061-24740083 GGGGCAATAAGGGGTTGGGAAGG - Intergenic
903672474 1:25044974-25044996 GAAGAAGGGAGGGGAAGGGAAGG + Intergenic
903682863 1:25108712-25108734 GAAGGAAGGAAGGGAAGGGAAGG + Intergenic
904151224 1:28443071-28443093 GGAGAGATAATGGGAAGGGATGG - Intronic
904216822 1:28927642-28927664 GAGGAAAGAAGGGGGAGGGAGGG - Intronic
904337968 1:29810327-29810349 GAAGGAAGAAGGTGGAGGGAGGG - Intergenic
904448378 1:30594340-30594362 GAAGGAAGGAAGGGAAGGGAGGG + Intergenic
905076900 1:35280184-35280206 GAAGAAAGGAAGGGAAGGGAAGG - Intronic
905256631 1:36688995-36689017 GAAGGAATATGGGAAGGGGAAGG + Intergenic
905260233 1:36712125-36712147 GAAGAAAGAGGAGGAAGGGAAGG - Intergenic
905331085 1:37198173-37198195 GCAGCAATTGGGGGAAGGGCAGG + Intergenic
905463986 1:38139171-38139193 GGAGCAGGTAGGGGAAGGGAGGG + Intergenic
905713672 1:40129534-40129556 TGAGCAATAAGGGGAGTGGAGGG + Intergenic
905898157 1:41562523-41562545 GAAGGAAGGAAGGGAAGGGAAGG - Intronic
906073413 1:43034449-43034471 GAAGAAGGAAAGGGAAGGGAGGG - Intergenic
906804219 1:48764471-48764493 GAAGCCAAATGGGGAAGGGGGGG + Intronic
907212080 1:52832604-52832626 AAAGAAAAAGGGGGAAGGGAAGG - Intergenic
907466923 1:54644343-54644365 AAAGAAAGAAAGGGAAGGGAAGG - Intronic
908075236 1:60510395-60510417 GAAGCAAAACAGGGAGGGGAAGG - Intergenic
908296554 1:62718643-62718665 GAAGGAAGGAAGGGAAGGGAAGG + Intergenic
908325953 1:63023821-63023843 GAAGAAAGAAAGGGAAAGGAAGG - Intergenic
908703638 1:66927634-66927656 GAAGAACTAAGGGTAATGGATGG + Intronic
908741293 1:67330841-67330863 GGAGCAATAAAGGGGAGAGAGGG + Intronic
908768131 1:67572411-67572433 GAGGGAAGGAGGGGAAGGGAGGG + Intergenic
908786274 1:67737527-67737549 GATGCAGAAAGGGAAAGGGAAGG - Intronic
909525294 1:76615333-76615355 GCAGAGCTAAGGGGAAGGGAAGG + Intronic
909663257 1:78107037-78107059 GAAGGAAGGAAGGGAAGGGAGGG - Intronic
910173536 1:84403526-84403548 GAAGGAAGAAGGGGAAGGGCTGG + Intronic
910212067 1:84803887-84803909 AAAGCAAGAGGGTGAAGGGAAGG - Intergenic
910840712 1:91558789-91558811 GAATGAATAAGGGGAAGGGAAGG - Intergenic
911062497 1:93760224-93760246 GAGACAAATAGGGGAAGGGAGGG + Intronic
911137684 1:94458939-94458961 GAAGCGGGGAGGGGAAGGGAGGG - Intronic
911620883 1:100065589-100065611 AAAGGGAAAAGGGGAAGGGAAGG - Intronic
911620920 1:100065727-100065749 GAAGAGAAAAGGGGAAGGAAAGG - Intronic
911764384 1:101656581-101656603 GAATATATAATGGGAAGGGATGG + Intergenic
911767968 1:101701746-101701768 GGAGAAAGAAAGGGAAGGGAAGG - Intergenic
911782515 1:101900403-101900425 GATGGAATAAGGGAAAGGGAAGG + Intronic
912558181 1:110531283-110531305 AAGGAAATAAGGGGAAGGGATGG - Intergenic
912763552 1:112389010-112389032 GAGGCAGTAAGGGGAGGGGTGGG + Intergenic
912865835 1:113255463-113255485 AAAGCAATTAGGGGAGGAGACGG + Intergenic
912917107 1:113826387-113826409 GAAGGGAGAAGGGGAAGGGAAGG + Intronic
913139166 1:115923245-115923267 GGAGCAGGGAGGGGAAGGGATGG - Intergenic
913208875 1:116567170-116567192 GAAGGAAAGAAGGGAAGGGAAGG + Intronic
913248111 1:116888123-116888145 GCAGGGATAAGGGGAAGGGGAGG + Intergenic
913954928 1:143280885-143280907 GAAAGAAAAAGGGGAAAGGAAGG - Intergenic
914922586 1:151857572-151857594 GAGGAAAACAGGGGAAGGGAAGG + Intergenic
915157671 1:153891622-153891644 GAAGGAAAAAGGAGAGGGGAAGG + Intronic
915178022 1:154033027-154033049 GAAGGAAGGAAGGGAAGGGAAGG + Intronic
915895398 1:159807916-159807938 GAGGAAAGAAGGGGAGGGGAAGG + Intronic
916176942 1:162049855-162049877 GAAGGAAGGAAGGGAAGGGAGGG - Intergenic
916300817 1:163271995-163272017 GAAGGAACAAAGGGAAGGAAGGG - Intronic
916401512 1:164453826-164453848 GAAGGAAGGAAGGGAAGGGAAGG + Intergenic
916401543 1:164453949-164453971 AAAGAAAGAGGGGGAAGGGAAGG + Intergenic
917881579 1:179342261-179342283 GAAGGAAAGAAGGGAAGGGAAGG - Intronic
918331398 1:183464248-183464270 GAAGAGGGAAGGGGAAGGGAGGG + Intergenic
918395875 1:184112457-184112479 GAAGGAAGGAGGGGAGGGGAGGG + Intergenic
918564187 1:185907711-185907733 GAAACAACTAGGGGAAGAGAAGG + Intronic
918575279 1:186051315-186051337 GAAACAAGAAGGGTAAAGGAGGG + Intronic
918761861 1:188420584-188420606 GAAGGAGGAAGGGGAAGGGAGGG - Intergenic
918766244 1:188487328-188487350 GAAGAAACTAGGGGAAGGGTGGG - Intergenic
918872969 1:190000653-190000675 GAAGAAACAAAGCGAAGGGAAGG - Intergenic
919669852 1:200328833-200328855 GAAGTAAGAAGGGGATGGCACGG - Intergenic
920330244 1:205202107-205202129 GAAGGGAGAAGGGGAAGGGAAGG + Intronic
920531686 1:206706921-206706943 GAATGAATGAGGGGTAGGGAAGG - Intronic
920698084 1:208196914-208196936 GAAAGAAAAAGGGGAAGGCAGGG + Intronic
921337696 1:214104921-214104943 GAAGAACTGAGGGAAAGGGAAGG - Intergenic
921919883 1:220655880-220655902 GAAGCAGCAAGGGGAAGAGTGGG - Intronic
921950101 1:220920661-220920683 GAAGCAGGGAGAGGAAGGGAAGG + Intergenic
922409183 1:225354031-225354053 GAAGCATTAAGGGGAGGCGTAGG - Intronic
922507336 1:226134165-226134187 GAAGACACATGGGGAAGGGAAGG - Intergenic
922539829 1:226410428-226410450 GAAGAGAAAAGGGGAGGGGAGGG + Intergenic
922584540 1:226723662-226723684 AGAGGAACAAGGGGAAGGGAGGG + Intronic
922979347 1:229812430-229812452 AAAGAAAGAAAGGGAAGGGAAGG + Intergenic
923004935 1:230041026-230041048 GAAGATATAAGGGAAAGGGGTGG - Intergenic
923363838 1:233239716-233239738 GAAGTAAAAAGGGCCAGGGATGG - Intronic
923498568 1:234545519-234545541 GCAGCAGTAAGGAGAAGAGAAGG + Intergenic
923621755 1:235585226-235585248 GAAGGAAGAAGGGAAGGGGAAGG - Intronic
923678241 1:236098469-236098491 GAAGGAAGGAAGGGAAGGGAAGG + Intergenic
1063152359 10:3348324-3348346 GAACCACCTAGGGGAAGGGAAGG - Intergenic
1063225651 10:4013094-4013116 GAAGGGAGAGGGGGAAGGGAAGG - Intergenic
1063225660 10:4013119-4013141 GAAGGGAGAGGGGGAAGGGAAGG - Intergenic
1063295681 10:4803258-4803280 GCACCAGGAAGGGGAAGGGAGGG + Intronic
1063484311 10:6404928-6404950 GAAGGAAGGAAGGGAAGGGAAGG - Intergenic
1063647456 10:7899267-7899289 GAAGACATCTGGGGAAGGGAAGG - Intronic
1064134383 10:12737625-12737647 GAAGTGTTAAAGGGAAGGGATGG - Intronic
1065202800 10:23330951-23330973 GAAGGAAAACCGGGAAGGGAAGG + Intronic
1065203080 10:23331703-23331725 GAAGGGAAAAGGGGAAGGGAAGG + Intronic
1065246018 10:23758656-23758678 GAAAGAAAAAGGGGGAGGGAGGG - Intronic
1065263822 10:23954573-23954595 GAAGGAAAGAAGGGAAGGGAAGG + Intronic
1065373854 10:25016860-25016882 GTAGCGGAAAGGGGAAGGGACGG - Intronic
1065450131 10:25848332-25848354 GAAGGAAGGAAGGGAAGGGAAGG + Intergenic
1065631594 10:27686365-27686387 AAAGAAAGAAAGGGAAGGGAAGG + Intronic
1066203994 10:33169675-33169697 GAAGGAAAAAGGGGAAGGAAAGG + Intergenic
1066504512 10:36027418-36027440 GAAGGATTTAGGGGAAGGAATGG + Intergenic
1066580270 10:36872922-36872944 GAAGCACTAAGTGAAAGGAAAGG - Intergenic
1066752380 10:38671115-38671137 GAAGGGAAAAAGGGAAGGGAAGG + Intergenic
1066951424 10:42121834-42121856 GAAGGAAAAAGAGGAAAGGAAGG - Intergenic
1066964645 10:42251931-42251953 GAAGGGAAAAAGGGAAGGGAAGG - Intergenic
1067557886 10:47285053-47285075 GAAGGAAGGAAGGGAAGGGAGGG + Intergenic
1068450388 10:57178896-57178918 GAGGGAAGGAGGGGAAGGGAAGG + Intergenic
1068686810 10:59878893-59878915 CAAGCCATAAGGGAAAGGAAAGG + Intronic
1068992110 10:63160906-63160928 TAAGGAATGGGGGGAAGGGAGGG - Intergenic
1069130357 10:64693495-64693517 GAAGATATAAGGGAAATGGAGGG - Intergenic
1069449229 10:68502772-68502794 GAAGAAAAGAGGGGAGGGGAGGG + Intronic
1069532168 10:69227489-69227511 GAAGCAGAGAGGGGCAGGGAGGG - Intronic
1070046846 10:72846823-72846845 GAAGCAATGAAGGGAAGGAGTGG + Intronic
1070305947 10:75239338-75239360 GTAGCAAAAAGGGGAGGGGGTGG - Intergenic
1070536221 10:77379792-77379814 GCAGCATTATGGGGCAGGGATGG - Intronic
1070973938 10:80589900-80589922 GAAGCTAGGTGGGGAAGGGAAGG + Intronic
1071222790 10:83489416-83489438 GAAGGGAAAAAGGGAAGGGAGGG - Intergenic
1071441605 10:85702856-85702878 GAAGAAAAAAGGGGAGGAGAAGG + Intronic
1071943787 10:90617473-90617495 GGTGCAATAAGGGAAAGGCAAGG + Intergenic
1072586797 10:96789967-96789989 GAAGGAAGAAGAGGAGGGGAAGG - Intergenic
1072606173 10:96984586-96984608 GAAGGAATGAAGGGAAGGAAGGG + Exonic
1072787766 10:98295812-98295834 GCAGGAATAAAGGGAAGGGAGGG - Intergenic
1072897175 10:99376987-99377009 GGAGGAAGAAGGGGGAGGGAGGG - Intronic
1073004781 10:100315003-100315025 GAAGGAAGGAAGGGAAGGGAAGG + Intronic
1073030804 10:100524150-100524172 GAAGGAGAAAGGGGGAGGGAAGG + Intronic
1073043690 10:100623850-100623872 GAAGGGGTAAGGGGGAGGGAGGG + Intergenic
1073531247 10:104233610-104233632 AAAGGAAGAAGGGTAAGGGAGGG - Intergenic
1073556319 10:104455776-104455798 GAAGTAAGACAGGGAAGGGAAGG + Intergenic
1073565797 10:104534691-104534713 AAAGAAAGAAGAGGAAGGGAAGG - Intergenic
1073930030 10:108565501-108565523 GAAGAAGTGAAGGGAAGGGAGGG + Intergenic
1074105608 10:110387814-110387836 GAAGAAAGAAAAGGAAGGGAAGG + Intergenic
1074146074 10:110718161-110718183 GAAACAAAAAGGGGAAGTGCTGG - Intronic
1074453030 10:113574867-113574889 GAAAGAAAAAGTGGAAGGGAAGG - Intronic
1074478635 10:113796983-113797005 GAAGAAAGAAAAGGAAGGGAGGG + Intergenic
1074484310 10:113858208-113858230 GAAGAAAGAAAAGGAAGGGATGG - Intronic
1074518977 10:114199481-114199503 GCAGGAAGAATGGGAAGGGATGG - Intronic
1074967520 10:118504494-118504516 GAAGGAAGGAAGGGAAGGGAGGG + Intergenic
1075148055 10:119900033-119900055 AAAACGATGAGGGGAAGGGAGGG - Intronic
1075284478 10:121171771-121171793 GAAGGAAGAAGGGGAAGGGAAGG + Intergenic
1075284484 10:121171789-121171811 GAAGGCAGAAGGGGAAGGGAAGG + Intergenic
1075284491 10:121171807-121171829 GAAGGGAGAAGGGGAAGGGAAGG + Intergenic
1075284498 10:121171825-121171847 GAAGGGAGAAGGGGAAGGGAAGG + Intergenic
1076276673 10:129205289-129205311 AAAACAATAGGGGGAAGGGCAGG - Intergenic
1076296674 10:129391221-129391243 AAAGAAAGAAAGGGAAGGGAAGG + Intergenic
1076453720 10:130575074-130575096 GAAGAAAGGAGGGGAAGGGAGGG - Intergenic
1076489961 10:130851964-130851986 GAAAGAAGAAAGGGAAGGGAAGG - Intergenic
1077211259 11:1371907-1371929 GAGGGAGCAAGGGGAAGGGATGG + Intergenic
1077336505 11:2007276-2007298 GAAGCCAGAAGGGGCAAGGAGGG - Intergenic
1077553897 11:3216830-3216852 GAAGAGAGAAGGGGAGGGGAGGG - Intergenic
1077738687 11:4820491-4820513 GAAGGAAGAAAGGGAAGGAATGG - Intronic
1078135797 11:8650455-8650477 GAAGGAAAAGGAGGAAGGGAAGG + Intronic
1078227515 11:9405840-9405862 GAAGAAAGGAAGGGAAGGGAGGG - Intronic
1078362552 11:10680469-10680491 GAAGGAAGGAGAGGAAGGGAGGG + Intronic
1078612948 11:12837769-12837791 GAAGGAAGAAGAGGAAGAGAAGG - Intronic
1078968341 11:16373904-16373926 GGAGGGAGAAGGGGAAGGGAGGG + Intronic
1079643055 11:22830093-22830115 GTAGCAATGCAGGGAAGGGATGG + Intronic
1079893832 11:26093428-26093450 TAGTCAATGAGGGGAAGGGACGG + Intergenic
1079950453 11:26795743-26795765 GAAGAAATAAGGGGAGGAAAGGG + Intergenic
1079997377 11:27308402-27308424 GAAGAAATGTAGGGAAGGGATGG - Intergenic
1080135053 11:28844675-28844697 GAAGGAAGAAGAGGGAGGGAGGG - Intergenic
1080237861 11:30092745-30092767 AAAAGAATAAAGGGAAGGGAAGG - Intergenic
1080321392 11:31014239-31014261 GAAACAAAGAGAGGAAGGGAGGG - Intronic
1080397258 11:31901726-31901748 GAAGTAATAAGGTGAGGAGAAGG - Intronic
1080550345 11:33369129-33369151 GAAGGGAGAAGGGGAGGGGAAGG - Intergenic
1080683352 11:34496055-34496077 GAAGCAGAGAGGGGAGGGGAGGG - Intronic
1081386381 11:42478198-42478220 AAAGCGAGAAAGGGAAGGGAAGG + Intergenic
1081577901 11:44330637-44330659 GAAGCTAGAAGGAGCAGGGAAGG + Intergenic
1081639337 11:44742258-44742280 GAAGGGAAAAAGGGAAGGGAAGG - Intronic
1081693650 11:45094765-45094787 GAAGGAATAGAGGGAAGGAAGGG + Intergenic
1083022212 11:59518772-59518794 TAAGAATTATGGGGAAGGGAGGG + Intergenic
1083100658 11:60302235-60302257 GAAGCAAGGAGTGGCAGGGAAGG + Intronic
1083751517 11:64763523-64763545 GAAGCAATGAGGTGAAGCCAAGG + Intergenic
1084907954 11:72363178-72363200 GAAGGAAGGAAGGGAAGGGAAGG + Intronic
1085463454 11:76708902-76708924 GAAGCCAAAAAGGGATGGGAAGG - Intergenic
1085936817 11:81155943-81155965 GAAGCAAGAAGGAGAAAAGATGG - Intergenic
1086518709 11:87645971-87645993 GAAGGGGGAAGGGGAAGGGAAGG - Intergenic
1087179085 11:95124510-95124532 GAAGAAAGCAGGGGAAGGGGAGG + Intronic
1088173147 11:107018978-107019000 GACGCTTTCAGGGGAAGGGAAGG + Intergenic
1088192332 11:107239835-107239857 GAAGGAGTGAGAGGAAGGGATGG + Intergenic
1088457076 11:110043967-110043989 GAAGGAAGGAAGGGAAGGGAAGG + Intergenic
1088916867 11:114234184-114234206 GAAGGAAAAAGGGGCAGAGAGGG + Intronic
1089306852 11:117531892-117531914 AAAGAAAGAAAGGGAAGGGAAGG + Intronic
1089378987 11:118014313-118014335 GAAGGAAGGAAGGGAAGGGAAGG + Intergenic
1089624762 11:119744291-119744313 GAAGAAGAAAGGGGATGGGAGGG - Intergenic
1089682576 11:120127482-120127504 GAAGCAAAAGGAGGAAGTGAGGG - Exonic
1089731225 11:120520352-120520374 GAAGAAATCAGGCCAAGGGAAGG - Intronic
1090182787 11:124715647-124715669 GAAGCAATGAGGGGCAGTGGAGG - Intergenic
1090416015 11:126540982-126541004 GTGGCACTAAGGGGCAGGGATGG + Intronic
1090463812 11:126915028-126915050 AAAGCCAGAAGGGGAAGGAAAGG - Intronic
1090628880 11:128629040-128629062 GAAGTGCTAAGGGGAAGGGATGG - Intergenic
1090857206 11:130620884-130620906 GAAGAAATAAGCTGAAAGGAAGG - Intergenic
1091042418 11:132294289-132294311 GAAGGAATGAGGGGAGGGGAAGG - Intronic
1091103289 11:132895804-132895826 GAAGCAAAGAGGGGCAGGGGGGG - Intronic
1091192603 11:133707444-133707466 GAAAAAGGAAGGGGAAGGGAAGG + Intergenic
1202819489 11_KI270721v1_random:62458-62480 GAAGCCAGAAGGGGCAAGGAGGG - Intergenic
1091562803 12:1627836-1627858 GAATCAAGAATGGGAAGGGGTGG - Intronic
1092478820 12:8841859-8841881 TAAGTAATGAGGGGATGGGAAGG - Intronic
1092851287 12:12629594-12629616 GAAGCATTCAGGGAAAGGAAAGG - Intronic
1092881864 12:12892966-12892988 GAAGGAATGAGGGGAAGGAAGGG + Intronic
1092942824 12:13426578-13426600 GAAGAGAGAGGGGGAAGGGAGGG - Intergenic
1093416647 12:18928102-18928124 GAAGCAATCAGGAGAAGTGGGGG - Intergenic
1093858999 12:24140230-24140252 GAAGCTATGGGGGTAAGGGAGGG + Intergenic
1095272477 12:40236105-40236127 GAAGTAATAATGGCAAGGGCAGG - Intronic
1095863576 12:46947215-46947237 GAAGGAGAAAGGGGAAGGGCAGG - Intergenic
1095903407 12:47352409-47352431 GAAGAAAGAAGGGAAAGGAAAGG + Intergenic
1096121403 12:49091648-49091670 GAACCAATAGGGGTGAGGGACGG - Intronic
1096771515 12:53938773-53938795 GAAGCACTAGGAGGAGGGGAGGG + Exonic
1097680033 12:62640288-62640310 AAAGTAATAAAGGGAAGGGAGGG - Intergenic
1097703827 12:62847152-62847174 AAGGCAAGAAGGGGAAGAGAGGG + Intronic
1097771504 12:63591968-63591990 AAAGAAAAGAGGGGAAGGGAAGG + Intronic
1099148043 12:79072910-79072932 GAAGGAGTAAGGGGAAGGAAGGG + Intronic
1099332018 12:81301171-81301193 GAAGCACTAATGGGGAGGTATGG + Intronic
1099385312 12:82006254-82006276 GAAGGAGGAAGGGGAGGGGAGGG + Intergenic
1099470534 12:83042580-83042602 GAAGCTATAAGGGAGAGAGAAGG - Intronic
1099601102 12:84738821-84738843 GAAGCAGTAAAGCGAAGGGAAGG - Intergenic
1100258765 12:92911472-92911494 CAAGAGTTAAGGGGAAGGGAAGG + Intronic
1100367756 12:93937099-93937121 GAACCACAGAGGGGAAGGGAAGG + Intergenic
1101505089 12:105338717-105338739 GAAGCAGTAGAGAGAAGGGAGGG + Intronic
1101638292 12:106565825-106565847 GAAGGAAGGAAGGGAAGGGAGGG + Intronic
1102556021 12:113727212-113727234 GAAGGAAGCAGGGGGAGGGAAGG - Intergenic
1102558055 12:113741942-113741964 GAAGGGAAAAGGGGAAGAGAAGG + Intergenic
1102745192 12:115243850-115243872 GAAGGAAGGAGGAGAAGGGAAGG + Intergenic
1102952558 12:117040355-117040377 GAAGGAATCAGGGAATGGGAAGG + Intronic
1102976002 12:117207654-117207676 GAAGAGAGAAGGGGAGGGGAAGG - Intergenic
1102983790 12:117262899-117262921 TAAGCAAAGAGGGGAAGGAAGGG - Intronic
1103484505 12:121273852-121273874 GAATCAGCATGGGGAAGGGAAGG - Intronic
1103582404 12:121925071-121925093 GAGGCAAGAAGGGGAAGGGGTGG - Intronic
1103776710 12:123371689-123371711 GAAGAAAGAAGGGAGAGGGAGGG - Intergenic
1104204631 12:126626684-126626706 AAATCAGTGAGGGGAAGGGAAGG - Intergenic
1104923355 12:132302799-132302821 GCAGCAGAAAGGGGACGGGACGG + Intronic
1105710586 13:23005111-23005133 GAAGCAATAAAGGGGATGGGAGG + Intergenic
1106217434 13:27715735-27715757 CAAGAAATAAGGGGCAGGAATGG + Intergenic
1106488977 13:30199477-30199499 AAAGCATTAAGAGAAAGGGAAGG + Intergenic
1106800226 13:33248672-33248694 GAAGCAAAAGGGGAAAGGAATGG - Intronic
1106931283 13:34668527-34668549 GAAGCTATAAAGGGAGGGAAAGG - Intergenic
1107124263 13:36829274-36829296 GATGGAATAATGGGAAAGGAGGG + Intergenic
1107592636 13:41924384-41924406 GAAGAGAGGAGGGGAAGGGAGGG + Intronic
1107970805 13:45640779-45640801 AAAGCACCTAGGGGAAGGGATGG - Intergenic
1109552184 13:63917875-63917897 AAGGAAAGAAGGGGAAGGGAAGG - Intergenic
1110087804 13:71404412-71404434 GTAGAAATAAGGGCAAGGGAAGG - Intergenic
1110552879 13:76827958-76827980 GAAGGAAGAAGGGGAGGGGAGGG + Intergenic
1110552917 13:76828059-76828081 GAAGAAAGAAGGGGAGGGGAAGG + Intergenic
1110552939 13:76828114-76828136 GAAGAAAGAAGGGGAGGAGAGGG + Intergenic
1110669787 13:78164101-78164123 GAAGGAAGAAAGGAAAGGGATGG - Intergenic
1111084507 13:83357237-83357259 GAAGGAACAAGGGAAAGGGGAGG - Intergenic
1111785543 13:92782097-92782119 GAAGGAGTGGGGGGAAGGGAGGG + Intronic
1112033676 13:95478614-95478636 GAAGCCAAATGGGGATGGGAGGG - Intronic
1112186454 13:97132516-97132538 GAAGCAATCAGGGAGAGAGAGGG - Intergenic
1112193012 13:97196336-97196358 GCAACAAAAAGGGGAAGGGCAGG - Intergenic
1112427238 13:99313647-99313669 GAAGGAATGTGAGGAAGGGAGGG + Intronic
1112782607 13:102917274-102917296 GAAGGAAGGAAGGGAAGGGAAGG - Intergenic
1112819831 13:103319334-103319356 GAAGAAAAAAGGAGGAGGGATGG - Intergenic
1113303869 13:109054950-109054972 GAGGGAGGAAGGGGAAGGGAAGG - Intronic
1114578149 14:23731743-23731765 GAAGTAACAAAGTGAAGGGAAGG - Intergenic
1114979153 14:28140627-28140649 GAAGGAAGGAAGGGAAGGGAAGG - Intergenic
1115498169 14:34027190-34027212 GGAGGAGGAAGGGGAAGGGAGGG + Intronic
1115550551 14:34501175-34501197 GAAGAAAGAAAGGGAAGGAAAGG + Intergenic
1115744088 14:36418270-36418292 TAAGGAAGCAGGGGAAGGGAGGG + Intergenic
1116640771 14:47459526-47459548 GAAGAAAGAAAGAGAAGGGAGGG - Intronic
1116788969 14:49318996-49319018 GAAGGAAAGAGGGGAAGAGAGGG + Intergenic
1116802529 14:49458273-49458295 GAAGGCAGAAGGGCAAGGGAGGG - Intergenic
1117420621 14:55541413-55541435 GAATCAATAATGTGAAGGAAAGG + Intergenic
1117427487 14:55615847-55615869 GAAGAAAGAAAGGGAAGGAAAGG - Intronic
1117740683 14:58816347-58816369 CAAGCAAATAGGGGAAGGCAAGG - Intergenic
1117830322 14:59743710-59743732 GAAACAAAGAGGTGAAGGGAAGG - Intronic
1117964150 14:61189600-61189622 GAAGAAAGGAAGGGAAGGGAAGG - Intronic
1118102344 14:62621114-62621136 TAAGCAATAAAGGGTATGGAGGG + Intergenic
1118710929 14:68518791-68518813 GAACAAAGAAGGGGAAGAGAAGG - Intronic
1118912464 14:70073067-70073089 GAAGGAAGGAAGGGAAGGGAAGG - Intronic
1119040993 14:71274456-71274478 TAAGAAATAAAGGGAAGGCAAGG + Intergenic
1119714005 14:76845348-76845370 AAAAGAAGAAGGGGAAGGGAAGG + Intronic
1119905728 14:78300069-78300091 GAAGGAATAAGGAAAAGGAAAGG - Intronic
1119921562 14:78451098-78451120 GCAGCAATAAGGGGAAGAGGTGG - Intronic
1119922202 14:78456940-78456962 GAAGCAAGGAAGGGAAGGGAAGG - Intronic
1119965870 14:78914895-78914917 CAAGCAATAAGGGGAAGGAGGGG + Intronic
1120433124 14:84444337-84444359 AAAGCAAAAAAGGGAGGGGAAGG - Intergenic
1120521997 14:85534490-85534512 GATGCCAGAAGGTGAAGGGAGGG - Intronic
1120879323 14:89402662-89402684 GAAGCAAGAAGGGGAGTGCAGGG - Intronic
1121141266 14:91544581-91544603 GAAGGAAGGAGGGGAAGGAAGGG + Intergenic
1121231382 14:92361348-92361370 GAAGCAAGGTTGGGAAGGGAGGG + Intronic
1121935745 14:98017037-98017059 GAAGGAAGGCGGGGAAGGGAGGG + Intergenic
1122058835 14:99123277-99123299 GAAGAGGGAAGGGGAAGGGAAGG - Intergenic
1122439282 14:101718962-101718984 GGAGAAGGAAGGGGAAGGGAGGG + Intergenic
1122579497 14:102762503-102762525 GCAGGTATAAGGGGATGGGAGGG + Intergenic
1123395756 15:19933451-19933473 GAAGGAAAAAGAGGAAAGGAAGG + Intergenic
1124193413 15:27599585-27599607 GGAGCAATAATGGGAATAGAAGG + Intergenic
1124458695 15:29869175-29869197 GAAGCCATAAGAGAAAGCGAGGG + Intronic
1124647674 15:31450437-31450459 GAAGGAAGACGGGGAAGGGGAGG + Intergenic
1125178424 15:36852576-36852598 GGAGAAAAAAGGGGAGGGGATGG + Intergenic
1125187775 15:36951839-36951861 GAAGCAGGAGGGGGAAAGGAGGG - Intronic
1125206340 15:37157949-37157971 GAAGAAATGAGGGGAAGCAAAGG + Intergenic
1125253086 15:37729050-37729072 GGAAGAGTAAGGGGAAGGGAGGG - Intergenic
1125384988 15:39127636-39127658 AAAGCACTAAGTGAAAGGGAGGG - Intergenic
1125468587 15:39979924-39979946 GAAGAAAAGAGGGGAGGGGAAGG + Intronic
1126317596 15:47386903-47386925 AATGCAATAGGGGTAAGGGATGG + Intronic
1126414132 15:48400225-48400247 GAAGCCAGACAGGGAAGGGAGGG + Intergenic
1126611838 15:50537854-50537876 GAAGAAAAGAGGGGAGGGGAGGG + Intronic
1126991943 15:54388181-54388203 GAAGGAAAAAAAGGAAGGGAAGG - Intronic
1127174762 15:56341610-56341632 AAAGAAAGAAAGGGAAGGGAAGG + Intronic
1127267556 15:57374200-57374222 GGAAGAAAAAGGGGAAGGGAAGG - Intergenic
1127496712 15:59519599-59519621 GAAGGAAGAAGGGAAGGGGAGGG - Intronic
1127507541 15:59610852-59610874 GAAGGAGGAAGGGGGAGGGAAGG - Intronic
1128522873 15:68387007-68387029 GAAGGAAGAACGAGAAGGGATGG + Intronic
1128806409 15:70534295-70534317 GAAGGAAGAAGAGGAGGGGAAGG + Intergenic
1130161749 15:81408179-81408201 GAAGCAAAAAGGAGAAGGGAAGG + Intergenic
1130304022 15:82700752-82700774 GAAGCCATAAGGGCAAGGCTGGG - Intronic
1130561737 15:84964254-84964276 GAAACGATAAGGGCATGGGAAGG + Intergenic
1131011141 15:89019502-89019524 GAAGTAGGAAGGGGAAGGGTGGG - Intergenic
1131036871 15:89228263-89228285 GAAAGAATATGGGAAAGGGAAGG - Intergenic
1131345493 15:91643922-91643944 GAAGCCACACGGGGAAGGGTGGG + Intergenic
1131875195 15:96798572-96798594 GGGGCAATAAGGGGCAGAGAGGG - Intergenic
1132038216 15:98503851-98503873 GGAGCAAAAAGGGGCAGGAAGGG - Intronic
1132289623 15:100690345-100690367 GAAACAATAAGGAGACGAGAAGG - Intergenic
1132404114 15:101532069-101532091 GAAGGAAGGAAGGGAAGGGAAGG - Intergenic
1132523422 16:401825-401847 GAAGCAATCAGGGCAGGGGCGGG + Exonic
1132826718 16:1908909-1908931 GAAGCAATAAGGGGAAAAGGTGG + Intergenic
1133498295 16:6340952-6340974 GAAGAAAAAAGGGGAAGGGGTGG + Intronic
1133512302 16:6471873-6471895 GAAGCACATAGGGAAAGGGAAGG + Intronic
1133578953 16:7124515-7124537 GAAGGAAGGAGGGGAGGGGAGGG - Intronic
1133810638 16:9158469-9158491 CAAGAAAGAAAGGGAAGGGAGGG - Intergenic
1133819794 16:9226246-9226268 GAAGGAAGGAAGGGAAGGGAGGG - Intergenic
1133819802 16:9226268-9226290 GAAGGAAGGAAGGGAAGGGAGGG - Intergenic
1133819824 16:9226324-9226346 GAAGAAAGGAAGGGAAGGGAGGG - Intergenic
1134040400 16:11063976-11063998 GAGGAAGAAAGGGGAAGGGAGGG + Intronic
1134110983 16:11515557-11515579 GAAGGAAAGAGGAGAAGGGAGGG + Intronic
1134444354 16:14319688-14319710 GAATCAATGTGGGGAAGGAAGGG + Intergenic
1134595363 16:15491612-15491634 GGAGCAAAATGAGGAAGGGAAGG - Intronic
1135088121 16:19490906-19490928 GGAGAAAGAAGGGGAAGGGAAGG - Intronic
1135164798 16:20129635-20129657 GAAGAAGGAAAGGGAAGGGAAGG - Intergenic
1135165806 16:20138202-20138224 GAAGAGAGAATGGGAAGGGAAGG - Intergenic
1135603362 16:23801790-23801812 GAAGGAAAGAAGGGAAGGGAAGG - Intergenic
1136405078 16:30040570-30040592 GAGGGAAAAAGGGGAAGAGAAGG + Intronic
1136574257 16:31113878-31113900 GAAGTAGGAAGGGGAAGGGGAGG + Intergenic
1136640225 16:31557826-31557848 GAAGAAAGAAAGGGAAGGGAAGG - Intergenic
1136798702 16:33048894-33048916 GAAGGAAAAAGAGGAAAGGAAGG + Intergenic
1136852184 16:33621047-33621069 GAAGGGAAGAGGGGAAGGGAAGG - Intergenic
1136935622 16:34461179-34461201 GAAGGAAAAAGAGGAAAGGAAGG - Intergenic
1136946087 16:34652787-34652809 GAAGGAAAAAGAGGAAAGGAAGG + Intergenic
1136948923 16:34691329-34691351 GAAGGAAAAAGGGGAAAGAAAGG + Intergenic
1136956415 16:34791841-34791863 GAAGGAAAAAGAGGAAAGGAAGG + Intergenic
1136964196 16:34887391-34887413 GAAGGAAAAAGAGGAAAGGAAGG + Intergenic
1136968342 16:34942083-34942105 GAAGGAAAAAGAGGAAAGGAAGG + Intergenic
1137088811 16:36162637-36162659 GAAGGAAAAAGAGGAAAGGAAGG + Intergenic
1137093340 16:36221863-36221885 GAAGGAAAAAGAGGAAAGGAAGG + Intergenic
1137219803 16:46437406-46437428 GAAGGAAAAAGAGGAAAGGAAGG - Intergenic
1137310369 16:47250896-47250918 GAGGAAAGAAGGGGAATGGAGGG + Intronic
1137407938 16:48204878-48204900 GAAGCCATAGAGGGAAAGGAGGG + Intronic
1137953257 16:52803640-52803662 GAAGAAGAAAGGGGAAGGGGAGG + Intergenic
1138242197 16:55436187-55436209 GAAGGGAAGAGGGGAAGGGAGGG + Intronic
1138429535 16:56959837-56959859 GAAGAAAGAAAGGGAAGGGAAGG + Intergenic
1138477755 16:57282177-57282199 GGGGCAATAGGGGGAATGGAAGG - Intronic
1138567979 16:57847259-57847281 GAAGGAAGGAAGGGAAGGGAGGG + Intronic
1138621260 16:58213064-58213086 GAAAGAAAAAGAGGAAGGGAAGG + Intergenic
1139004235 16:62551432-62551454 GAATAAAAAAGGGGAGGGGAGGG - Intergenic
1139131183 16:64148199-64148221 GAAGAAATGGAGGGAAGGGAAGG - Intergenic
1139320398 16:66109663-66109685 GAAGAAGGAAGGGGAGGGGAGGG + Intergenic
1139320441 16:66109789-66109811 GAAGGCAGAAGGGGAAGGGAGGG + Intergenic
1139363657 16:66419373-66419395 GAAGGAAGAAAGGGAGGGGAGGG + Intergenic
1140731215 16:77858292-77858314 GAAGAAGAAAGAGGAAGGGAGGG + Intronic
1140777684 16:78264974-78264996 AAAGAAAGAAAGGGAAGGGAAGG - Intronic
1140833070 16:78769361-78769383 GAAGGAAGGAGGGGAAGAGAGGG - Intronic
1140872819 16:79122548-79122570 GAAAGAATGAGGGGAAGGAAGGG - Intronic
1141216346 16:82027873-82027895 GAAGCAATAAGGGTAGGGTGAGG - Intergenic
1141337871 16:83174268-83174290 GCAGCATTAATTGGAAGGGATGG - Intronic
1141650826 16:85392089-85392111 GAGGGAATCACGGGAAGGGAGGG - Intergenic
1141845206 16:86603810-86603832 GAAGGAATAAGAGGAGGAGAGGG - Intergenic
1203113780 16_KI270728v1_random:1469518-1469540 GAAGGGAAGAGGGGAAGGGAAGG - Intergenic
1142797699 17:2321713-2321735 AAAGGAATAAGGGGAAGGAATGG - Intronic
1142832893 17:2562397-2562419 GAAGGAAGGAAGGGAAGGGAAGG + Intergenic
1142832902 17:2562433-2562455 GAAGGAAGAAAGGGAAGGAAAGG + Intergenic
1142972374 17:3621539-3621561 GAAGGAGTAAAGAGAAGGGAGGG - Intronic
1143174141 17:4947180-4947202 GAAGCGGAGAGGGGAAGGGAGGG + Intronic
1143266649 17:5642985-5643007 GAAGAGAAGAGGGGAAGGGAAGG - Intergenic
1143459712 17:7094429-7094451 GAATCAGGAAGAGGAAGGGAAGG - Intergenic
1143548673 17:7615142-7615164 CAACCAATCAGGGGGAGGGAGGG + Intronic
1143794704 17:9327312-9327334 GAAGGAAGAAGGAGAAGAGAAGG + Intronic
1143854784 17:9840643-9840665 TAAACAAGATGGGGAAGGGAAGG + Intronic
1143886238 17:10067129-10067151 GATGAAATATGGGGGAGGGATGG + Intronic
1143963426 17:10738995-10739017 GAAGAGAGAAGAGGAAGGGAGGG - Intergenic
1144129700 17:12234323-12234345 GTAGCTATGAAGGGAAGGGATGG + Intergenic
1144352911 17:14415851-14415873 GAAGGAAGGAAGGGAAGGGAAGG - Intergenic
1144384450 17:14736507-14736529 TTGGCAATTAGGGGAAGGGAGGG + Intergenic
1144422888 17:15114190-15114212 GAAGCAAGATGGGGAAAGGGAGG - Intergenic
1144561007 17:16320287-16320309 GAGGGAGGAAGGGGAAGGGAAGG + Intronic
1144561019 17:16320328-16320350 GAAGGAAGGAAGGGAAGGGAAGG + Intronic
1145223366 17:21107346-21107368 CAAGCCATGATGGGAAGGGAGGG - Intergenic
1145692372 17:26755863-26755885 GAAGGAAGAAGAGGAATGGAAGG + Intergenic
1145816666 17:27799800-27799822 AAAGAAAGAAAGGGAAGGGAAGG + Intronic
1146262789 17:31432658-31432680 GAAGAATTAAGAGGAAGAGAGGG - Intronic
1146593180 17:34146456-34146478 GAAGCGGGAAGGGGAAGGTAGGG + Intronic
1146689589 17:34864053-34864075 GAAGGAAGAAGAGGAGGGGAAGG - Intergenic
1146766845 17:35530418-35530440 GAAGGAAGGAAGGGAAGGGAAGG + Intronic
1146914673 17:36670983-36671005 GAAGGAAGGAAGGGAAGGGAAGG - Intergenic
1147241112 17:39091116-39091138 GAAGAAACAAGGGGAAGCTAGGG - Intronic
1147494468 17:40902798-40902820 GAAGCATTATGGGAAAGCGAGGG + Intergenic
1147617682 17:41839483-41839505 CAAGGATTAAGGGGATGGGAAGG + Intronic
1147814608 17:43200028-43200050 GAAGAACTAAAGGGAAGGGCTGG - Intronic
1147931926 17:43987189-43987211 CAATTAATAAGGGCAAGGGAGGG - Intronic
1147978163 17:44259644-44259666 GAAGCGAGAATGGGAAGGGGAGG - Intronic
1148085252 17:44990080-44990102 GAAGAAAGAAAAGGAAGGGAAGG - Intergenic
1148180712 17:45602608-45602630 GAGGGAAGAAGGGAAAGGGAGGG - Intergenic
1148268191 17:46243318-46243340 GAGGGAAGAAGGGAAAGGGAGGG + Intergenic
1148644333 17:49210626-49210648 AAAGCAATAAGAGGGAGGGAAGG + Exonic
1149042634 17:52208337-52208359 AAAGAAAGAAAGGGAAGGGATGG - Intergenic
1149576708 17:57718789-57718811 GAAGAAAGAAGGGGAGGGAAGGG + Intergenic
1149764874 17:59267474-59267496 AAAGCAATAAGGGAAAGTGGAGG - Intronic
1150008647 17:61485743-61485765 GGAGCAATGAGGGGCAGGGCAGG - Intergenic
1150157753 17:62868571-62868593 GATGCAAAAGGGGGAAGAGAGGG - Intergenic
1150293929 17:63998132-63998154 GAACCAGCAAGGGGAGGGGAGGG + Intergenic
1150519570 17:65852276-65852298 GAAGGGAGGAGGGGAAGGGAAGG - Intronic
1150771989 17:68050167-68050189 GGAGAAAGAAAGGGAAGGGAAGG - Intergenic
1150983068 17:70165622-70165644 GAAGCAAAAATGAGAACGGAAGG + Intergenic
1151131725 17:71904036-71904058 GAAGCAATCATGGAAATGGACGG + Intergenic
1151248508 17:72815214-72815236 GAATCACCCAGGGGAAGGGAAGG + Intronic
1151338075 17:73452022-73452044 GGAGCAGTGGGGGGAAGGGAGGG - Intronic
1151383926 17:73743813-73743835 GAAGGAAGAGGGGGAGGGGAAGG - Intergenic
1151635352 17:75343829-75343851 GAAGAAAGGAGAGGAAGGGAGGG + Intronic
1152196140 17:78919499-78919521 GAAGAAATCAAGGTAAGGGAGGG - Intronic
1152524449 17:80879499-80879521 GAGGGAAGAAGGGGAAGGGTGGG - Intronic
1203183892 17_KI270729v1_random:93406-93428 GAAGGAAAAAGAGGAAAGGAAGG + Intergenic
1152984294 18:307866-307888 GAGGAACTGAGGGGAAGGGAAGG + Intergenic
1153139910 18:1959357-1959379 GAAAGAATAAAGGGAGGGGAGGG - Intergenic
1153203897 18:2675694-2675716 GAAGTATTAGGTGGAAGGGAAGG + Intronic
1153216207 18:2823354-2823376 GAAGGAAGAAAGAGAAGGGAAGG - Intergenic
1153435297 18:5062367-5062389 GAAGCTGTAAGGGCAAAGGAAGG + Intergenic
1153695200 18:7633449-7633471 CCAGGAATGAGGGGAAGGGAAGG - Intronic
1153782836 18:8509435-8509457 GAAGTAAAAATGGGAAGGAAAGG + Intergenic
1153918174 18:9764639-9764661 GAAAAAATAAGCGGAAAGGAAGG - Intronic
1155650211 18:28132462-28132484 GAACCACTGAGGGAAAGGGAAGG + Intronic
1156278381 18:35607216-35607238 GAGGCAATCAGAGGAAGTGAGGG + Intronic
1156555951 18:38068433-38068455 GAAGCAATATCTGGAAGAGAAGG + Intergenic
1156843807 18:41639481-41639503 GAAGAAAGAAGAGGGAGGGAGGG + Intergenic
1157311218 18:46554690-46554712 GAAGAAAGAAGAGAAAGGGAGGG + Intronic
1157531567 18:48425424-48425446 GAAGTAACATGGGGAAGAGAAGG - Intergenic
1157699807 18:49754761-49754783 GAAGGGAGATGGGGAAGGGAAGG + Intergenic
1157880833 18:51319734-51319756 GATCCAATCAGGGGAGGGGAGGG - Intergenic
1158321693 18:56270628-56270650 GAAGGAAAGAAGGGAAGGGAAGG + Intergenic
1158880914 18:61778981-61779003 GAGGGAAGAAAGGGAAGGGAAGG + Intergenic
1159041369 18:63325960-63325982 GAAGAGATGAGGGGTAGGGAGGG - Intergenic
1159624706 18:70679084-70679106 AAAGGAAAAAGGGGAGGGGAGGG - Intergenic
1161095414 19:2387563-2387585 GAAGGGAGAAAGGGAAGGGAAGG + Intergenic
1161857386 19:6773480-6773502 GAAGATGTAAGGGGAAGGAAGGG - Intronic
1161913883 19:7214768-7214790 GAAGAAAAAAAGGGAAGGGAAGG - Intronic
1162058847 19:8082447-8082469 GAAGGAAGGAAGGGAAGGGAAGG - Intronic
1162226280 19:9225383-9225405 GAAGGAAGGAGGGGAAGGAAGGG + Intergenic
1162376028 19:10305750-10305772 GAAGCAAGATGGAGAAGGGGGGG + Intronic
1162878617 19:13639859-13639881 AAAGGAAGAAGGGAAAGGGAAGG - Intergenic
1163204902 19:15795208-15795230 GAAGAAGGAAGGGGGAGGGAGGG - Intergenic
1163295256 19:16407624-16407646 GAATCAAGAAGGGGAAAAGAAGG - Intronic
1164737219 19:30550604-30550626 GAAGGAAGGAAGGGAAGGGAAGG + Intronic
1164925079 19:32124180-32124202 GGGGCAAGAATGGGAAGGGAAGG + Intergenic
1164938024 19:32230057-32230079 GAAGGAACAGGGGGAATGGAAGG + Intergenic
1165350080 19:35270378-35270400 ACAGCAATGAGGGGACGGGATGG + Intronic
1165868362 19:38952953-38952975 GAAGAAATGAGGGCATGGGAGGG - Intronic
1166088401 19:40492148-40492170 GAAGCAACAAGGGGCAGGTGGGG + Intronic
1166458193 19:42962285-42962307 GAAGCAGTGAGGTGAAGGGTAGG + Intronic
1167031175 19:46961981-46962003 GAAGGAAGGAAGGGAAGGGAAGG + Intronic
1167200388 19:48061268-48061290 GAGGCCATGAGGGGAGGGGAAGG + Intronic
1167305686 19:48707924-48707946 AAAGAAAGAAGGGGAGGGGAGGG + Intergenic
1167390354 19:49190650-49190672 CAAGAAATGAGGGGAAGAGAAGG - Intronic
1167429119 19:49444143-49444165 GAAGGAGGAAGGGGAAAGGAAGG - Intergenic
1167429130 19:49444213-49444235 GAAGGAGGAAGGGGAAAGGAAGG - Intergenic
1167429141 19:49444291-49444313 GAAGGAGGAAGGGGAAAGGAAGG - Intergenic
1167554220 19:50183134-50183156 GAAGGAAGGAAGGGAAGGGAGGG - Intergenic
1167574110 19:50309589-50309611 GATGAAATGAGGGGAGGGGAGGG - Intronic
1167721457 19:51182901-51182923 GAAGGAGAAAAGGGAAGGGAAGG - Intergenic
1167747956 19:51363901-51363923 GAAGCACAAAGGGTAAGGGAGGG + Intronic
1167763519 19:51463869-51463891 GAAGGAGAAAAGGGAAGGGAAGG + Intergenic
1168236439 19:55066587-55066609 GAAGAAAAAAGAGGAAGAGAGGG - Intronic
1168356964 19:55706658-55706680 AAAGAAAAGAGGGGAAGGGAAGG + Intronic
1202672019 1_KI270709v1_random:63955-63977 GAAGGAAAAAGAGGAAAGGAAGG + Intergenic
1202682366 1_KI270712v1_random:18776-18798 GAAGGAAAAAGAGGAAAGGAAGG + Intergenic
925079646 2:1053925-1053947 GAAGCAAGAGGGGGGCGGGAGGG - Intronic
925301765 2:2820414-2820436 GAAGGAAGGAAGGGAAGGGAAGG + Intergenic
925369941 2:3336989-3337011 GAAGAAGGAAGGGAAAGGGAAGG + Intronic
925469384 2:4142700-4142722 GATTCAGTGAGGGGAAGGGAGGG - Intergenic
925984386 2:9204289-9204311 GAAGGAAGAAGGAGAAGGAAAGG - Intergenic
926037482 2:9646747-9646769 GGAGGAAGAAGAGGAAGGGAGGG + Intergenic
926176676 2:10599077-10599099 AAAGAAATGGGGGGAAGGGAAGG + Intronic
926558308 2:14386569-14386591 GAAGCAGGAGGGGGAGGGGAAGG + Intergenic
926762683 2:16292690-16292712 GAAGGAATACGGAGAAAGGAAGG - Intergenic
927136137 2:20097785-20097807 GAGGTAATTAGGGGAGGGGATGG - Intergenic
927472916 2:23388940-23388962 GAAGCAAAAAGGAGGAAGGAAGG - Intronic
927656359 2:24950217-24950239 GAAGGAAAGCGGGGAAGGGAAGG - Intronic
927791008 2:26009483-26009505 GAAGCAATATGTGGAAAGGAAGG - Intergenic
927877642 2:26669499-26669521 GAATGAATAAAAGGAAGGGAGGG - Intergenic
928081317 2:28315034-28315056 GAAGAAAGAAAGGGAAGGGGAGG + Intronic
928081346 2:28315105-28315127 GAGGGGAAAAGGGGAAGGGAAGG + Intronic
928274094 2:29883105-29883127 GAAGAAAGGAAGGGAAGGGAAGG + Intronic
928809755 2:35208721-35208743 GAAACAATAAAGGCAAGGGTAGG - Intergenic
928977735 2:37106147-37106169 GAGACAATAATGGGAAGGAAGGG - Exonic
929055901 2:37875699-37875721 GGAGCAATAAGGGAAAGAGGAGG + Intergenic
929098576 2:38287008-38287030 GAAGAAATCAAGGGATGGGATGG + Intergenic
929635927 2:43521025-43521047 GAAGGAATGAAGGGAAGGAAGGG + Intronic
929981293 2:46682743-46682765 TAAGCAATGAGGGGAAGAGGGGG + Intergenic
930000795 2:46860350-46860372 GAGGCAATAAGGAGGAAGGAAGG - Intergenic
930018216 2:46985186-46985208 GAAGAAAGAAGAGGAAGGGAGGG - Intronic
930142558 2:47967517-47967539 GAACCAAGAAGCAGAAGGGAAGG - Intergenic
930571094 2:53088158-53088180 GGAGAAGTAAGGGGAGGGGAAGG + Intergenic
930690265 2:54355559-54355581 GAAGAAATAGAGGGAAGGGAAGG - Intronic
930919847 2:56739363-56739385 GAAGAAAGAAATGGAAGGGAAGG - Intergenic
931157329 2:59650063-59650085 AAAGCAAGAAGGGGAAAGGGAGG + Intergenic
931197229 2:60064266-60064288 GAGGAGAGAAGGGGAAGGGAGGG + Intergenic
931628463 2:64277772-64277794 GAGGAAGGAAGGGGAAGGGAGGG - Intergenic
932025365 2:68126792-68126814 CAATAAATTAGGGGAAGGGAAGG + Intronic
932428089 2:71656342-71656364 GGAGCAATAAGTGAAGGGGAGGG + Intronic
932751242 2:74373084-74373106 GAAGGGAGAAGGGGATGGGATGG - Intronic
932904016 2:75730550-75730572 GCAGCAATTAGGTGAATGGATGG - Intergenic
933059995 2:77725222-77725244 GAATGAATGAAGGGAAGGGAAGG + Intergenic
933215830 2:79629089-79629111 GAAGCAATAAGGGGAAGGGACGG - Intronic
933644788 2:84801903-84801925 AAAGAAAGAAAGGGAAGGGAAGG + Intronic
933734727 2:85486832-85486854 AAAGAAAGAAAGGGAAGGGAAGG + Intergenic
933799668 2:85950648-85950670 GAAGCCAGGAGAGGAAGGGAAGG - Intergenic
934066760 2:88348573-88348595 GAAGGAAGAAGGGGAGGAGACGG - Intergenic
934303473 2:91799018-91799040 GAAGGAAAAAGAGGAAAGGAAGG + Intergenic
934329786 2:92053738-92053760 GAAGGAAAAAGAGGAAAGGAAGG - Intergenic
934539416 2:95161570-95161592 GAACCAAAAAGGTGAGGGGATGG + Intronic
934949271 2:98565387-98565409 CAAGAAATAGTGGGAAGGGATGG + Intronic
935269693 2:101423277-101423299 GAAGCAATTACAGGATGGGAAGG + Intronic
935511679 2:103983848-103983870 AAAGCAAAAAGGTGAAGGAAGGG + Intergenic
935729153 2:106050844-106050866 AAAGAAAGAAAGGGAAGGGAAGG + Intergenic
936031056 2:109070890-109070912 GGAGCAACAGTGGGAAGGGAGGG - Intergenic
936447460 2:112607238-112607260 GAAGGAGGAAAGGGAAGGGAAGG - Intergenic
937440363 2:121910150-121910172 GAGACATTAAGGGGTAGGGATGG - Intergenic
937777505 2:125797255-125797277 GAAGGAAGGAAGGGAAGGGAAGG + Intergenic
938115526 2:128600785-128600807 GAGGCAGAAAGGGGGAGGGAAGG - Intergenic
938314710 2:130317698-130317720 GAAGGCATGAGGGGGAGGGAGGG - Intergenic
938695605 2:133832711-133832733 GAAGCAAGATGGAGAAGAGATGG - Intergenic
938798479 2:134738585-134738607 AAAGCAAGAAGGGGAAGAGCTGG + Intergenic
939535384 2:143421425-143421447 GAGAAAAGAAGGGGAAGGGAAGG + Intronic
939778629 2:146416816-146416838 AAAGCGATACGGGGAAGAGAAGG + Intergenic
940656141 2:156489878-156489900 GAAGGAAGGAGGGGAGGGGAGGG - Intronic
941901841 2:170686343-170686365 GAAGAAAGGAGGGGAGGGGAGGG + Intergenic
942017762 2:171833703-171833725 GAAGAAAGAAAGGGAAGGAAAGG - Intronic
942074253 2:172342314-172342336 GAAGCACCAAGGGGAGGAGAAGG - Intergenic
942342305 2:174961176-174961198 GAAGGAACAGAGGGAAGGGAGGG + Intronic
942482299 2:176402823-176402845 GAAGTAAGAAAGGGAAGGGCAGG - Intergenic
942482308 2:176402851-176402873 GAAGGAAGAAAGGGAAGGGAGGG - Intergenic
942482319 2:176402879-176402901 GAAGGAAGAAAGGGAAGGGAGGG - Intergenic
942482330 2:176402911-176402933 GAAGGTAGAAAGGGAAGGGAGGG - Intergenic
942969229 2:181937718-181937740 GAGGCACTTAGGGGAAGTGACGG + Intergenic
943003405 2:182358938-182358960 GAAGGAAGAAAGGGAATGGAAGG - Intronic
943577486 2:189648111-189648133 AAAACAATAAGTAGAAGGGATGG - Intergenic
945431864 2:209773509-209773531 AAAGACACAAGGGGAAGGGAGGG + Intronic
945588341 2:211695991-211696013 GAAGGAAGGAAGGGAAGGGAAGG - Intronic
945592948 2:211756308-211756330 CCAGCAGTAAAGGGAAGGGAAGG + Intronic
946372836 2:219290927-219290949 GCAGCAGAAAGGGGGAGGGACGG + Intronic
947226903 2:227849332-227849354 CAAGCCATAATGTGAAGGGAGGG + Intergenic
947336078 2:229084992-229085014 GAAACGATAAGGAGAAAGGAAGG - Intronic
947382163 2:229554998-229555020 GAAGGAAAAAGAGAAAGGGAAGG + Intronic
947906351 2:233766205-233766227 GAAGCCAGAAGGGGATGGAATGG + Intronic
947997993 2:234544702-234544724 GAAGGAAGGAAGGGAAGGGAAGG + Intergenic
948250887 2:236528007-236528029 GAAAGAAAAAGGGGGAGGGAGGG - Intergenic
948301202 2:236908810-236908832 TGACCACTAAGGGGAAGGGAAGG - Intergenic
948871904 2:240805004-240805026 GAAGAAGGAAAGGGAAGGGAAGG + Intronic
1168862044 20:1052569-1052591 GATGCAATGAGGGGGAGGCAGGG - Intergenic
1169178625 20:3542562-3542584 GAAGGAGAAAGGGGAAGGGGAGG - Intronic
1169267357 20:4174786-4174808 AAAGGAAGAAAGGGAAGGGAAGG - Intronic
1169431158 20:5537659-5537681 GAAGGAAAAAAGGGAAGGAAGGG + Intergenic
1169621630 20:7513494-7513516 GAAGAAATTAGTGGAAGGAAAGG - Intergenic
1169665923 20:8035519-8035541 GAAGCAAAAAGGGGCAGAGGTGG - Intergenic
1169693393 20:8358554-8358576 GAAGCAAGATGGGGCAGGGTAGG - Intronic
1169779412 20:9293240-9293262 GAAGAAAGAAAGGGAAGGAAAGG + Intronic
1169920631 20:10730995-10731017 AAAGGAATGAAGGGAAGGGAAGG - Intergenic
1170137804 20:13094478-13094500 GAAAAATGAAGGGGAAGGGAAGG - Intronic
1170253761 20:14316932-14316954 GGAGGAATAAGGGGAAGATAGGG - Intronic
1170349367 20:15422099-15422121 CAAGGAAAAAGTGGAAGGGAGGG + Intronic
1170418743 20:16171395-16171417 GAAGGAAGGAAGGGAAGGGAAGG + Intergenic
1170544547 20:17424410-17424432 GAAGCAAAGAGGGGAAGGAATGG + Intronic
1170558827 20:17538167-17538189 GAAGGAAGAAAGGGAAGGGAAGG + Intronic
1172569781 20:35960892-35960914 GAAAGAAAAAGGGGAGGGGAGGG - Intronic
1172641493 20:36442949-36442971 GAAGCAATAAGGGTAGGGAGTGG - Intronic
1172762758 20:37333644-37333666 GAAGCAGGAAGGGAAAGGCAGGG - Intergenic
1172798383 20:37559130-37559152 GAAGCCATCCAGGGAAGGGAAGG - Intergenic
1172800115 20:37570135-37570157 GAAGAAATAACGGGAAGCTAAGG - Intergenic
1172871686 20:38139661-38139683 GAGGTAGAAAGGGGAAGGGATGG + Intronic
1173002101 20:39111786-39111808 GAAGGAGGGAGGGGAAGGGAAGG + Intergenic
1173065084 20:39703012-39703034 GAAAAAGGAAGGGGAAGGGAGGG + Intergenic
1173080004 20:39856954-39856976 GAGGAAAGAAAGGGAAGGGAGGG - Intergenic
1173082232 20:39879271-39879293 GAAGCTGGAAGGGGCAGGGAAGG + Intergenic
1173440066 20:43068020-43068042 GAAGGAAGAGGAGGAAGGGAGGG + Intronic
1173644249 20:44623684-44623706 GAAGGAAAAAGAGGAAGGGAGGG - Intronic
1173913969 20:46692877-46692899 CAAGCAGTAAAGGGGAGGGAGGG + Intergenic
1173990975 20:47303194-47303216 GCAGCAGGAAGGGGAAGAGAGGG + Intronic
1175054145 20:56182803-56182825 TCAGCAATTAGGGGAAGTGATGG + Intergenic
1175553902 20:59834247-59834269 GAAGCAGGAAGGAGATGGGATGG - Intronic
1175693067 20:61079935-61079957 GGAGCAATAATGGGGATGGATGG - Intergenic
1176270365 20:64233091-64233113 GAGGGAAGAAGGGGAGGGGAGGG - Intronic
1176585867 21:8584684-8584706 GAAGGAAAAAGAGGAAAGGAAGG + Intergenic
1177239585 21:18439680-18439702 GAATCAATAATGGGAAGGAGAGG + Intronic
1177587705 21:23119753-23119775 GAAGCAAAAAGGTGAAGGCTGGG - Intergenic
1178016114 21:28347563-28347585 GAAGGAAGAAGGAGGAGGGAGGG - Intergenic
1178357355 21:31920069-31920091 GAAGCCAGAAGAGGCAGGGAAGG - Intronic
1178637724 21:34319583-34319605 GAATGGATATGGGGAAGGGATGG + Intergenic
1179296504 21:40067709-40067731 GAGGGAATGAGGGGAGGGGAGGG - Intronic
1179308553 21:40176677-40176699 GAGGAGCTAAGGGGAAGGGAAGG - Intronic
1179411298 21:41165701-41165723 GAGGCTGTAAGGAGAAGGGAAGG + Intergenic
1180094159 21:45547366-45547388 CAGGCCATGAGGGGAAGGGAGGG + Intergenic
1180268674 22:10561589-10561611 GAAGGAAAAAGAGGAAAGGAAGG + Intergenic
1180753568 22:18143515-18143537 CAAGCAATAGGAGGGAGGGAAGG + Intronic
1181177566 22:21046250-21046272 GGAGCAATGAAGGGAAGGCAGGG - Intronic
1181547419 22:23609965-23609987 GAAGGCATGAGGGGCAGGGAGGG - Intronic
1181557263 22:23678236-23678258 GAAGGAGCAAGGGGAAAGGACGG - Intergenic
1182106811 22:27695538-27695560 CAAGAAAGAAAGGGAAGGGAAGG + Intergenic
1182106869 22:27695884-27695906 GAAGGAAAGAGAGGAAGGGAGGG + Intergenic
1182410417 22:30180784-30180806 GAAGAGAAAAAGGGAAGGGAAGG - Intergenic
1182741712 22:32572477-32572499 GAAGGAAGAAAAGGAAGGGAGGG - Intronic
1182773992 22:32817595-32817617 GAAGAAAAAGGAGGAAGGGAAGG + Intronic
1182969952 22:34564498-34564520 GAAGCAGTAAGGGCAGGTGAGGG - Intergenic
1183007657 22:34916657-34916679 GAGGGAAGGAGGGGAAGGGAGGG + Intergenic
1183089588 22:35512465-35512487 GAAGCAAGAGGGAGAAGGAAAGG - Intergenic
1183159774 22:36104610-36104632 GAAGTAAGATGGAGAAGGGAAGG - Intergenic
1183277878 22:36912576-36912598 GCAGGAATGAGGGGAATGGAGGG - Intergenic
1183486659 22:38090869-38090891 GCAGCAATAACGGGAAGGCTTGG + Intronic
1183547996 22:38465585-38465607 GAGGAAATAAAGGGAAGGGGAGG + Intergenic
1183608186 22:38879335-38879357 GAAGCAAGATAGGAAAGGGAAGG + Intergenic
1184391268 22:44204905-44204927 GAAGCTAGAATGGAAAGGGAGGG + Intronic
1203299305 22_KI270736v1_random:65795-65817 AATGGAATAAGGGGAATGGAGGG + Intergenic
1203322923 22_KI270737v1_random:86056-86078 GAAGGAAAAAGCGGAAAGGAAGG - Intergenic
949243661 3:1900255-1900277 GAAATAAGAAGGGGTAGGGAGGG + Intergenic
949332514 3:2937904-2937926 CAAGAAATGAGGGGAAGAGAGGG + Intronic
949442172 3:4093670-4093692 GAAACAATAAGGGAAAAGGCTGG + Intronic
950021344 3:9789843-9789865 GAAGCAGAAACTGGAAGGGAAGG - Exonic
950045710 3:9947525-9947547 TAAGCAGCAAGGGGAAGGGCAGG + Exonic
950465128 3:13149054-13149076 TAAGCAAGAAGGGGAGGCGAGGG - Intergenic
950542217 3:13619408-13619430 GAAGGAAGAAGAGAAAGGGAAGG - Intronic
950671280 3:14527239-14527261 GAAGGAAGAAAGGGAAGGGAAGG + Intronic
950894156 3:16432874-16432896 GAAGAAATAAAGGAAAGGAAAGG + Intronic
951040974 3:17988477-17988499 GAAGAAATGAGGGCAAGGCATGG + Intronic
951353418 3:21634290-21634312 GAAGAAAGGAGAGGAAGGGAAGG + Intronic
951393167 3:22131608-22131630 AAAGGTATAAGTGGAAGGGAAGG + Intronic
951523399 3:23630384-23630406 GAAGGAAGAAAGGGAAGGAAGGG + Intergenic
952073305 3:29665989-29666011 GAAGCAAGAAGGTGAGGAGAGGG - Intronic
952089234 3:29864815-29864837 GAAGGAAGGAAGGGAAGGGAAGG + Intronic
952197819 3:31094526-31094548 TAAGAAATAAGGTGTAGGGAAGG + Intergenic
952468761 3:33621157-33621179 GAGGCACTATGGGGAAGGAAGGG - Intronic
952622659 3:35364441-35364463 AAAGCAATAAGGGGATTAGAAGG + Intergenic
952820706 3:37483496-37483518 GAAGTAAGAATGGGAAGGGAAGG + Intronic
953197186 3:40745686-40745708 GAAGCAAGACTGGGAAGGGGAGG - Intergenic
953237757 3:41120950-41120972 GAAGGAATAAACAGAAGGGAGGG + Intergenic
953285431 3:41602194-41602216 TAAGAAAGAAAGGGAAGGGAAGG + Intronic
953903725 3:46857798-46857820 GAAGAAAAAAGAGGAGGGGAGGG + Intergenic
954169549 3:48789843-48789865 GAAGGAACAAAAGGAAGGGAGGG - Intronic
954325046 3:49858976-49858998 GAGGCAAGAAGGGAAGGGGAAGG + Exonic
954411820 3:50374256-50374278 GAAGGAAAAGGGGAAAGGGAAGG + Intronic
955192194 3:56771764-56771786 GGAGCAATAATGGGAAGAGATGG + Intronic
955218110 3:57001637-57001659 GAAGAAGGAAGGAGAAGGGAAGG - Intronic
955565946 3:60246357-60246379 GAAGAGAAAAGGGGAAGGAAGGG + Intronic
955672136 3:61412745-61412767 GAAGAAGGAAAGGGAAGGGAAGG + Intergenic
955977714 3:64494105-64494127 TAAGGAATGAGGGGAAGGTAAGG - Intergenic
956225051 3:66947856-66947878 GAAGCAGAAAGTGGAAGGGAAGG - Intergenic
957503482 3:81089276-81089298 GAAGCAAAAAGAAGAAAGGATGG - Intergenic
957794190 3:84981678-84981700 GAAGAAAGAATGGGAAGGGAGGG - Intronic
958122034 3:89303258-89303280 AAAGCAATAAGGAGTATGGAGGG - Intronic
958624962 3:96612193-96612215 AAAGAAATAAGGTGGAGGGAAGG + Intergenic
958688862 3:97434895-97434917 GCAAGAATAAGGGGTAGGGAGGG - Intronic
958733762 3:97987269-97987291 GAAGCAAAAATGGGAAGGCCTGG - Intronic
958828171 3:99057450-99057472 GGAGAATTAAGGGGAAGGGTTGG - Intergenic
958906608 3:99948645-99948667 GAAAGAAAGAGGGGAAGGGAAGG + Intronic
959244354 3:103845608-103845630 CAAGCAATAAGGGAAAGCTAAGG - Intergenic
959368094 3:105488703-105488725 GAAGGAAAGAAGGGAAGGGAGGG + Intronic
959541726 3:107547766-107547788 GAAAGAAGAAGGGGAGGGGAAGG - Intronic
959554737 3:107703905-107703927 GAAGCATTAAGGGGCTGGTAAGG - Intronic
962057621 3:131888639-131888661 GAAGCAAAGATGGGAAGGGAAGG + Intronic
962213776 3:133502235-133502257 GAAGGAAGGAAGGGAAGGGAAGG + Intergenic
962864751 3:139438647-139438669 CAAGCAATAAGTAGAAGGTAAGG + Intergenic
962892047 3:139680437-139680459 GAAGCAATACAGGGAAGAAAAGG + Intergenic
963114489 3:141714733-141714755 AAAGAAAGAAAGGGAAGGGAAGG + Intergenic
963179212 3:142336440-142336462 GAAGGAAGGAAGGGAAGGGAGGG + Intronic
963280917 3:143384126-143384148 GGAACAAGAAGGGGAAGGGGAGG + Intronic
963627416 3:147690687-147690709 GAAGAAAGAAAGGGAAGGGAAGG - Intergenic
964967068 3:162508309-162508331 AAAGCAATATGGGAAAGGTACGG + Intergenic
965138683 3:164807531-164807553 GAAGAAAGAAAAGGAAGGGAGGG + Intergenic
965567566 3:170136933-170136955 GAAGAAGAAAGGGGGAGGGAAGG + Intronic
966019869 3:175195490-175195512 AAAGGAATAAATGGAAGGGAGGG + Intronic
966901165 3:184487012-184487034 AAAGAAAGCAGGGGAAGGGAGGG - Intronic
967356483 3:188577813-188577835 GAAGAAGGAAGGGGAGGGGAGGG - Intronic
967596790 3:191334702-191334724 AAAGAAAGAAGGGGAAGAGAGGG - Intronic
967605320 3:191438421-191438443 GAAGGAAGGAGGGGAGGGGAGGG - Intergenic
967627094 3:191699550-191699572 GAAGGAATGAAGGGGAGGGAGGG + Intergenic
967627103 3:191699576-191699598 GAAGGAACGAAGGGAAGGGAGGG + Intergenic
967814835 3:193789719-193789741 GAGGCTAGAAGGGGAAGGAAAGG + Intergenic
968472277 4:787631-787653 GACGCAGGAAGGGGCAGGGAAGG + Intronic
968708474 4:2095229-2095251 GAAGCAAAAAGGGGAGGGGAGGG + Intronic
969777616 4:9369526-9369548 GAAGAAATAAGTGGAAGGAATGG + Intergenic
970184690 4:13438424-13438446 AAAGCAAGAAGGGGAGGGAAAGG - Intronic
970205796 4:13654494-13654516 GTAGCAAGCAGGGAAAGGGAGGG - Intergenic
970273473 4:14371446-14371468 GAAGAAATAAAGGGAAAGAAGGG + Intergenic
970347061 4:15162621-15162643 GAAGGAGAAAGGGAAAGGGAAGG + Intergenic
970852425 4:20617267-20617289 GAAAGAAGAAGGGGAGGGGACGG + Intronic
970906903 4:21226310-21226332 GAGGAAAGAAAGGGAAGGGAAGG + Intronic
971004809 4:22361289-22361311 GAAAGAAAAAGAGGAAGGGAGGG + Intronic
971196994 4:24479191-24479213 GAAGGAAGAAGGGGAAGGGAAGG + Intergenic
971311573 4:25529928-25529950 GAAGAAGGGAGGGGAAGGGAGGG + Intergenic
972164556 4:36266597-36266619 GAAGAAATGAAGGAAAGGGAAGG - Intergenic
972664325 4:41149481-41149503 GGAGAAAGAAGGAGAAGGGAAGG + Intronic
972755225 4:42039759-42039781 GAGGGAAAAAGGGGAAGGCAAGG - Intronic
972902981 4:43708033-43708055 GAAGGAAGAAGGGGAGGGGAGGG + Intergenic
973331015 4:48910287-48910309 GAAGGAAGGAAGGGAAGGGAAGG - Intergenic
973536310 4:51885778-51885800 GAAGCCAGAAGGGGAGAGGAAGG + Intronic
974146481 4:57953732-57953754 AAAGGAAGAAAGGGAAGGGAAGG + Intergenic
974820273 4:67058576-67058598 TAAGCAATGAAGGGAAGGAAGGG + Intergenic
975043903 4:69778895-69778917 CAAGGGCTAAGGGGAAGGGAGGG + Intronic
975265506 4:72361199-72361221 GGAGCAATAAGGGGAATTGAAGG - Intronic
976804858 4:89035480-89035502 GAAGGAAGGAGGGGAGGGGAGGG + Intronic
976980922 4:91227670-91227692 GACTCCAAAAGGGGAAGGGAGGG - Intronic
977708734 4:100100247-100100269 TCAGCAATGAGAGGAAGGGAGGG + Intergenic
978143775 4:105348112-105348134 AAAGAAGGAAGGGGAAGGGACGG + Intergenic
978243791 4:106548807-106548829 GAGGGAAGGAGGGGAAGGGAAGG - Intergenic
978243798 4:106548825-106548847 GAGGGAAGGAGGGGAAGGGAGGG - Intergenic
978299133 4:107245934-107245956 TCAGCAACAAGAGGAAGGGAAGG - Intronic
978497362 4:109374757-109374779 GAAGGAAGGAAGGGAAGGGAAGG + Intergenic
979376866 4:119956797-119956819 GAAACAATAGGTGGAATGGAGGG - Intergenic
979506402 4:121502613-121502635 GAAGGAAGGAGGGGGAGGGAGGG - Intergenic
979722143 4:123913381-123913403 GAAGCAATCTGGGGAAAGGGAGG - Intergenic
979774931 4:124578381-124578403 GGAGATATAAGGGGAAGGGGAGG + Intergenic
979803162 4:124937006-124937028 AAAGCAATACAGGGAGGGGATGG + Intergenic
980108201 4:128608402-128608424 GGAGCAAAAAGGTGAAGGCATGG + Intergenic
980619447 4:135279600-135279622 GAAAGAATGAGGGGAAAGGAAGG - Intergenic
980869787 4:138597489-138597511 GATGCAAAAAGCAGAAGGGAAGG + Intergenic
981086471 4:140689467-140689489 AAGGGAAAAAGGGGAAGGGAAGG - Intronic
981354083 4:143766753-143766775 TCAGCAAAAAAGGGAAGGGAAGG - Intergenic
981485200 4:145278385-145278407 GAAGGTATAAGGGAAAGTGAGGG + Intergenic
981892894 4:149760015-149760037 GAAGGAAGGAAGGGAAGGGAAGG + Intergenic
981971865 4:150672930-150672952 AAAGTAGTAAGGAGAAGGGAAGG + Intronic
982223148 4:153141689-153141711 AAAGAAAGAAAGGGAAGGGAAGG - Intergenic
982255032 4:153443348-153443370 GAAGCAAGAAGGGGGAAGGAAGG + Intergenic
982280924 4:153683470-153683492 GATGGAATAGGGGCAAGGGAAGG + Intergenic
982329652 4:154166808-154166830 GAAGGAATGAGGGGAAAGGAGGG + Intergenic
982373129 4:154656407-154656429 CAAGGAATCAAGGGAAGGGAAGG + Intronic
982452498 4:155569931-155569953 AAAAGAAAAAGGGGAAGGGAAGG + Intergenic
982882069 4:160731874-160731896 GAAGGAAAAAAAGGAAGGGAAGG - Intergenic
983217890 4:165019167-165019189 GAAAGTATAAGAGGAAGGGAGGG - Intergenic
983307932 4:166017673-166017695 GAAAGAACAAGAGGAAGGGAGGG - Intronic
983914080 4:173272150-173272172 GAAGCAGTGAGGGACAGGGATGG - Intronic
983965004 4:173799128-173799150 GAAGGAAGGAAGGGAAGGGAAGG - Intergenic
984166455 4:176308196-176308218 GAAGCACGAAGGGACAGGGAAGG + Intergenic
984663658 4:182402035-182402057 GAGGTCATAAGTGGAAGGGATGG + Intronic
984760075 4:183356356-183356378 GAGGCAGAAAGGAGAAGGGAAGG - Intergenic
984911365 4:184676755-184676777 GGAGAAAGAAAGGGAAGGGAAGG - Intronic
985835193 5:2266076-2266098 GAAGGTAAAAGGGGAAGGCAAGG + Intergenic
985937230 5:3106536-3106558 GAAGAAAGGAGGGGAGGGGAGGG - Intergenic
986147226 5:5089710-5089732 AAGGGAATTAGGGGAAGGGAAGG - Intergenic
986618294 5:9643023-9643045 GAAGGATAAAGAGGAAGGGAGGG - Intronic
987020235 5:13863223-13863245 GAAGAAATGAGGGTAAAGGAAGG - Intronic
988551000 5:32200661-32200683 GGAGAAGGAAGGGGAAGGGAAGG + Intergenic
989197957 5:38734252-38734274 GCAGGAACAATGGGAAGGGAGGG - Intergenic
989224176 5:39006670-39006692 GAGGAAATAAGGGGAGGGAAGGG + Intronic
989721383 5:44532642-44532664 GAAGAAAGGAGGAGAAGGGAAGG + Intergenic
989948226 5:50265340-50265362 GAAGGAATAAGAGGAGGGGTTGG - Intergenic
990042159 5:51388703-51388725 GAAGGCAGAAGGGTAAGGGAGGG - Intronic
990085817 5:51975261-51975283 CAAGCAAGAAGGGGAAGAGCTGG + Intergenic
990201159 5:53376376-53376398 GAAGAGAGGAGGGGAAGGGAAGG + Intergenic
990316870 5:54591008-54591030 GAAGAAAAAAGGAGAAGTGAGGG - Intergenic
990584743 5:57200137-57200159 GAAGGAAGCAGGGGAGGGGAGGG - Intronic
990782748 5:59384400-59384422 GAAGGAGAAAGGGGAAGAGATGG - Intronic
990992211 5:61697435-61697457 GAAGCAAGGAGAGGAAGGAAAGG - Intronic
991417397 5:66406727-66406749 GAAACAAAATGGGGAAGGGGCGG + Intergenic
991548604 5:67811804-67811826 GAAGAAAGAAGGGGAGGGGAGGG - Intergenic
991646664 5:68807954-68807976 GAAGGGAAAAGGGGAAGGGAAGG + Intergenic
991700732 5:69313880-69313902 GAAGCAAAAAGGAGAGGGCATGG + Intronic
992284782 5:75223580-75223602 GAAGCAACAATGGAAAGGAAAGG + Intronic
992598950 5:78377038-78377060 GAAGCAAAAAAGAGGAGGGAAGG - Intronic
992911586 5:81400835-81400857 GAAGCTGAAAGGGGCAGGGAAGG + Intergenic
992953334 5:81882395-81882417 GAAAAAATAAGGGGGAGGGAAGG + Intergenic
993175240 5:84475650-84475672 GAAGGAAGAAGTGGAAGGGAGGG + Intergenic
993202858 5:84840226-84840248 GAAGAGAGAAGGGAAAGGGAAGG - Intergenic
993439393 5:87936986-87937008 GAAGGAAGAAAAGGAAGGGAGGG - Intergenic
993439405 5:87937056-87937078 GAAGGAAGAAAAGGAAGGGAGGG - Intergenic
994019917 5:95011344-95011366 GAAGAAATAAGTGGAGGAGAAGG - Intronic
995177953 5:109199968-109199990 GAAGCAAAGAGGGGTAGGGATGG - Intergenic
995711239 5:115037974-115037996 AAAGCAAAAAGGGGAAAGCAGGG - Intergenic
996119911 5:119659766-119659788 GAAACAATATGAAGAAGGGAAGG + Intergenic
996178803 5:120393471-120393493 GAAGCGATAAAGAAAAGGGAAGG + Intergenic
996456911 5:123695122-123695144 CAAGCAATAAGGCAGAGGGAGGG + Intergenic
996545980 5:124679353-124679375 GAAGGAAGGAAGGGAAGGGAAGG - Intronic
996810869 5:127515196-127515218 GAAGCTAGAAGGGGCAAGGAAGG + Intergenic
997672468 5:135686744-135686766 GAAGGAAGGATGGGAAGGGATGG + Intergenic
998325332 5:141275034-141275056 GAAGGAAGGAAGGGAAGGGAAGG + Intergenic
998364614 5:141621173-141621195 GAAGAAATAAGGGGCAAGGGGGG + Exonic
998378637 5:141708373-141708395 GAAGAAAAAAGGGGAAAGAAGGG - Intergenic
998638914 5:143987473-143987495 GAGGGAATGAGGGGAAGGAAGGG - Intergenic
998652946 5:144141792-144141814 GAAGCAATTAGTGGAAGCAAAGG + Intergenic
998966775 5:147549518-147549540 GAAGGAAAAAGGGAAAGGAAGGG - Intergenic
999019024 5:148142696-148142718 GAAGGAAAAAGGGGAAGAGAAGG + Intergenic
999019222 5:148144642-148144664 GAAAGAAAAAGGGGAAGAGAAGG - Intergenic
999120558 5:149206338-149206360 GAAGCACAATGGGGAAGGGGTGG + Intronic
999177443 5:149641218-149641240 GAAGAAATACGGGGAAGGGCGGG - Intergenic
999272480 5:150304662-150304684 GAAGCAGCAAGGGGATGGGGTGG + Intronic
999945476 5:156590858-156590880 GAAGAGAGAAGGGGAAGGAAAGG - Intronic
1000185060 5:158851361-158851383 GAAGAAGGAAAGGGAAGGGAAGG + Intronic
1000465675 5:161573071-161573093 GAAGCAAGGCTGGGAAGGGAAGG + Intronic
1001534283 5:172487860-172487882 GAAGCGATCAGAGGTAGGGATGG + Intergenic
1001707342 5:173751083-173751105 TGTGCAATAAGGGGAAGTGAAGG + Intergenic
1001737799 5:174021052-174021074 GAAGCAGAAGGGGAAAGGGAAGG + Intergenic
1002332121 5:178450394-178450416 GAAGCAAGAAAGGAAAGGGCGGG - Intronic
1002430722 5:179202413-179202435 GAAGGAAGAAGGGTAGGGGAAGG - Intronic
1002678656 5:180941072-180941094 GAAGAAAGAGGTGGAAGGGAGGG + Intronic
1002693565 5:181068783-181068805 GAAGGAATGAGAGGAAGGAAAGG + Intergenic
1002832641 6:836770-836792 AAAGCACTAAGAGGAAGGAAAGG + Intergenic
1003318941 6:5035619-5035641 GAAGGAAGGAGGGGAGGGGAGGG - Intergenic
1003322286 6:5062891-5062913 CAAGCCAGGAGGGGAAGGGAAGG + Intergenic
1003443515 6:6164834-6164856 GAAGGAGGGAGGGGAAGGGAGGG - Intronic
1004008258 6:11656787-11656809 GAAGTAATTAGGCAAAGGGATGG + Intergenic
1004295144 6:14403318-14403340 GAAGCTAGAAGGGGCAGGGAAGG - Intergenic
1004311130 6:14546127-14546149 GAAGCTAGAAGAGGAAAGGAAGG - Intergenic
1004617402 6:17303586-17303608 AAAGGAAAAAGGGAAAGGGAAGG + Intergenic
1004761426 6:18670864-18670886 GAAGAGAGAAGGGGAGGGGAGGG - Intergenic
1004879940 6:19997295-19997317 GAAGGAAGGAAGGGAAGGGAAGG + Intergenic
1005068798 6:21845105-21845127 GAAACAATAAGTGGAAGGAGGGG - Intergenic
1005319815 6:24642086-24642108 GAAGAAAGGAAGGGAAGGGAAGG + Intronic
1005437676 6:25832474-25832496 GAAGGAAGAAGGGAAAGAGAAGG - Intergenic
1005830953 6:29670778-29670800 GAAGCAACAAGAGGAAGAGGCGG + Intronic
1006097099 6:31662728-31662750 AAAGCATTAAGGGCAGGGGAAGG + Intronic
1006258369 6:32848895-32848917 GAAGCAAGAAGGGTAAAGAATGG + Intronic
1006299504 6:33186112-33186134 GAGGTAGTAGGGGGAAGGGAAGG - Intronic
1006307257 6:33230706-33230728 GAAGGAAGGAAGGGAAGGGAAGG + Intergenic
1006827782 6:36948764-36948786 AAAGAAAGAAAGGGAAGGGAGGG - Intronic
1007040683 6:38719383-38719405 GGTACAAGAAGGGGAAGGGAAGG - Intronic
1007552986 6:42744571-42744593 GAAGCAGTAAGGGGGAAGGAGGG - Exonic
1007703576 6:43778155-43778177 GATGAAAGAAGGGGAGGGGATGG + Intronic
1007726984 6:43922519-43922541 GAGGCAAGAAGGGGTGGGGAGGG - Intergenic
1007828919 6:44623220-44623242 GAAGAAAAAGGAGGAAGGGAGGG - Intergenic
1008419331 6:51279101-51279123 GAAGGAATAAAGTGAAGGGGAGG + Intergenic
1008563750 6:52747560-52747582 GAAGCTGTAAGAGGCAGGGAAGG + Intergenic
1008683056 6:53894786-53894808 GAAACAACAAAGGGAAGGGGAGG - Intronic
1008777010 6:55052122-55052144 GAAGCAAAAAAAGGCAGGGAGGG - Intergenic
1008813930 6:55540054-55540076 GAAGCAAAGGAGGGAAGGGAAGG + Intronic
1009266932 6:61567685-61567707 GAAGAAGAAAGGGGAAAGGAGGG - Intergenic
1009319265 6:62266238-62266260 GAAGCCAAAAGGATAAGGGAAGG - Intronic
1009890702 6:69677518-69677540 GAAGAAAGAAGGGCAAGGGAAGG + Intronic
1010298659 6:74232094-74232116 GAAGGAAGAGGAGGAAGGGAGGG - Intergenic
1010343065 6:74780137-74780159 GAAGAAAGTAGGGGAAGAGAAGG - Intergenic
1010720183 6:79274563-79274585 GAAGCCATAAAGGGAAGAAAGGG + Intergenic
1010787471 6:80021185-80021207 GATGCCACAAAGGGAAGGGAAGG + Intronic
1011012883 6:82721869-82721891 GAAGAAATAAGAGGAAGGGAAGG - Intergenic
1011302596 6:85892235-85892257 GGAGCACTAGGGGGAAGGGATGG - Intergenic
1011789055 6:90878592-90878614 GAAGAAATACGGTGGAGGGAGGG + Intergenic
1011883123 6:92057283-92057305 GAAGGTAGAAGGGGAAGAGAGGG + Intergenic
1012497824 6:99854266-99854288 GAAGGAAGAAAGGGAAGGAAGGG - Intergenic
1013766362 6:113578617-113578639 GAAGTAAAAAAGGGAAAGGAAGG - Intergenic
1013863735 6:114668178-114668200 GAAAAAAGAAAGGGAAGGGAAGG + Intergenic
1014576118 6:123075392-123075414 GAAGGAAGGAAGGGAAGGGAAGG - Intergenic
1014870585 6:126591376-126591398 GGACCCAGAAGGGGAAGGGAAGG - Intergenic
1015139280 6:129911452-129911474 TCAGCACTCAGGGGAAGGGAAGG - Intergenic
1015714292 6:136174986-136175008 GAAGAAAGAAGGAGAAGGAAAGG + Intronic
1015742250 6:136469305-136469327 GAAGGAAGAAGAGGAAGGCAGGG - Intronic
1016138264 6:140574174-140574196 GAATCCATTAGGGGAAGAGATGG - Intergenic
1016301699 6:142638826-142638848 GAAGGAAGAAGAGGGAGGGAGGG + Intergenic
1016756517 6:147693456-147693478 GGGGCAATAAGGGGCAGAGAGGG + Intronic
1017204878 6:151794041-151794063 GTAACAAAATGGGGAAGGGAGGG + Intronic
1017671613 6:156774700-156774722 GAAGCCATGAGGGGAAGGCCCGG - Intergenic
1017856720 6:158356280-158356302 CAAGCTTTAAGGGGAAGGGAGGG + Intronic
1017930011 6:158943831-158943853 GAAGAAAGAAAGGGAAGGGAAGG - Intergenic
1017977967 6:159374904-159374926 GCAGCAATGAGGGTAAGGCAGGG - Intergenic
1018235463 6:161719299-161719321 GAAGGAAAAAGGAGAAGAGAGGG + Intronic
1018524313 6:164690726-164690748 GAAGCAAAAAGAGAAAAGGAAGG + Intergenic
1018694333 6:166379736-166379758 GAAGTAAAAAGAGGAAGGGATGG + Intronic
1019061554 6:169261039-169261061 GAGGCAAAGAGGGGAAGTGAGGG - Intergenic
1019225113 6:170502492-170502514 GCAGCCATCAGGGGAAGGAAAGG + Intergenic
1019225123 6:170502528-170502550 GCAGCCATCAGGGGAAGGAAAGG + Intergenic
1019225150 6:170502672-170502694 GCAGCCATCAGGGGAAGGAAAGG + Intergenic
1019989296 7:4681155-4681177 GAAGGAAGGAGAGGAAGGGAAGG + Intergenic
1019989366 7:4681391-4681413 GAAGGAATGAAGGGAAGGGAAGG + Intergenic
1019989371 7:4681409-4681431 GAAGGAATGAAGGGAAGGAAGGG + Intergenic
1020581350 7:10006768-10006790 GAACAAAGAAGGGGAAAGGAGGG - Intergenic
1020583900 7:10040772-10040794 GGAGAAAAAAGGGGAGGGGAGGG + Intergenic
1021077372 7:16321583-16321605 CAAGAAATATAGGGAAGGGAGGG + Intronic
1021089780 7:16469870-16469892 GGAGGAATAAGAGGAAGGGTTGG - Intronic
1021316000 7:19147703-19147725 AAAGGAGTAAGGGGGAGGGAGGG - Intergenic
1021352992 7:19617860-19617882 GAAGGAAGAAGGGGAGGGGAGGG - Intergenic
1021425318 7:20493481-20493503 GAAGGCATAAGAGGAAGGCATGG + Intergenic
1021619477 7:22537278-22537300 GAAGGAAGGAAGGGAAGGGAAGG - Intronic
1021677834 7:23098524-23098546 GAACCAATAAGATGAATGGATGG - Intergenic
1021950512 7:25769573-25769595 GAGGAAAGAAGGGGAAGGGAAGG + Intergenic
1022194878 7:28055222-28055244 GATGCAAAAAGGGGATGGGAGGG - Intronic
1022274472 7:28841931-28841953 GAAGGGAGGAGGGGAAGGGAGGG + Intergenic
1022651991 7:32285815-32285837 GAGAGAATAAGGGGAGGGGAAGG + Intronic
1022854111 7:34298698-34298720 TAAGAGATAAGGGGAAGGGGTGG + Intergenic
1022872458 7:34493610-34493632 AAAGCAATAAGGAGAAGAGATGG - Intergenic
1023241175 7:38149178-38149200 GAAAAGAGAAGGGGAAGGGAAGG + Intergenic
1023372633 7:39527371-39527393 GAAAGAAAAAAGGGAAGGGAAGG + Intergenic
1023598231 7:41854762-41854784 GAAGGCATGAGGGGTAGGGATGG - Intergenic
1024086799 7:45900088-45900110 GAAGCAGTAAGAGAAAGGCAAGG - Intergenic
1024305474 7:47925593-47925615 CAGGCCATAATGGGAAGGGAGGG + Intronic
1024746600 7:52414025-52414047 GAAGCAAGGAGAGGAAGGGAGGG + Intergenic
1025146987 7:56513903-56513925 GAAGGAGGAAGGGGGAGGGAGGG - Intergenic
1025147054 7:56514211-56514233 GAAGAAAGAAGGGAGAGGGAAGG - Intergenic
1025321634 7:58100481-58100503 GAAGGAAAAAGAGGAAAGGAAGG + Intergenic
1025480923 7:60981790-60981812 GAAGAAAAAAGAGGAAAGGAAGG + Intergenic
1025488113 7:61077245-61077267 GAAGGAAAAAGAGGAAAGGAAGG - Intergenic
1025556775 7:62319164-62319186 GAAGGAAAAAGGGGAAAGGAAGG - Intergenic
1026086827 7:67269628-67269650 GAAGGAAGAAAAGGAAGGGAGGG - Intergenic
1026103546 7:67402489-67402511 GAAGCAAGACAGGGAAGAGAAGG - Intergenic
1026210464 7:68299484-68299506 GAAAGAATAAGAGCAAGGGAGGG - Intergenic
1026245065 7:68612310-68612332 AAAGAAAGAAAGGGAAGGGAGGG - Intergenic
1026332931 7:69368734-69368756 GAAGGCACAAAGGGAAGGGATGG + Intergenic
1026521159 7:71119283-71119305 GAAGGAAGGAAGGGAAGGGAAGG - Intergenic
1026526338 7:71156634-71156656 GAGGCAGGGAGGGGAAGGGAAGG - Intronic
1026546877 7:71330895-71330917 GGAGCAAGAAGGGGAAGGATAGG - Intronic
1026677227 7:72437968-72437990 GAAGAAAGAAAGAGAAGGGAAGG - Intronic
1026690286 7:72545102-72545124 GAAGGAAGAAAAGGAAGGGAGGG + Intergenic
1027652807 7:80891360-80891382 GAAGTATTATGGGGGAGGGAGGG - Intronic
1028047793 7:86144986-86145008 GAAGCAATAATGTGAAGAAAGGG - Intergenic
1028194356 7:87888546-87888568 GAAGCAACAAGGAAAAGGAAAGG - Intronic
1028380735 7:90195816-90195838 GGTGCAATAAGGGAAAGGCAAGG - Intronic
1028520875 7:91729127-91729149 GAAGGAAGGAAGGGAAGGGAAGG + Intronic
1028920532 7:96305890-96305912 GAAGCAAAAAGGAAAAGGAAAGG + Intronic
1029288575 7:99484172-99484194 GAATCAGGAAGAGGAAGGGAAGG + Intronic
1029372580 7:100158712-100158734 GAAACAGGAAGCGGAAGGGAGGG + Intronic
1029473570 7:100769489-100769511 GAAGGAAGAAAGGGAAGAGAAGG - Intronic
1029575783 7:101402421-101402443 GAAGGGGAAAGGGGAAGGGAAGG - Intronic
1029872040 7:103704725-103704747 GGAGCAAAAATAGGAAGGGAAGG - Intronic
1030191741 7:106817350-106817372 GAAGCAAAGAGGGGTGGGGAAGG - Intergenic
1030238780 7:107296086-107296108 GAGGAAGGAAGGGGAAGGGAAGG - Intronic
1030394433 7:108967690-108967712 GATGGAAGAAGGGGAAGGAAAGG - Intergenic
1030595590 7:111535295-111535317 GAAGCAAAAAGGAGAAATGAAGG + Intronic
1031016267 7:116579937-116579959 AAAGCAATACAAGGAAGGGAAGG + Intergenic
1031542264 7:123008596-123008618 GAAGCTATAAGAGGCAGAGATGG - Intergenic
1032364107 7:131283334-131283356 GAAGGAAGGAGGGGAAGGGAAGG - Intronic
1032521798 7:132551048-132551070 GAGGTACTAAGTGGAAGGGAAGG - Intronic
1032527311 7:132588628-132588650 GAAGGAAGGAAGGGAAGGGAAGG + Intronic
1033000834 7:137502546-137502568 GGAGGAGAAAGGGGAAGGGAGGG + Intronic
1033912870 7:146285934-146285956 GAAGGAAAAGGGGGAGGGGAGGG - Intronic
1033946339 7:146723280-146723302 GAAGCTAGAAGGGGACAGGAAGG + Intronic
1034267660 7:149789062-149789084 GGAGGGATGAGGGGAAGGGAGGG + Intergenic
1034385772 7:150739748-150739770 AAAGAAAGAAGGGAAAGGGAGGG + Intronic
1034493137 7:151404986-151405008 GAAGCCACACGGGGCAGGGATGG + Intronic
1034707402 7:153157872-153157894 GAAGAATGAAGGGGAAGCGAGGG + Intergenic
1035110313 7:156476185-156476207 GAAGGAAGAACAGGAAGGGAAGG + Intergenic
1035400723 7:158563751-158563773 TGAGGGATAAGGGGAAGGGAGGG - Intronic
1035870050 8:3127870-3127892 GAAGGAATGAGAGGGAGGGAGGG + Intronic
1035992791 8:4510855-4510877 GAAGGAAGGAAGGGAAGGGAAGG - Intronic
1036023438 8:4874987-4875009 GAAGAAAAGAAGGGAAGGGAAGG - Intronic
1036275059 8:7343480-7343502 GAAGAAATATGGGGAAGGAATGG + Intergenic
1036346295 8:7966868-7966890 GAAGAAATATGGGGAAGGAATGG - Intergenic
1036576576 8:10032997-10033019 GAAGGAAGGAAGGGAAGGGAAGG - Intergenic
1036841618 8:12127626-12127648 GAAGAAATATGGGGAAGGAATGG - Intergenic
1036863428 8:12373872-12373894 GAAGAAATAAGAGGAAGGAATGG - Intergenic
1037058012 8:14469115-14469137 GAAGCAAAAAGTGGAGGGGTAGG - Intronic
1037098356 8:15013521-15013543 GAAGGAATAAAGGGAAGGAGGGG - Intronic
1037480679 8:19302340-19302362 GAAGGAAGGAAGGGAAGGGAAGG + Intergenic
1037740394 8:21604310-21604332 GAAACAACAAGGGGAAGTGCAGG - Intergenic
1037760181 8:21736900-21736922 GAAGAAATGAGGGGAGGGGAGGG + Intronic
1037802693 8:22044034-22044056 GGAGCAAAAGGGGGAAGGAAGGG - Intronic
1038065429 8:23958827-23958849 GAAGGAAAGAAGGGAAGGGAGGG - Intergenic
1038704086 8:29877852-29877874 GAGGCTGGAAGGGGAAGGGAGGG + Intergenic
1039099333 8:33924069-33924091 GAAGCTAGAAGAGGAAAGGATGG - Intergenic
1039665118 8:39517621-39517643 GAAGCAAGAAAGGGAAGGTGTGG - Intergenic
1039851269 8:41367328-41367350 AAAGGAAGAAGGGGAAGGAAGGG + Intergenic
1040288333 8:46111700-46111722 GAAGCAAAAACGGGATGGCAGGG - Intergenic
1040436164 8:47393781-47393803 GAAGGGAGAAGGGGAAGGGAAGG - Intronic
1040957325 8:52992784-52992806 GAAGCCATAAAAGGAAGGGGAGG - Intergenic
1041162784 8:55061940-55061962 GAAGCAAGAGAGGGTAGGGAGGG - Intergenic
1041201802 8:55456825-55456847 GAAGTAAAAAAGAGAAGGGAAGG + Intronic
1041995027 8:64044413-64044435 AAAGAAAGAAAGGGAAGGGAAGG + Intergenic
1042353193 8:67799099-67799121 AAAGGAATAAGGGGGAGGGGGGG - Intergenic
1042601723 8:70505617-70505639 GAGGGAGGAAGGGGAAGGGAGGG - Intergenic
1042632230 8:70830776-70830798 GAAGTAATAAAAGGAAGAGATGG + Intergenic
1042829616 8:73012159-73012181 GAGGGAGTAAGGGGAAGGGCTGG + Intronic
1042942484 8:74121854-74121876 GAAGGAAGGAAGGGAAGGGAAGG - Intergenic
1043084428 8:75810827-75810849 GAAGGAAGGAAGGGAAGGGAGGG - Intergenic
1043089358 8:75877725-75877747 CAGGCAACAAGGGGAAGTGAAGG - Intergenic
1043620034 8:82179111-82179133 GAACCAATAAGATGAAGTGAGGG - Intergenic
1043726208 8:83614238-83614260 GAAGGAAGAAAGGGAAGGAAGGG - Intergenic
1043726213 8:83614256-83614278 GAGGGAGGAAGGGGAAGGGAAGG - Intergenic
1043852419 8:85229813-85229835 AAAGAAAAAAGAGGAAGGGAGGG + Intronic
1044431486 8:92112733-92112755 GAAGAAAAGAGGGGAGGGGAGGG + Intergenic
1044513364 8:93109841-93109863 GAAGCAATGAAGGGAAAAGAGGG + Intergenic
1045282201 8:100758795-100758817 GAAGCATTGTGAGGAAGGGAAGG - Intergenic
1046017517 8:108622844-108622866 GAATCAATAAGAGGAAAGAAAGG - Intronic
1046170600 8:110500169-110500191 GAAACAATAAGGGCAATGAATGG - Intergenic
1046297839 8:112245249-112245271 GATGAAATAAGGGGAAGATATGG - Intronic
1046522502 8:115343442-115343464 GAAGGAAAATGGGGAAGGGAGGG - Intergenic
1046547881 8:115674434-115674456 GAAGAAAGAAAGGGAAGGGAAGG - Intronic
1046588352 8:116175706-116175728 GAAGAAAGAAAGAGAAGGGAAGG + Intergenic
1047238092 8:123060263-123060285 GAAGAAAAAAGGGCGAGGGAAGG - Intronic
1047370707 8:124253548-124253570 GAGGCGATAAAAGGAAGGGAGGG - Intergenic
1047484893 8:125320297-125320319 GAAGGAAGGAAGGGAAGGGAAGG + Intronic
1047734018 8:127750192-127750214 AAAGAAAGAAAGGGAAGGGAAGG - Intergenic
1047734028 8:127750243-127750265 GAAGGAAGGAAGGGAAGGGAAGG - Intergenic
1047741834 8:127812633-127812655 GAAGGAAGGAAGGGAAGGGAAGG + Intergenic
1047828530 8:128606023-128606045 GAAGGAAGGAAGGGAAGGGAAGG - Intergenic
1048370081 8:133769446-133769468 CAAGCCATGATGGGAAGGGAAGG + Intergenic
1048422641 8:134292462-134292484 TATGGAAAAAGGGGAAGGGAGGG + Intergenic
1048551684 8:135439039-135439061 GAAGGAAAGAAGGGAAGGGAAGG + Intergenic
1048837867 8:138538320-138538342 GAAGGAAGGAAGGGAAGGGAAGG + Intergenic
1050022197 9:1295859-1295881 GAAGAAATAAGAAGAAGGCATGG + Intergenic
1051440234 9:17075418-17075440 AAAGAAAAAAGGGGAGGGGAGGG - Intergenic
1051707076 9:19892034-19892056 GAAGAGAAAAAGGGAAGGGAGGG - Intergenic
1051900380 9:22032347-22032369 GAAGGAATGAAGGGAAGGAAGGG - Intronic
1052087563 9:24286529-24286551 GAAAGAAAAAAGGGAAGGGAGGG - Intergenic
1052497431 9:29245404-29245426 GAAACAATGAGAGGTAGGGAGGG - Intergenic
1052965741 9:34339264-34339286 GTAGCAAAAAGGGGTAGGGAAGG + Intronic
1053095979 9:35328675-35328697 GGAGGAAGAAAGGGAAGGGAAGG - Intronic
1053485751 9:38454846-38454868 GAAGGAAGAAAGGGAAGGAAGGG - Intergenic
1053698423 9:40661698-40661720 GAAGGAAAAAGAGGAAAGGAAGG - Intergenic
1054309714 9:63461105-63461127 GAAGGAAAAAGAGGAAAGGAAGG - Intergenic
1054408503 9:64785247-64785269 GAAGGAAAAAGAGGAAAGGAAGG - Intergenic
1054441656 9:65269058-65269080 GAAGGAAAAAGAGGAAAGGAAGG - Intergenic
1054488624 9:65752431-65752453 GAAGGAAAAAGAGGAAAGGAAGG + Intergenic
1055573545 9:77641054-77641076 GAAGGAAGGAGGGGAGGGGAGGG + Intronic
1055596767 9:77873573-77873595 GAAGTAAAAAGGGGGAGGAAGGG + Intronic
1055883346 9:81029828-81029850 TCAGCAATAGCGGGAAGGGATGG - Intergenic
1055919909 9:81449377-81449399 GAAGCAAAAAGGGGAAGGCCAGG - Intergenic
1056318510 9:85414872-85414894 GAAGCCATCAGGGTAAGGGTGGG + Intergenic
1056361214 9:85859636-85859658 GAAGCAGTAATGGGAGGTGAGGG + Intergenic
1056550174 9:87646282-87646304 GAATCCAAAAGGGGAAGGAAAGG + Intronic
1056662105 9:88551644-88551666 GAAGCAACAGGGGAAGGGGAAGG - Intronic
1057215922 9:93228783-93228805 GAAGTATTTGGGGGAAGGGAAGG + Intronic
1057222865 9:93267270-93267292 AAAGCAACAGGGGGACGGGAAGG - Intronic
1057565100 9:96160253-96160275 GAAGGAAGGAGGGGAGGGGAGGG + Intergenic
1057627217 9:96688155-96688177 CAAGCAAGATGGGGAATGGAAGG + Intergenic
1057751167 9:97794410-97794432 GAAGGAAGAGGGAGAAGGGATGG + Intergenic
1057882655 9:98804850-98804872 GAAGGAAGGAAGGGAAGGGAAGG - Intergenic
1057901230 9:98950512-98950534 GAAGGAAGGAAGGGAAGGGAAGG - Intronic
1058324650 9:103680299-103680321 GAAGAAGGAAAGGGAAGGGAGGG + Intergenic
1058343488 9:103927318-103927340 GAAAGGAGAAGGGGAAGGGAAGG + Intergenic
1058875286 9:109238775-109238797 GCAGGAGTTAGGGGAAGGGATGG + Intronic
1059309933 9:113381349-113381371 AAAGAAAGAAAGGGAAGGGAAGG - Intergenic
1059542554 9:115144453-115144475 AAAGAAATAAGGGTAAGTGAAGG - Intronic
1059675912 9:116539183-116539205 GAGGAAATAAGGGGAAAGTAAGG + Intronic
1059885576 9:118741115-118741137 GAACCAAGAAGGGGAGGGCATGG + Intergenic
1060045800 9:120339163-120339185 GAAGAAAAAAGAGGAAGGGAGGG + Intergenic
1060240374 9:121897896-121897918 GAAGAAAGAGAGGGAAGGGAAGG - Intronic
1060416385 9:123433812-123433834 AAAGCAGTCAGGGGAAGGGAGGG - Intronic
1060666016 9:125432698-125432720 GAGGCAGGAAGGGGTAGGGAGGG + Intergenic
1060790765 9:126484038-126484060 CAAGCCATCAGGGGAGGGGAGGG + Intronic
1060997321 9:127882572-127882594 GAAGAAAAGAAGGGAAGGGAAGG + Intergenic
1061947174 9:133914803-133914825 GAAGGGAGAAGGGGAGGGGAGGG + Intronic
1062362611 9:136194765-136194787 GAGGGAAGAAGGGGAAGGGGAGG - Intergenic
1062638433 9:137503666-137503688 GAAGGAAGAAGGAGAAGGGGAGG + Intronic
1062701381 9:137906334-137906356 AAAGCTATAAGGTGAAGGGAGGG + Intronic
1203615769 Un_KI270749v1:62203-62225 GAAGGAAAAAGAGGAAAGGAAGG + Intergenic
1185431825 X:15698-15720 GAAGCGGTGTGGGGAAGGGAAGG - Intergenic
1185441143 X:228414-228436 GAAGCGGTGTGGGGAAGGGAAGG - Intergenic
1185501710 X:601782-601804 GAAGGAAGGAAGGGAAGGGAAGG - Intergenic
1185573801 X:1154491-1154513 GAAGCAGGGAGGGGAGGGGAGGG - Intergenic
1185674062 X:1834452-1834474 GAAGGAAGGAAGGGAAGGGAAGG + Intergenic
1186005811 X:5070828-5070850 GAAGAAACAAAGGAAAGGGAAGG - Intergenic
1186005817 X:5070875-5070897 GAAGAAACAAAGGAAAGGGAAGG - Intergenic
1186058272 X:5674596-5674618 GAGGAGAGAAGGGGAAGGGAGGG + Intergenic
1186137765 X:6537303-6537325 GAGGCCAGAAGGGGAAGGGGGGG - Intergenic
1186324354 X:8462590-8462612 GAGGCCAGAAGGGGAAGGGGGGG + Intergenic
1186412574 X:9356811-9356833 GAAGCACGAAAAGGAAGGGAAGG + Intergenic
1186622717 X:11258309-11258331 GATGCAGTGAGGGGAAGAGAAGG + Intronic
1186729572 X:12394655-12394677 GAAGAAAAAAAGAGAAGGGAGGG - Intronic
1186944446 X:14549872-14549894 GAAAGAATAAGAGGAAGAGAAGG + Intronic
1187571483 X:20508242-20508264 GAAGTAAGATTGGGAAGGGAAGG - Intergenic
1187576276 X:20559361-20559383 GAAAAAGGAAGGGGAAGGGAAGG - Intergenic
1187916080 X:24153305-24153327 AAGGCATGAAGGGGAAGGGAGGG - Intronic
1188277279 X:28215976-28215998 GAAGGAAGGAAGGGAAGGGAAGG - Intergenic
1188327427 X:28822765-28822787 GAAGAAATAAGGACAAGGGATGG + Intronic
1188487216 X:30695461-30695483 GAAGCAATAAGAGGTAGGAAAGG - Intronic
1189194765 X:39143682-39143704 GAAGGAAGGAGGGGAAGGAAAGG - Intergenic
1189265899 X:39715906-39715928 GAAGCAAGACAGGGAAGGGGAGG + Intergenic
1189548889 X:42072593-42072615 GAAGAGACAAGGGGAAGGGAAGG + Intergenic
1189643136 X:43095640-43095662 GAAGCTAAAAGAGAAAGGGAAGG + Intergenic
1189685589 X:43560549-43560571 GAAGAGATGAGGGGAAGGAAAGG - Intergenic
1191904794 X:66076928-66076950 GAAGAGAAAAAGGGAAGGGAAGG - Intergenic
1191904805 X:66076968-66076990 GAAGGAAAGAAGGGAAGGGAAGG - Intergenic
1192283553 X:69709567-69709589 GAAGGAAGAAAGGGAGGGGAGGG + Intronic
1192316551 X:70056255-70056277 GAAGAAATAAGGGTAAAGGGTGG + Intergenic
1192563466 X:72143064-72143086 AAAGGAATATGGGGACGGGAGGG + Intergenic
1192730076 X:73794247-73794269 GAAAGAAAAAAGGGAAGGGAAGG + Intergenic
1193507153 X:82358956-82358978 AAAGAAAGAAGGGGATGGGAGGG + Intergenic
1194122198 X:89975334-89975356 GGAGGAAAAAGGGGAAAGGAAGG - Intergenic
1194200662 X:90950294-90950316 GAAGCATTAAGGGGAAATGTAGG + Intergenic
1194204212 X:90992638-90992660 GAAGCAATAAATGGAAGTAAGGG + Intergenic
1195000320 X:100637013-100637035 GAAGTTATAAGGAGAGGGGAGGG - Intronic
1195082373 X:101383906-101383928 GAAGCCATCTGGGGAGGGGAAGG - Intronic
1195129082 X:101837279-101837301 GAGGGAAGAAGAGGAAGGGATGG + Intronic
1195177178 X:102322564-102322586 GAAGAAAGAAGAGGAAGGAAAGG - Intronic
1195181686 X:102364529-102364551 GAAGAAAGAAGAGGAAGGAAAGG + Intronic
1195202661 X:102565313-102565335 GAGGCAGGAAGGGGAAGGCAGGG - Intergenic
1195305134 X:103574445-103574467 GAAGCCATGAGGGGCAGGGCTGG - Intergenic
1195567186 X:106354648-106354670 GAAGCAAGAGAGAGAAGGGAGGG - Intergenic
1195605434 X:106801242-106801264 GAAGTAAAAAGGGGAAGGAAAGG + Intergenic
1195802866 X:108733331-108733353 GTAGCACTGAGGGGAAGGGGAGG + Exonic
1196797087 X:119511069-119511091 GAAGCAGCAAGGGGAAGGAGGGG - Intergenic
1198448229 X:136739898-136739920 GAAGCCAAAAGGGCAACGGAAGG + Intronic
1199090358 X:143684376-143684398 AAAGGAAGAAGGGCAAGGGAAGG + Intergenic
1199317060 X:146393478-146393500 GAAGGAATGGGGGGGAGGGAGGG - Intergenic
1199493136 X:148423235-148423257 GAAGAGATGAAGGGAAGGGAGGG + Intergenic
1199855549 X:151756255-151756277 GAAGCAAAAGGGGGAGAGGAGGG - Intergenic
1200121127 X:153791112-153791134 GAAGCAAAAAAGAGGAGGGAGGG - Intronic
1200475052 Y:3632768-3632790 GGAGGAAAAAGGGGAAAGGAAGG - Intergenic
1200546651 Y:4526727-4526749 GAAGCATTAAGGGGAAATGTAGG + Intergenic
1201114907 Y:10828049-10828071 GAAGAAATAATGGAAAGGAAAGG - Intergenic
1201480423 Y:14432722-14432744 GAAGGAGGGAGGGGAAGGGAGGG + Intergenic