ID: 933215831

View in Genome Browser
Species Human (GRCh38)
Location 2:79629093-79629115
Sequence AGGGGAAGCAATAAGGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 687
Summary {0: 1, 1: 0, 2: 9, 3: 79, 4: 598}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933215831_933215841 4 Left 933215831 2:79629093-79629115 CCCTTCCCCTTATTGCTTCCCCT 0: 1
1: 0
2: 9
3: 79
4: 598
Right 933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
933215831_933215836 -7 Left 933215831 2:79629093-79629115 CCCTTCCCCTTATTGCTTCCCCT 0: 1
1: 0
2: 9
3: 79
4: 598
Right 933215836 2:79629109-79629131 TTCCCCTATGCCAGCCATATTGG 0: 1
1: 0
2: 2
3: 7
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933215831 Original CRISPR AGGGGAAGCAATAAGGGGAA GGG (reversed) Intronic
900088275 1:908790-908812 AGGGGAGGGAATGAGGGGCAGGG + Intergenic
900474372 1:2869346-2869368 AGTGGGAGCACTGAGGGGAAGGG + Intergenic
900720489 1:4172640-4172662 AGGGGGAGCACTAAGGGGTGCGG + Intergenic
900751797 1:4402468-4402490 AGGGGAAAAAATAAAAGGAAAGG - Intergenic
901658640 1:10785176-10785198 AAGGGAAGGAATGAGAGGAAGGG - Intronic
902204319 1:14856207-14856229 AGGGGATGAAAAGAGGGGAAGGG + Intronic
903009914 1:20322408-20322430 AGGGGGAGAAGCAAGGGGAAGGG + Intronic
903808280 1:26020813-26020835 AGGGGAGGCACGCAGGGGAAAGG + Intronic
904136334 1:28315471-28315493 AGGAGAAGCAGTATGGCGAAGGG - Intergenic
904408052 1:30306608-30306630 AGTGGAAGGGAGAAGGGGAAGGG - Intergenic
905256630 1:36688991-36689013 AGGGGAAGGAATATGGGAAGGGG + Intergenic
905622157 1:39457660-39457682 AGAGGATGCAATCAGAGGAATGG - Intronic
905713670 1:40129530-40129552 AGAGTGAGCAATAAGGGGAGTGG + Intergenic
905997460 1:42393665-42393687 GTAGGAAGAAATAAGGGGAAAGG + Intronic
906217446 1:44051623-44051645 AGGGGAAACAATCAGGGAAAAGG - Intergenic
906553381 1:46686229-46686251 AGGGGAAGGTACAAGGTGAAGGG + Intronic
907748673 1:57240923-57240945 AGGAGATGCAAGAAGGGGAGAGG - Intronic
908082814 1:60598648-60598670 AGGGAAAGGAAAAAAGGGAAGGG + Intergenic
908285823 1:62599310-62599332 AGAGGAAACAACAAGGGCAAAGG - Intronic
908353161 1:63306232-63306254 AGGAGAAGGAGGAAGGGGAAGGG + Intergenic
908657698 1:66405386-66405408 AGGGGAAGCAATGACAGGAGGGG - Intergenic
909284578 1:73798747-73798769 AGGAAAAGCAAGAAAGGGAAGGG + Intergenic
910068134 1:83178358-83178380 AGGGGAAGGAAGATGGGGAATGG + Intergenic
910173535 1:84403522-84403544 AGCAGAAGGAAGAAGGGGAAGGG + Intronic
910286117 1:85556134-85556156 AGGAGAAGGAGGAAGGGGAAAGG - Intronic
912249639 1:107997523-107997545 TGGGGAAGCAATTAAGGTAATGG + Intergenic
912381019 1:109248417-109248439 AGGGGATTGAATAAGGTGAATGG - Intergenic
912393868 1:109324434-109324456 ATGCTAAGAAATAAGGGGAATGG - Intronic
912476431 1:109939595-109939617 AGGGAAAGAGATGAGGGGAAGGG - Intergenic
912489178 1:110052212-110052234 AGGGGAAGAAATTAGAGGCAGGG - Intronic
912523833 1:110266145-110266167 AGGGGGAGAAATAATGGGCAGGG + Intronic
913065834 1:115253854-115253876 AGGGTCAGGGATAAGGGGAAAGG + Intergenic
914046219 1:144095306-144095328 AAAGGAAGAAATAAAGGGAAGGG + Intergenic
914131891 1:144865379-144865401 AAAGGAAGAAATAAAGGGAAGGG - Intergenic
914811949 1:151035455-151035477 TGGGGTAGGAAAAAGGGGAAAGG - Exonic
914830156 1:151165357-151165379 AGGGGAAGAGAGAGGGGGAAAGG - Exonic
914904734 1:151734599-151734621 AGGGGAAGCAGGTAGGGGCAGGG + Intergenic
914934653 1:151968062-151968084 AAGCAAAGCAATAAAGGGAAGGG - Intergenic
915493855 1:156267239-156267261 ATGGGAGGCAGTAAGGAGAAGGG + Intronic
915970242 1:160349832-160349854 AGGGGAAGCAGGAGAGGGAAGGG - Intronic
917538802 1:175893978-175894000 AGGGGAAGGGAGAAGAGGAAGGG - Intergenic
918289315 1:183091491-183091513 AGGGGAAGGAGGAAGAGGAAGGG - Intronic
918637673 1:186797815-186797837 AGAGGAAACAGTAAGTGGAATGG + Intergenic
918894138 1:190317705-190317727 AGGGGAAACAATACGGGTAAAGG - Intronic
919044357 1:192431685-192431707 AGAGAAAGCAAGCAGGGGAAAGG - Intergenic
919796672 1:201325221-201325243 AGGGGAAGCACCAAGGGCAGGGG + Intronic
920330238 1:205202090-205202112 AGGGGAAGGGAGAGGGGGAAGGG + Intronic
920330243 1:205202103-205202125 GGGGGAAGGGAGAAGGGGAAGGG + Intronic
921534772 1:216332959-216332981 AGGGGAAGAAAAATGGGCAATGG + Intronic
921945528 1:220883639-220883661 ATGGGAAGCAGAAAGGGAAAGGG - Intronic
923252676 1:232191852-232191874 AGGGGAAGCCAGAAGGGGGATGG - Intergenic
923686055 1:236154549-236154571 AGGGGAAGCTATGTGGGTAACGG - Intronic
924294427 1:242570906-242570928 AGAGGAAGCAAGAAGGGAGAAGG + Intergenic
924721486 1:246627132-246627154 AGAGAAAGCACTAAGTGGAAGGG - Intronic
1062945468 10:1457973-1457995 AGGGTAAGCAATGAGGCAAATGG - Intronic
1064125781 10:12658790-12658812 AGGGGAGGCCAGAAGGGGAATGG - Intronic
1064371272 10:14753622-14753644 TGGGAAGGAAATAAGGGGAAAGG + Intronic
1065187401 10:23181805-23181827 AGGGGAAGCAAGATGGGAACTGG + Intergenic
1065203079 10:23331699-23331721 GGGGGAAGGGAAAAGGGGAAGGG + Intronic
1065204033 10:23341572-23341594 ATGGGAAGCCATGAGGGGATTGG - Intronic
1065217102 10:23459724-23459746 AGAGGAAGCAATAGAGGGGAGGG - Intergenic
1065696831 10:28388121-28388143 AGGGGAAGGTGGAAGGGGAAAGG + Intergenic
1066250811 10:33631118-33631140 AGAGAAAGCAATGAGGGCAATGG + Intergenic
1066259633 10:33716647-33716669 AGGGGAAGAAGAAAGAGGAAGGG - Intergenic
1066746460 10:38606487-38606509 AGGGGAAGGAAAATGGGGCAGGG + Intergenic
1068269173 10:54697659-54697681 AGGGGAAGGGGGAAGGGGAAGGG + Intronic
1068638811 10:59378748-59378770 AGGGGAAGGAGGAAGGAGAAAGG - Intergenic
1068782756 10:60939463-60939485 AGGGGAAGCTTTTAAGGGAAGGG - Intronic
1068788036 10:60998623-60998645 AGGGGGTGGAAAAAGGGGAAGGG + Intronic
1068846425 10:61680868-61680890 CAGGGAAGAAAGAAGGGGAAGGG + Intronic
1069513222 10:69057437-69057459 CAGGGAGACAATAAGGGGAAGGG - Intergenic
1070273864 10:74985594-74985616 AGGGAAGGCAACAAGGAGAAAGG - Intronic
1070501304 10:77075225-77075247 AGAGGAAGGAATAAAGGGTAGGG - Intronic
1070938931 10:80325911-80325933 TGGGCAAGAAATAAGAGGAATGG + Intergenic
1071941794 10:90598875-90598897 AGAGAAAGCAATAATGGGAAGGG + Intergenic
1072282239 10:93877253-93877275 AGGGGGTGCACTAATGGGAAGGG + Intergenic
1073028016 10:100502491-100502513 AGGAAAAGCAAGAAGGGTAAAGG + Intronic
1073114055 10:101080999-101081021 AGAGGGAGGAATAAGAGGAAGGG + Intergenic
1073282184 10:102362738-102362760 AGGGGAAGTGATATGGGGACAGG - Intronic
1073358298 10:102874782-102874804 AGGGGTGGCAAAAGGGGGAAGGG + Intronic
1073531249 10:104233614-104233636 AGGGAAAGGAAGAAGGGTAAGGG - Intergenic
1073592188 10:104767788-104767810 AGGGGAAGGGAGAAGGGAAAAGG - Intronic
1073764313 10:106665350-106665372 AAGGGAAGGAAGAAGGAGAAAGG - Intronic
1074764560 10:116691199-116691221 AGGGGAAGCAGCCTGGGGAAGGG + Intronic
1075221277 10:120587049-120587071 AGGGGAAGGCATGAGGAGAAGGG + Intronic
1075284477 10:121171767-121171789 AGGGGAAGGAAGAAGGGGAAGGG + Intergenic
1075284483 10:121171785-121171807 AAGGGAAGGCAGAAGGGGAAGGG + Intergenic
1075284490 10:121171803-121171825 AAGGGAAGGGAGAAGGGGAAGGG + Intergenic
1075284497 10:121171821-121171843 AAGGGAAGGGAGAAGGGGAAGGG + Intergenic
1075284504 10:121171839-121171861 AAGGGAAGGGAGAAGGGGAAGGG + Intergenic
1075516280 10:123111086-123111108 AGGGGAAGCAAACACGGGGAAGG - Intergenic
1075585434 10:123653789-123653811 AGGGGAAGGGAGAAGGGGGAAGG + Intergenic
1075634722 10:124022741-124022763 AGGGGAAACATCAAGGGGGAAGG - Intronic
1076004817 10:126940025-126940047 AGGAGAAGCAAGAAGGAGAAGGG + Intronic
1078326178 11:10383018-10383040 TGAGGAAGCAATAAGGAAAAAGG + Intronic
1078446659 11:11409756-11409778 CGGGGAACTAATAAGGGGACTGG + Intronic
1081159036 11:39731477-39731499 AGGGGAAGCATCATGGGAAAGGG - Intergenic
1081933272 11:46887324-46887346 AGGGGAAGCTGTCAGGGGACAGG + Intronic
1082068582 11:47920427-47920449 AGGGGTAGTAGTAATGGGAATGG - Intergenic
1082196801 11:49316258-49316280 AGGGGAAGGGGTAAGGGGAAGGG + Intergenic
1082630000 11:55530567-55530589 AAGTGAAGCATTAAGGAGAAAGG + Intergenic
1083310352 11:61780686-61780708 AGGGGCAGCAAAAAGGCAAAGGG - Intronic
1083551051 11:63590471-63590493 AGGATAAGCAACAAGTGGAAGGG + Intronic
1084089790 11:66871912-66871934 AGGAGAAGCAGAAAGGGGAGTGG + Intronic
1084719573 11:70895561-70895583 AGGGGTACTAAAAAGGGGAATGG + Intronic
1085014112 11:73161297-73161319 AGGGGTAGGAGGAAGGGGAATGG - Intergenic
1085465083 11:76717561-76717583 AGGGGAAGCAGCAAGTGCAAAGG - Intergenic
1085745810 11:79113243-79113265 AGGAGAAGCAAGAGAGGGAAGGG + Intronic
1085755355 11:79197267-79197289 AGGGGAGACAATGAAGGGAAAGG + Intronic
1086227123 11:84525599-84525621 AGTGGAAGGAATAATTGGAAAGG - Intronic
1086670065 11:89535561-89535583 AGGGAAAGCAAAAAGCAGAAAGG - Intergenic
1087782860 11:102319445-102319467 AGTTGAAGCAATGAGGGGATGGG + Intronic
1087883015 11:103441210-103441232 AGAGGAAGCAGCAAGGGTAAAGG - Intronic
1088350901 11:108886125-108886147 AGGGGAGGGGATAAGGGGAAGGG + Intronic
1088412890 11:109555022-109555044 AGGAGAAGGAAGAAGGGGACTGG + Intergenic
1088736150 11:112729289-112729311 AGGAGAAGAAAGGAGGGGAAAGG + Intergenic
1088970997 11:114774709-114774731 TGGGGAAGGAAAAAGGGAAAGGG - Intergenic
1089593767 11:119561553-119561575 AGGGGAAGGAAAAAGAGGAAGGG - Intergenic
1090273029 11:125401096-125401118 AGGGGAAGCCAAAGGAGGAAAGG + Intronic
1090606124 11:128424553-128424575 AGGGGCAGCACCAGGGGGAAGGG + Intergenic
1090703225 11:129314788-129314810 AGGGGAAGGGGGAAGGGGAAGGG - Intergenic
1090834720 11:130446014-130446036 AGGGGGAGCACTAAGTGGGAGGG + Intergenic
1090949926 11:131464365-131464387 GGGGGCAGCAACAAGGGAAAGGG + Intronic
1091077516 11:132634050-132634072 AGCAGAAGCAAAAAGGGAAAGGG + Intronic
1091192653 11:133707596-133707618 AAGGGAAGAAAAAAGGGGAAGGG + Intergenic
1091493565 12:952952-952974 GGGGGAAGGGAAAAGGGGAAGGG + Intronic
1091635623 12:2194371-2194393 AGGGGGAGCAGGAAGGGGAAGGG - Intronic
1091742940 12:2973004-2973026 AGGGGATGCCAAGAGGGGAAGGG - Intronic
1092166820 12:6347725-6347747 AGGGGAAGCAAGATGGGTAAGGG - Exonic
1092324360 12:7513692-7513714 AGAGGAATAAATAAAGGGAATGG + Intergenic
1092405224 12:8217106-8217128 AGAGGAAGCAACAAGGGTAATGG + Intergenic
1092974338 12:13729805-13729827 AGAGGAAGCCATATGGGGAGGGG + Intronic
1092998965 12:13977873-13977895 TGGGGAAGCTATAAAGGGAAAGG - Intronic
1093832378 12:23778425-23778447 AGGTGAAGAAATAAGGAAAAAGG + Intronic
1094516154 12:31129054-31129076 AGGGGAAAAAAGGAGGGGAAAGG + Intergenic
1095169476 12:39017432-39017454 AGGGCAACCAAAAAGGTGAAAGG - Intergenic
1095223649 12:39651879-39651901 ATGTGAAGCAATAGGGAGAAGGG - Intronic
1096233247 12:49909313-49909335 AGGGGCATCAAAAAGGGCAAAGG + Intergenic
1096786999 12:54022675-54022697 AGGGGGAGAAAGAGGGGGAAAGG + Intronic
1098547969 12:71731965-71731987 TGGGGGAGCAAGAAGGGGGATGG - Intergenic
1099601103 12:84738825-84738847 AGGAGAAGCAGTAAAGCGAAGGG - Intergenic
1099989830 12:89709596-89709618 AGGGGAAGGAAGAAAGGGAGGGG - Intergenic
1100402521 12:94244902-94244924 AGGGGAAGAAAGAATGGGGAAGG - Intronic
1100593378 12:96050531-96050553 AGGGGACTCCAAAAGGGGAAAGG + Intergenic
1101165614 12:102028650-102028672 AGGGGAAGCAATGCGTGGGAAGG + Intronic
1101582153 12:106051002-106051024 AGGGTGAGGAATGAGGGGAAGGG + Intergenic
1102408786 12:112698891-112698913 AGGGGGAGGAGGAAGGGGAAAGG - Intronic
1102423438 12:112822150-112822172 AGGGGAAGAGACAAGGGGCAAGG + Intronic
1102527684 12:113523696-113523718 AGGGGGAGCAGCAAGGGCAAAGG - Intergenic
1103050605 12:117776162-117776184 AGGGGAAGGAATATGGGGTTGGG - Intronic
1103582406 12:121925075-121925097 AGGTGAGGCAAGAAGGGGAAGGG - Intronic
1103893135 12:124254804-124254826 AGAGGAAGCAATTAGGGAGACGG + Intronic
1104001694 12:124864176-124864198 AGGGGTAGGAGAAAGGGGAAGGG - Intronic
1105341425 13:19529624-19529646 AGGAGAAGAAAGTAGGGGAAGGG - Intronic
1105595158 13:21830613-21830635 AGGGGGAGGGAGAAGGGGAAAGG - Intergenic
1105710584 13:23005107-23005129 AGCTGAAGCAATAAAGGGGATGG + Intergenic
1105730911 13:23214421-23214443 AGGGAAAGCAATATGTGGGAAGG + Intronic
1105775438 13:23655047-23655069 AGGGGATGCAATGTGGGGAGAGG + Intronic
1106027487 13:25968726-25968748 ACAGGAAGGAATAAGGGAAAAGG - Intronic
1107115094 13:36738338-36738360 AAGCGAAGCAATGAGGGGAATGG + Intergenic
1107562022 13:41565786-41565808 AGGGGAAGGATGATGGGGAAAGG - Intergenic
1107819906 13:44277169-44277191 AGGGAAGGAAAGAAGGGGAAGGG + Intergenic
1107828614 13:44353609-44353631 TGGGGAAGGAAGAAGTGGAATGG + Intergenic
1109074264 13:57813946-57813968 AGAGGAAGCAAAAAGTGAAAAGG - Intergenic
1109267435 13:60217423-60217445 AAGGGAAGAAATCATGGGAAAGG - Intergenic
1109778578 13:67077306-67077328 AAAGGAATCAATAAGGGCAAAGG - Intronic
1110303494 13:73956947-73956969 AAGGGAAGGAAAAAAGGGAAAGG + Intronic
1110873979 13:80487126-80487148 AGGGGTAGCATTAGAGGGAAAGG + Intergenic
1110916906 13:81031716-81031738 AGGGGAAGCAAGAGAGTGAAGGG + Intergenic
1110964515 13:81676151-81676173 TGGGGAAGCCAGAAGGGGGATGG + Intergenic
1111564752 13:90000117-90000139 AGTGGAAGCAATAAAAGGCAGGG + Intergenic
1111600956 13:90473401-90473423 AGAGGTAGCAATTAGGGGGAAGG - Intergenic
1113955598 13:114098633-114098655 AGGGGAGGCAGGAAGGGCAAGGG + Intronic
1114464665 14:22913077-22913099 AGGGATAGAAGTAAGGGGAAGGG + Intronic
1114623623 14:24114430-24114452 AGGGGAAGCAGTGGGGAGAAAGG + Intronic
1114764243 14:25352124-25352146 AGGGGAAGCAAGAGAGAGAAAGG + Intergenic
1114924899 14:27384133-27384155 GGGGGAAGCGAGAAGGGGGATGG + Intergenic
1115498167 14:34027186-34027208 AGGGGGAGGAGGAAGGGGAAGGG + Intronic
1115802049 14:37005389-37005411 GAGGGAATCAATAAGGGAAACGG - Intronic
1116290275 14:43026386-43026408 AGAGGAAGCAAGAGTGGGAAGGG - Intergenic
1116443007 14:44976201-44976223 TGTGGAAGCAGTAAGGGGAAAGG - Intronic
1116752881 14:48909095-48909117 AGGGGAAGAAAGAAGGAGAAAGG - Intergenic
1117830323 14:59743714-59743736 AGGGGAAACAAAGAGGTGAAGGG - Intronic
1117927548 14:60799507-60799529 TGGTCAAGCAATAAAGGGAAAGG + Intronic
1118350436 14:64969849-64969871 AGGGGAAGGGACAAGGAGAAGGG + Intronic
1118464435 14:66017769-66017791 AAGGGATGGAATAAGTGGAAAGG - Intergenic
1118588258 14:67377684-67377706 AGTAAAAGCAATAAAGGGAAAGG - Intronic
1118667445 14:68086154-68086176 GGGGGAAGCCAGAAGGGGAATGG + Intronic
1118825779 14:69379719-69379741 TAGGGAAGCTATAAGGGCAAGGG - Intergenic
1119283617 14:73431879-73431901 GGAGTAAGAAATAAGGGGAAGGG + Intronic
1119288750 14:73477460-73477482 AGGGGAAGAAAAAAGGGGAGAGG + Intergenic
1119768202 14:77203994-77204016 AGAGGAAGCAGTCAGGGGAGAGG + Intronic
1119950167 14:78737037-78737059 AAGGGAAGGAGGAAGGGGAAAGG - Intronic
1119997651 14:79271382-79271404 AGGGGAAGGAAGAAGGAGGAAGG - Intronic
1120024468 14:79567386-79567408 ATGGGAAACAAAATGGGGAAGGG + Intronic
1120441882 14:84551721-84551743 AGGGGAAGCAAACATGAGAATGG - Intergenic
1121369010 14:93339937-93339959 ACGGGAAGTAATAAGGAGAATGG + Intronic
1121593336 14:95137401-95137423 AAGGGAAAGAAAAAGGGGAAGGG + Intronic
1121593377 14:95137531-95137553 AAGGGAAAGAAAAAGGGGAAGGG + Intronic
1121630507 14:95418568-95418590 AGGGGGAGGAAAAAGAGGAAAGG - Intronic
1122058836 14:99123281-99123303 AGGGGAAGAGGGAAGGGGAAGGG - Intergenic
1122647932 14:103207385-103207407 AGGGGAAGGAGGAAGGGGAAGGG - Intergenic
1123068651 14:105630432-105630454 AGGGGAAGGGGTAAGGGGCAGGG + Intergenic
1124178705 15:27452677-27452699 AGGGGGAGGAAGAAGAGGAAGGG + Intronic
1124460203 15:29882907-29882929 AGGGGCAGCAAGAAGACGAAGGG - Intronic
1124647672 15:31450433-31450455 AAGGGAAGGAAGACGGGGAAGGG + Intergenic
1125004324 15:34800146-34800168 AGGGGAAGGAGGAAGGGGCACGG + Intergenic
1125094726 15:35838127-35838149 AAGGGAAGCCATAATGAGAAGGG + Intergenic
1125202384 15:37111368-37111390 AGAGGAAGAAATGTGGGGAAGGG - Intergenic
1126145473 15:45469368-45469390 AGGGGAATGAATAAGGGCAGGGG - Intergenic
1126411126 15:48374174-48374196 AGGTGAAGCAATCAGAGGATTGG - Intergenic
1127591099 15:60424385-60424407 AGGGGAAGAAAAAACTGGAAGGG + Intronic
1127940393 15:63689434-63689456 AGGGGAGGGAATCAGTGGAAAGG + Intronic
1128522872 15:68387003-68387025 AGGGGAAGGAAGAACGAGAAGGG + Intronic
1128551825 15:68602660-68602682 AGGGGGGGCAATAAACGGAAGGG - Intronic
1128617488 15:69121592-69121614 AGGGGGAGAAAAAAGGGAAAGGG - Intergenic
1129031150 15:72618761-72618783 AGGGGAGGAGAGAAGGGGAAAGG + Intergenic
1129044965 15:72725941-72725963 AGGGAAAGGAGGAAGGGGAAAGG - Intronic
1129686666 15:77689870-77689892 GGGGGAAGCAAGAAGGGGAAGGG + Intronic
1130161748 15:81408175-81408197 GGTGGAAGCAAAAAGGAGAAGGG + Intergenic
1130216343 15:81973862-81973884 AGAGGAAGAAAGACGGGGAAGGG + Intergenic
1130248502 15:82277199-82277221 AAGGCAAGAAATAAGGGGTATGG + Intronic
1130391813 15:83463067-83463089 CAGGGAAGCATGAAGGGGAAGGG + Intronic
1131939722 15:97547602-97547624 AGAGGAAGCAACAAGGGAAACGG + Intergenic
1132257194 15:100385896-100385918 AGTGGAAGCAATGTGGGGAAGGG + Intergenic
1133102062 16:3485725-3485747 AGGGGGCGCAATAAAGGGAATGG + Exonic
1133344032 16:5058435-5058457 AGGGGAAGGAAAAAGGAAAAGGG - Intronic
1134770604 16:16806049-16806071 AGGGGAAGGAGAAGGGGGAAGGG - Intergenic
1135081450 16:19439691-19439713 AGAGGAAGCAAGATGGAGAAAGG + Intronic
1135794512 16:25428440-25428462 AGAGCAAGCAATAAGGGAATGGG - Intergenic
1135992392 16:27225908-27225930 CGGGGAAGCCACAAGGGAAATGG + Intronic
1136574255 16:31113874-31113896 AGGGGAAGTAGGAAGGGGAAGGG + Intergenic
1136736601 16:32473155-32473177 AGGGGAAGGAAAATGGGGCAGGG - Intergenic
1137968673 16:52961961-52961983 AGGGGAAGGAAGAAAGGGACTGG - Intergenic
1138931428 16:61662300-61662322 AGCGGAAGCTATAAGGGGAGAGG - Intronic
1139413905 16:66790253-66790275 AAGGGAAGGAAAAAGGGGAGGGG + Intronic
1140661780 16:77195730-77195752 AGGGGATACAATATAGGGAAAGG - Intronic
1141146351 16:81532949-81532971 AGAGGAAGCAGTCAGGGCAAAGG - Intronic
1141890302 16:86922073-86922095 TGGGGAAGGAGGAAGGGGAAGGG + Intergenic
1203016467 16_KI270728v1_random:356422-356444 AGGGGAAGGAAAATGGGGCAGGG + Intergenic
1203034802 16_KI270728v1_random:629580-629602 AGGGGAAGGAAAATGGGGCAGGG + Intergenic
1143595771 17:7912638-7912660 AGGGGCAGCAAGAAAGTGAAGGG - Exonic
1144594042 17:16551158-16551180 AGGGGAAGTAAAACAGGGAAGGG + Intergenic
1144620701 17:16816680-16816702 AGGAGAAGGAAAAAGGGGAGGGG + Intergenic
1144884941 17:18451467-18451489 AGGAGAAGGAAAAAGGGGAGGGG - Intergenic
1145147280 17:20492910-20492932 AGGAGAAGGAAAAAGGGGAGGGG + Intergenic
1146930104 17:36770891-36770913 AGGGGAAGGTTGAAGGGGAAGGG - Intergenic
1147760543 17:42795148-42795170 AGGGGAAGGAAGAAGTGGAGGGG - Exonic
1147869581 17:43578051-43578073 AGGGGAAGCAGAAAGAAGAAAGG + Intronic
1148061973 17:44842913-44842935 AGGGGAAGGGATGGGGGGAAGGG - Intergenic
1148064109 17:44856173-44856195 AGGTGGAGCAAAAAGGGCAAAGG + Intronic
1148677198 17:49452312-49452334 AGGGGAAGCAGGAAGGGCAGGGG - Intronic
1149466570 17:56884533-56884555 AGGTGAGGCAGTATGGGGAAAGG + Intergenic
1149637751 17:58184306-58184328 AGGGGAAGCAGGAAAGGGGAAGG - Intergenic
1150146432 17:62773489-62773511 AGGGGAAGAAATAAGTGGAGGGG + Intronic
1150345031 17:64398071-64398093 AGGGGAAGAAGTGAGGAGAAAGG - Intronic
1150597635 17:66620390-66620412 AGGGGAAGCAATAAGTGGGAGGG + Intronic
1150947610 17:69765399-69765421 AGGGGAGGGAAGAAGGGGGAGGG - Intergenic
1150947659 17:69765528-69765550 AGGGGAGGGAAGAAGGGGGAAGG - Intergenic
1151116751 17:71744200-71744222 AGAGGCAGCAAAAAGGGGAATGG - Intergenic
1151326011 17:73380169-73380191 AGGGGAAGGAAGCAGGGGCAGGG - Intronic
1151884513 17:76915788-76915810 AGGGGAAGGAAAAAGGAGACAGG - Intronic
1151999637 17:77637328-77637350 AGGGGAAGAGATGAGGGGGAGGG - Intergenic
1152719333 17:81915180-81915202 AAGGGAATCACAAAGGGGAAAGG + Intronic
1153703211 18:7717414-7717436 AGGGGAGACAAAAAGGGGATGGG - Intronic
1154144924 18:11859551-11859573 AGGGGAAGGAACAAAGGGAAGGG - Intronic
1154295899 18:13147417-13147439 AGAGGAAGCAAGAAGGCAAAGGG - Intergenic
1156700513 18:39819113-39819135 AGGGGAAGAAAGGAAGGGAAAGG + Intergenic
1157230308 18:45909596-45909618 AGGGGAAGGAATAGTGTGAAAGG + Intronic
1157422680 18:47559573-47559595 AGGGGAAGGAGAAAGGGGAAGGG - Intergenic
1158076603 18:53537122-53537144 AGGAGAAACCATTAGGGGAAGGG - Intergenic
1158186739 18:54780014-54780036 TGGGGAAGCAGTCAGGAGAAGGG - Intronic
1158951516 18:62499578-62499600 AGAGGAAGGAAGAAGGGGGAAGG - Intergenic
1159252332 18:65895758-65895780 AGCAGAAGGAATAAAGGGAAAGG - Intergenic
1159485666 18:69053439-69053461 AGGGGAGGCAAGAGGGGAAATGG + Intronic
1159529686 18:69639722-69639744 TGGGGAGGAAATAAGGGGAAAGG + Intronic
1159576328 18:70182508-70182530 AGGGGAAGGAAGAAAGGGAGAGG + Intronic
1160255766 18:77247503-77247525 AGCGGAAGCAAGAGAGGGAAGGG + Intergenic
1162376024 19:10305746-10305768 TGGGGAAGCAAGATGGAGAAGGG + Intronic
1162581597 19:11534570-11534592 AGAAGAAGAAATAAGGAGAAGGG + Intergenic
1162828598 19:13269992-13270014 AGGGGAAGGGAATAGGGGAAGGG - Intronic
1162873698 19:13604785-13604807 AAGGGAAGGAGGAAGGGGAAGGG + Intronic
1164680551 19:30131188-30131210 AGGGGAAGGGAGAAGGGGAGGGG - Intergenic
1165189368 19:34049502-34049524 AGGGGAAGAAGGGAGGGGAACGG + Intergenic
1167100109 19:47399389-47399411 GGGGGAAGGAATATGGGGGAGGG - Intergenic
1167226364 19:48244285-48244307 AATGAAAGCAATAAGGTGAACGG + Intronic
1167227643 19:48258697-48258719 AATGAAAGCAATAAGGTGAACGG - Intronic
1168214707 19:54917038-54917060 TGGGGGAGCAATAATGAGAAGGG - Intergenic
1202685772 1_KI270712v1_random:48721-48743 AAAGGAAGAAATAAAGGGAAGGG + Intergenic
925186579 2:1850792-1850814 ACGGGAAGCACCAAGGAGAAGGG - Intronic
925684000 2:6453089-6453111 AGGGAAGGGAAGAAGGGGAAGGG + Intergenic
926385725 2:12334031-12334053 AGGGGAAAGAATGATGGGAAAGG - Intergenic
926832465 2:16978633-16978655 AGAGCAAGAGATAAGGGGAAAGG + Intergenic
927791009 2:26009487-26009509 AGGGGAAGCAATATGTGGAAAGG - Intergenic
928334830 2:30388766-30388788 ATAGGAATCATTAAGGGGAAAGG + Intergenic
928361165 2:30663412-30663434 AGGGGAAGCACAAAGTGGAGCGG + Intergenic
928814009 2:35267557-35267579 GGGGAAAGCAAGCAGGGGAAAGG - Intergenic
929250083 2:39743653-39743675 AGAGGAAGCAAGAGGGAGAAGGG - Intronic
929362151 2:41104531-41104553 AAGGGAAGGAAGAAGGAGAAGGG + Intergenic
929478182 2:42274825-42274847 AGGGCAAGCATTAGGAGGAATGG + Intronic
930007630 2:46910682-46910704 ATGGGAAGCAATACTGGTAATGG - Intronic
931179372 2:59884371-59884393 AGAGGAAACAACACGGGGAAGGG - Intergenic
931208145 2:60167356-60167378 AGAGGAAGCAAAAAGGGGCCAGG - Intergenic
931316835 2:61140855-61140877 AGAGGAAGGAATAGGTGGAAGGG + Intergenic
931594094 2:63921965-63921987 AGTGGAAGCAAGAAGAGGGAAGG + Intronic
931847168 2:66216263-66216285 AAGTGAAGCAATGAGGAGAAAGG - Intergenic
931978248 2:67666686-67666708 AGGGAGAGTAAGAAGGGGAAGGG + Intergenic
931984737 2:67730630-67730652 AGGGAAAGCAATAAGGGATAGGG + Intergenic
933171670 2:79132311-79132333 AGGGGAAGCAAAATGGGAAGGGG - Intergenic
933215831 2:79629093-79629115 AGGGGAAGCAATAAGGGGAAGGG - Intronic
933942854 2:87259620-87259642 AGGGGAAGCACAGAGGGAAAGGG + Intergenic
934088925 2:88534194-88534216 AGGGGAAGCAAAATAGGGAGAGG - Intergenic
934187755 2:89762272-89762294 AGGGGAAGGAAAATGGGGCAGGG - Intergenic
934245952 2:90306103-90306125 AAAGGAAGAAATAAAGGGAAGGG - Intergenic
934262794 2:91490932-91490954 AAAGGAAGAAATAAAGGGAAGGG + Intergenic
934308862 2:91845676-91845698 AGGGGAAGGAAAATGGGGCAGGG + Intergenic
935281897 2:101525659-101525681 AGAGGAAGCAGCAAGGGCAAAGG + Intergenic
936337365 2:111601942-111601964 AGGGGAAGCACAGAGGGAAAGGG - Intergenic
937275040 2:120678933-120678955 AGGGGAGGGTATAAGGGGCATGG - Intergenic
937328424 2:121006207-121006229 AGCGGAGGCAATAAAGGGCACGG - Intergenic
937688523 2:124725464-124725486 GGGGGAAGGAGGAAGGGGAAGGG - Intronic
937942947 2:127302400-127302422 ATGGGAAGGAAGAAGGGGAAAGG - Exonic
938893026 2:135724307-135724329 AGGGGAACCATAAAGGCGAAGGG - Exonic
939174550 2:138734504-138734526 AGGGAAAGCTTTAAGGAGAAGGG + Intronic
939464541 2:142540747-142540769 AGGGCAAAAAATAAAGGGAATGG - Intergenic
939734010 2:145820863-145820885 AGGGGAAGCAGAAAGTGCAAAGG - Intergenic
940457461 2:153918730-153918752 AGAGGAAGGAATCAGGAGAAAGG - Intronic
940910283 2:159204270-159204292 AGGGGGAGCAGTAAGGGGCCTGG + Intronic
941038257 2:160590660-160590682 AGGGGAAGGGAGGAGGGGAAGGG - Intergenic
941038263 2:160590673-160590695 AGGGGAAGGGAGGAGGGGAAGGG - Intergenic
941038272 2:160590692-160590714 AGGGGAAGGGAGGAGGGGAAGGG - Intergenic
941038281 2:160590711-160590733 AGGGGAAGGGAGGAGGGGAAGGG - Intergenic
941125202 2:161576317-161576339 TGGGGAGGCCAGAAGGGGAATGG - Intronic
941901839 2:170686339-170686361 AGGGGAAGAAAGGAGGGGAGGGG + Intergenic
942197705 2:173538076-173538098 AGGGAAGTCAAAAAGGGGAAAGG - Intergenic
942309772 2:174645034-174645056 AGGGGAAGGAATAGGGATAAAGG + Intronic
942482300 2:176402827-176402849 GGGGGAAGTAAGAAAGGGAAGGG - Intergenic
942482310 2:176402855-176402877 GGGGGAAGGAAGAAAGGGAAGGG - Intergenic
942812558 2:180016089-180016111 AGGGGAAGGAAGTAGGGTAAGGG + Intergenic
943003406 2:182358942-182358964 AAGGGAAGGAAGAAAGGGAATGG - Intronic
943287976 2:186029253-186029275 AAGGGAAGCAAAAGGGGAAAGGG + Intergenic
943442654 2:187945060-187945082 GGGGGAAGCAAGAAGGGCAAAGG - Intergenic
943444726 2:187970554-187970576 AGGGGAAGCAAGAAAGAGAGAGG + Intergenic
944154860 2:196598209-196598231 AGGGGAAGGGAGGAGGGGAAGGG + Intergenic
944154900 2:196598290-196598312 AGGGGAAGGGAGGAGGGGAAGGG + Intergenic
944533330 2:200685631-200685653 AGGGGAATCAATGAGAGGAATGG - Intergenic
945459976 2:210094925-210094947 ATGAGAAGGAATAAGGGAAAAGG + Intronic
945616809 2:212080790-212080812 TGGGGAAGGAATCAGTGGAAAGG - Intronic
945762831 2:213935457-213935479 ATGGGAAGAAAGAAGGGGCAAGG - Intronic
946310161 2:218878896-218878918 AGGGTAAGCGGTAAGGGTAAGGG - Intergenic
946395004 2:219439223-219439245 AGGGTAAGCAGTGATGGGAACGG - Intronic
946530994 2:220570287-220570309 TGGGGAGGAAATAAGGGAAATGG - Intergenic
946555852 2:220856234-220856256 AAGGAAAGCACGAAGGGGAAAGG - Intergenic
946708344 2:222481617-222481639 AGGGTAAGACATAAAGGGAATGG - Intronic
947121487 2:226819848-226819870 AGTGAAAGTAATGAGGGGAAAGG - Intergenic
948525361 2:238567759-238567781 AGGGGAAGTCAAAAGGGGGATGG - Intergenic
1168852554 20:986492-986514 TGGGGAAGCAGTGATGGGAAAGG + Intronic
1168927936 20:1598352-1598374 AGTGGAAGCAATGAGGAGAGAGG - Intronic
1169178627 20:3542566-3542588 AGGGGAAGGAGAAAGGGGAAGGG - Intronic
1169273951 20:4220890-4220912 AGGGGAAGTAATAAGGGGTAGGG + Exonic
1170101269 20:12702091-12702113 AGGGGAAGTCATAAGTGCAAAGG + Intergenic
1171183912 20:23111388-23111410 AGGGGAAGGGAGATGGGGAAGGG + Intergenic
1171317760 20:24210432-24210454 AGGGGAGGCAGTGAGGAGAATGG + Intergenic
1171349671 20:24492759-24492781 AGGGGAAGGAAGATGGAGAAAGG - Intronic
1171386418 20:24772081-24772103 AGGTGAAGCAAGGAGGGGATGGG + Intergenic
1171475996 20:25409278-25409300 TGCGGCAGCAATATGGGGAATGG + Intronic
1172706749 20:36887649-36887671 AGGCTGAGCAATGAGGGGAACGG - Intronic
1172862300 20:38064188-38064210 AGGGGAAGAAGTGAGCGGAATGG - Intronic
1173424064 20:42927610-42927632 AGGGGAAGGAAAAAAGGAAAGGG + Intronic
1173608357 20:44348435-44348457 AGGGAAAGGAAAAAGGGAAAAGG - Intronic
1174812387 20:53658066-53658088 ATGGGAAGAAAGAAGGGGGAAGG + Intergenic
1174919220 20:54683733-54683755 AGGGGGAGCAAAAAGTGCAAAGG + Intergenic
1175208946 20:57336371-57336393 AGGGGAAGGATTAAGGAGAAAGG - Intronic
1176720415 21:10388127-10388149 AGGAGGAGGAAGAAGGGGAAGGG + Intergenic
1178007298 21:28235444-28235466 AGGGGAAGGAAGAGTGGGAAGGG + Intergenic
1178880256 21:36444257-36444279 AGGGGAGGGAATTAGGGGATGGG - Intergenic
1178926891 21:36783564-36783586 AGGAAAAGGAAAAAGGGGAAAGG + Intronic
1178953157 21:37001825-37001847 AGAGGAAGTAATTTGGGGAAGGG - Intergenic
1179025184 21:37673818-37673840 AGTGGAGGAAAGAAGGGGAAGGG + Intronic
1179166526 21:38939390-38939412 AGGAGAAGGAATGAAGGGAAGGG + Intergenic
1179395514 21:41036483-41036505 AGGGGAAGGAGACAGGGGAATGG + Intergenic
1179579485 21:42331894-42331916 TGGAGAAGTGATAAGGGGAAGGG + Intergenic
1180677808 22:17599966-17599988 AGGGGAAGGAAGAAAGGGAGGGG + Intronic
1180719771 22:17898984-17899006 AGGGGGAGCAACAGAGGGAAAGG - Intronic
1181976862 22:26736556-26736578 CAGGGAAGAAATAAGGGGAAGGG - Intergenic
1182110773 22:27721687-27721709 AGGGGAAGTGAGAAGGGGTAGGG - Intergenic
1182445206 22:30386027-30386049 AGGGTAAGCAAGCTGGGGAAAGG - Intronic
1182680714 22:32077352-32077374 AAAGGAAGGAAGAAGGGGAAAGG - Intronic
1182757774 22:32694277-32694299 AGGGGAAGGGATATGGGGAAAGG - Intronic
1183728510 22:39603389-39603411 AGGGGCAGTAAATAGGGGAAAGG - Intronic
1184419147 22:44369471-44369493 AGGGGAACCAGCAAGGGCAAAGG - Intergenic
1184996449 22:48210687-48210709 AGGGGAAGGGATAAGGGGGAAGG + Intergenic
1185038642 22:48492653-48492675 AGGAGACGCAAACAGGGGAAAGG + Intronic
949442171 3:4093666-4093688 AGGGGAAACAATAAGGGAAAAGG + Intronic
949494538 3:4619567-4619589 AGGGGAAGGGGGAAGGGGAAAGG - Intronic
952181452 3:30920726-30920748 AGGGGAACTGATAAGGGGATGGG - Intergenic
952403796 3:32987437-32987459 AGGGGATGCTCTAAGGAGAAAGG - Intergenic
952463587 3:33556151-33556173 AGAGGAAGCAATGGGGGAAATGG - Intronic
952755564 3:36863119-36863141 AGAGTAAGGAATAAGAGGAAAGG + Intronic
952820705 3:37483492-37483514 GGGGGAAGTAAGAATGGGAAGGG + Intronic
953229089 3:41047884-41047906 AGAGAAAGAAATAAAGGGAAAGG - Intergenic
953329764 3:42043259-42043281 AAGGGAAGAAAGAACGGGAACGG - Intronic
954038457 3:47866405-47866427 AGGGGAAGAAAAAGGAGGAAGGG + Intronic
954448425 3:50558973-50558995 GGGGGAAGGAAGTAGGGGAATGG - Exonic
954709395 3:52497817-52497839 AGTGGAAGCTCTGAGGGGAAAGG + Intronic
955421511 3:58742831-58742853 AGGGGAAGGAAGAAAGGGAGAGG + Intronic
955482397 3:59402721-59402743 AGGGGAAGAAATAGAGGGGAGGG + Intergenic
956118242 3:65940204-65940226 AGGGAAAGCAATACTAGGAATGG + Intronic
956738042 3:72253858-72253880 AGGGGCATGGATAAGGGGAAGGG - Intergenic
958663712 3:97106515-97106537 TGGGGAAGCCAGAAGGGGGATGG - Intronic
958859047 3:99423213-99423235 GGGGAAAGTAATAAGAGGAAGGG + Intergenic
958990607 3:100839757-100839779 TGGGAAAGCAACAAGGAGAAAGG - Intronic
959716471 3:109439057-109439079 AGGGGAAGAAAGAAGGGAATGGG - Intergenic
959877477 3:111402035-111402057 AGGCCAAGGAAGAAGGGGAAAGG - Intronic
960113492 3:113869114-113869136 AGGTGAAGGAAGAAGGGTAATGG + Intronic
961615174 3:128173644-128173666 AGGGGAACCGATAAGGAGAAGGG - Intronic
961634959 3:128327573-128327595 AGTGGAAGGAATAAGGGAGATGG + Intronic
961766957 3:129218943-129218965 AGGGAAAGAAAGAAAGGGAAAGG - Intergenic
962214254 3:133506780-133506802 AGGGAAGGCAAGAAGAGGAAGGG + Intergenic
962412972 3:135157392-135157414 AGGGAAAGCTGTAAAGGGAAAGG - Intronic
962954465 3:140251632-140251654 AGGGGAAGCAAAAAGAGGAAAGG - Intronic
963280915 3:143384122-143384144 AGGAGGAACAAGAAGGGGAAGGG + Intronic
963935205 3:151045336-151045358 CTGGGAAGAATTAAGGGGAAGGG + Intergenic
964624741 3:158748323-158748345 CCAGGAAGGAATAAGGGGAAGGG - Intronic
964833331 3:160910250-160910272 AGGGGAAGGGGAAAGGGGAAGGG - Intronic
965212872 3:165817485-165817507 AGGGGAAGTGATAAGAGGTAAGG - Intronic
965662748 3:171058978-171059000 AGGGGAAGAGATAAGGGAAAGGG + Intergenic
965966004 3:174490389-174490411 AGGGGAAGGAGAAAGGAGAATGG + Intronic
966799326 3:183748227-183748249 AGGGGAGGGGACAAGGGGAAGGG - Intronic
967140144 3:186550785-186550807 AGGGGAATGGATAAGAGGAAAGG + Intronic
967142800 3:186576363-186576385 AGGGGAAGGAATTAGGGTAGAGG + Intronic
967501043 3:190197735-190197757 AAGGGGAGAAAGAAGGGGAAAGG + Intergenic
968219453 3:196925381-196925403 AAGGCAAGGAATTAGGGGAAGGG - Intronic
968633283 4:1663901-1663923 AGAGGAAACCATAAGGGGCAGGG + Intronic
968708472 4:2095225-2095247 AAGGGAAGCAAAAAGGGGAGGGG + Intronic
968738766 4:2316160-2316182 AGGGGAAGGAAAAAAAGGAAAGG - Intronic
968857508 4:3138154-3138176 AGGGGAAGGGAAAAGGGGAAGGG - Intronic
969551278 4:7869231-7869253 AGGGGAAGGAGGAAGGGGAAGGG + Intronic
969709306 4:8833554-8833576 AGGGGAGGAGAGAAGGGGAATGG + Intergenic
970573358 4:17404285-17404307 AAGGGAAGGAAGAAGGAGAAAGG + Intergenic
970803163 4:20000814-20000836 TGGGAAAGCATCAAGGGGAAGGG + Intergenic
971254963 4:25006083-25006105 TGGGCAAGCACTAAGGGGCAAGG - Intronic
971446796 4:26759002-26759024 AGAGGAAGCTGTAAGGGCAAAGG - Intergenic
972271014 4:37510927-37510949 AGGGGAGGGAAGAAGGGGAATGG - Intronic
972912960 4:43841410-43841432 AGGGGACCCAGTAATGGGAAGGG - Intergenic
973303533 4:48617159-48617181 AGGGGAAGAAGTAAGTAGAAAGG + Intronic
973723621 4:53750544-53750566 AGGGGAATAAAAAAAGGGAAGGG + Intronic
973873181 4:55187282-55187304 AGGGGAAGGGATAGGGAGAAGGG + Intergenic
974000466 4:56506339-56506361 AGGGGTAGCGATAAGGGCTAGGG - Intronic
974939123 4:68442592-68442614 TGGGGAAGCAGTTAGGGGCATGG + Intergenic
975704494 4:77098666-77098688 TGGGAAAGCAACAAGGGGGAAGG - Intergenic
976842918 4:89452750-89452772 AGGAGAAGGAATAAGAGGAGAGG + Intergenic
977125967 4:93168254-93168276 AGGGGAAGAAAGAAAGAGAAAGG + Intronic
979188666 4:117831763-117831785 ATGGGAGGCCAGAAGGGGAATGG + Intergenic
980515813 4:133858730-133858752 AGGGCAAGCAACAAGGCCAATGG + Intergenic
981086472 4:140689471-140689493 AGGGAAGGGAAAAAGGGGAAGGG - Intronic
982163767 4:152595914-152595936 AAGGGAAGCAGCCAGGGGAAGGG - Intergenic
982255031 4:153443344-153443366 AAGAGAAGCAAGAAGGGGGAAGG + Intergenic
982329650 4:154166804-154166826 GGGTGAAGGAATGAGGGGAAAGG + Intergenic
984257838 4:177408740-177408762 AGGGAATGCAATAAGAGGACAGG - Intergenic
984352477 4:178613312-178613334 AAGGGAAGAAAAATGGGGAATGG + Intergenic
984911440 4:184676935-184676957 GGGGGAAGGGAGAAGGGGAAGGG - Intronic
985321873 4:188721675-188721697 AGGGGAAGGAAGAAGGAGAAAGG + Intergenic
985723038 5:1500827-1500849 AGCAGCAGCAATGAGGGGAACGG - Intronic
986240407 5:5955077-5955099 AGGGGAAGGAATGAAGGGGAAGG - Intergenic
986946660 5:13029276-13029298 AGGGGGAAGAAGAAGGGGAAGGG + Intergenic
987374862 5:17224451-17224473 AGGGGGGGAAAAAAGGGGAAGGG + Intronic
988790713 5:34604882-34604904 AAGGGAAGCAAGATGGCGAATGG - Intergenic
988801206 5:34698173-34698195 AGGGGAAGGGAGGAGGGGAAGGG - Intronic
988857902 5:35247038-35247060 AGAGGAAGAAAGAAGGGGAGGGG + Intergenic
988868064 5:35357126-35357148 AGGGGAAAGAAGAAAGGGAAAGG - Intergenic
988903731 5:35762840-35762862 AGGAGCAGCAATAAGGGAAGAGG + Intronic
989353695 5:40517135-40517157 GGGGGCAGGAATAAGGGAAAGGG - Intergenic
989690033 5:44131141-44131163 AGTGGAAGCAACAAGGAGAAGGG - Intergenic
989737134 5:44721320-44721342 AGGGAAAGCATTAAGAGGGAGGG + Intergenic
989981750 5:50654146-50654168 AGAGGAAGCAAGAAAGAGAAAGG + Intergenic
990182300 5:53174523-53174545 AGGAGAAGGAAGAAGGGGAAGGG + Intergenic
990391168 5:55322804-55322826 AGTGGAAGGAATAAGTGGGAAGG + Intronic
990594698 5:57301072-57301094 TGGGGATGCAATCAGGGGAGTGG + Intergenic
990829846 5:59943922-59943944 AAGGGAAGCAAGAAGATGAATGG + Intronic
991041291 5:62178361-62178383 ACTGGATGGAATAAGGGGAAGGG + Intergenic
991332856 5:65511257-65511279 AGGGGAAGCAATAAGTGCTGAGG + Intergenic
991360372 5:65813549-65813571 AGGGAAATCAATAAGGGGAATGG - Intronic
991646663 5:68807950-68807972 AGGGGAAGGGAAAAGGGGAAGGG + Intergenic
992301297 5:75383933-75383955 AGCAGAAGAAATAAGGTGAAAGG + Intronic
993032414 5:82720720-82720742 ATGGTAAAAAATAAGGGGAAAGG - Intergenic
993035249 5:82748884-82748906 AGGGGGAGAAATAAAGGAAAAGG + Intergenic
993379590 5:87191342-87191364 AGGGGAAGAATTATGGGGAGGGG + Intergenic
993826679 5:92696308-92696330 AGGGAAACCAATAAGGTCAAAGG + Intergenic
994384494 5:99113611-99113633 TGGTAAAGCAATAAGGTGAAAGG + Intergenic
994695477 5:103068187-103068209 AGGGGTAGCAAGTAAGGGAAGGG + Intergenic
995083906 5:108086005-108086027 AGGGGCAGAAAAAAGGGGCAGGG - Intronic
996075233 5:119185163-119185185 AGGGGAAGAAGTAGAGGGAAAGG - Intronic
996486230 5:124038414-124038436 AGGGAAAGCAATAACAGGGATGG + Intergenic
996540627 5:124627335-124627357 AGAGGAAGCACTCAGGGAAAAGG + Intergenic
997659216 5:135577139-135577161 AGGGGAAGAAAGCAGGGTAAAGG - Intronic
998042605 5:138962019-138962041 TAAGGAAGCAATAAGGAGAAGGG - Intronic
998186381 5:139982925-139982947 AAGGGAAGCAGCAAGGGGAGAGG - Intronic
998364610 5:141621169-141621191 CAGGGAAGAAATAAGGGGCAAGG + Exonic
998490115 5:142539473-142539495 GGGGGAAGCAAGGAGGGGAGAGG - Intergenic
999253900 5:150198964-150198986 AGAGGAAGGAAGAAGAGGAAGGG + Intronic
999437203 5:151571979-151572001 AAGGGAAGCAGTAAGTGCAAAGG - Intergenic
1000284937 5:159818937-159818959 TGGGGAAGCAGTAATGAGAAAGG + Intergenic
1001226757 5:169951169-169951191 AGGGCAAGAGAAAAGGGGAATGG + Intronic
1001335833 5:170795803-170795825 AAGGGAAGAAATAAGGGCAATGG + Intronic
1001527159 5:172437145-172437167 AGGGAAAGCAACAAGGGCAAGGG + Intronic
1001737798 5:174021048-174021070 AGGGGAAGCAGAAGGGGAAAGGG + Intergenic
1002254781 5:177951025-177951047 AAGGTAAACAATAAGGGGATGGG - Intergenic
1002475712 5:179464583-179464605 ATGGGGAGCCAGAAGGGGAATGG + Intergenic
1002759077 6:187960-187982 AGGGGAAGAAATTCGGGGCAAGG - Intergenic
1002829820 6:809552-809574 ATGTGAAGGAAGAAGGGGAAAGG + Intergenic
1002917171 6:1538659-1538681 AGGGGAAGAAAGATGGAGAAGGG + Intergenic
1003022746 6:2525594-2525616 AGGGGATGAAAGGAGGGGAAGGG + Intergenic
1003342484 6:5235075-5235097 AGGGGAAGTAATGATGGAAAGGG - Intronic
1003487841 6:6595197-6595219 AGGGGGAGAAAGAAGAGGAAGGG + Intronic
1003579180 6:7324087-7324109 AAAGGAAACAATATGGGGAAAGG + Intronic
1003984922 6:11426010-11426032 TGGGGAGGCAATGAGGGGAGTGG - Intergenic
1004615428 6:17283377-17283399 AAGGGAAGCATTAAGGGGTAGGG + Intronic
1004847756 6:19664202-19664224 AAGGCAAGCAATAGAGGGAACGG - Intergenic
1005398299 6:25406267-25406289 AGGTAAAGCAAGAGGGGGAAGGG + Intronic
1005744047 6:28819733-28819755 GGGGGAGGCGAGAAGGGGAAAGG + Intergenic
1005749747 6:28871750-28871772 AGAGAAAGCAAAAAGGGGATAGG - Intergenic
1006088666 6:31615196-31615218 GGAGGAAGGAATGAGGGGAAAGG + Exonic
1006145869 6:31959284-31959306 GGGGGTAGCACTACGGGGAAAGG - Exonic
1006299505 6:33186116-33186138 AGGGGAGGTAGTAGGGGGAAGGG - Intronic
1006416275 6:33905931-33905953 AGGAGGGTCAATAAGGGGAAGGG + Intergenic
1007234493 6:40380498-40380520 AGTGGAAGGAAGAAGGGGAAAGG - Intergenic
1007918238 6:45582213-45582235 ATAGGAAGCAATAAAGAGAATGG - Intronic
1007936563 6:45737660-45737682 AGGAGAAGAAAGAAGTGGAAAGG - Intergenic
1008111204 6:47497194-47497216 GGGGAAAGCAAAAAGGGGAAAGG - Intronic
1008117698 6:47571381-47571403 AGGGGAAAGAACAAGGGGAAAGG + Intronic
1008880819 6:56378500-56378522 AGAGGAAGGAAGAATGGGAAGGG + Intronic
1008912171 6:56746632-56746654 AGTGGAAGCTATAAGGAGAGAGG + Intronic
1011497053 6:87947278-87947300 AGGGGAAGAAAAAAGGGGTGAGG - Intergenic
1011888660 6:92128900-92128922 AGGGGCAGGAAAAAGGGAAATGG + Intergenic
1012072272 6:94637947-94637969 AGAGGAAGCAAGGAAGGGAAAGG + Intergenic
1012332621 6:98011812-98011834 ATGAGAATCAGTAAGGGGAAAGG - Intergenic
1013946466 6:115728447-115728469 GGGGGAAGCCAAAAGGGGGATGG - Intergenic
1014659846 6:124156217-124156239 AGGGAGAGCAGTAAGTGGAATGG + Intronic
1015015918 6:128412841-128412863 AAGGGAAGAAATAGGGAGAAAGG - Intronic
1015018159 6:128439195-128439217 ATGTGAAGCAGGAAGGGGAAGGG - Intronic
1015211947 6:130708618-130708640 AGAGGAAGGAAGAAGGGGCAGGG + Intergenic
1016116089 6:140287921-140287943 AGGAGAGGGAATAAGGAGAACGG + Intergenic
1017089260 6:150743917-150743939 GAGGGAATCAATAAGGGTAATGG + Intronic
1017239059 6:152147222-152147244 AGGGGAAGCAGAATTGGGAATGG - Intronic
1018379073 6:163241167-163241189 AGGGGAAGAAAAAAGGTGAAAGG + Intronic
1018954594 6:168400319-168400341 AGAGGAAGCAATGAGGGGCAGGG - Intergenic
1019016660 6:168885180-168885202 AGGTGAGGCAAAAAGGAGAAAGG - Intergenic
1019919969 7:4157281-4157303 AGGGGAAGGAAGAAAGGGAAGGG + Intronic
1019969145 7:4526138-4526160 AGAGGAAGAAGAAAGGGGAAGGG + Intergenic
1021638679 7:22716944-22716966 AGACAAAGCAAGAAGGGGAAAGG - Intergenic
1021984217 7:26083518-26083540 AGGGGAAGAAATGAAGGGAAGGG + Intergenic
1022036346 7:26538217-26538239 AGGAGAAGGAAGAAGGGGACAGG - Intronic
1022061346 7:26799012-26799034 AAGGGAAGGAAAAAGGGGAGGGG + Intronic
1022066302 7:26861663-26861685 AGGGGAAGGAAAAAGGGAGAGGG + Intronic
1022854109 7:34298694-34298716 TGGGTAAGAGATAAGGGGAAGGG + Intergenic
1022970840 7:35515433-35515455 AGGGGCTGGAAAAAGGGGAATGG - Intergenic
1024594518 7:50920853-50920875 AGGGGAGGCAGGGAGGGGAAGGG - Intergenic
1024640542 7:51325206-51325228 AGGAGAAGAAATAAAAGGAATGG + Intergenic
1025005243 7:55348917-55348939 GGAGGAAGGAATGAGGGGAAAGG - Intergenic
1025764944 7:64435326-64435348 AGGGGAAGCAGGTAGGGGGATGG - Intergenic
1026211461 7:68309627-68309649 AGGGGATGGGATAAGGGAAATGG + Intergenic
1026308756 7:69166121-69166143 AGGGGAAGGGAAGAGGGGAAGGG + Intergenic
1026308760 7:69166134-69166156 AGGGGAAGGGAAGAGGGGAAAGG + Intergenic
1026407216 7:70078725-70078747 AGGGGAAGGAAGAAAGGAAATGG + Intronic
1026433293 7:70369568-70369590 AGGGGAGGCAAGAAGGAGAGTGG + Intronic
1027275964 7:76556401-76556423 AGGGGAAGGAAGATGGGGAATGG - Intergenic
1027889760 7:83956784-83956806 AGTAGAAGAAATAAGGAGAAAGG - Exonic
1028046848 7:86130869-86130891 AGGGGAAGTAAAAAGGGGACGGG + Intergenic
1028611361 7:92715600-92715622 AGCAGGAGCAATAAGAGGAATGG + Intronic
1028634278 7:92970102-92970124 AGGTGGAGCAATAAAGGTAAGGG - Intergenic
1029406056 7:100374585-100374607 AGGGGAAGAGAAAAGGGGAGAGG - Intronic
1029546343 7:101212380-101212402 AGGGGAAGACATAGGGGGATGGG + Intronic
1029928429 7:104343793-104343815 AGGGGATGTAATCAGGGGAGTGG - Intronic
1030228970 7:107185141-107185163 AGGGGAAGAAAAGAGGGCAAGGG + Intronic
1030380258 7:108803247-108803269 AAGGGAAGAAAGAAGGGGAAGGG - Intergenic
1030746563 7:113173039-113173061 TGGGGAAGCCAGAAGGGGAATGG - Intergenic
1030863500 7:114668460-114668482 AGGGGAACCAGAAAAGGGAAAGG - Intronic
1030881522 7:114886218-114886240 AGGGGAGGGAAGAAGGGGAAAGG + Intergenic
1031656999 7:124368430-124368452 TGGGGAAGCAGTATGGGCAATGG + Intergenic
1032002133 7:128272217-128272239 AGGGGAAGCAGGAAAAGGAAAGG - Intergenic
1032457679 7:132086225-132086247 AGGAGAAGGAATAAGAGGACAGG + Intergenic
1032540272 7:132697270-132697292 GGGGGAAGGAGTGAGGGGAAAGG + Intronic
1033154576 7:138946015-138946037 AGGGGAGGAGAGAAGGGGAAGGG - Intronic
1033736661 7:144229045-144229067 TGGGGAAGCCATGAGGGCAAAGG + Intergenic
1033746395 7:144321905-144321927 AGGGGAAGCCATGAGGGCAAAGG - Intergenic
1033804361 7:144937524-144937546 AGGGGAAGGGGGAAGGGGAAGGG - Intergenic
1033804368 7:144937537-144937559 AGGGGAAGGGGGAAGGGGAAGGG - Intergenic
1033804391 7:144937598-144937620 AGGGGAAGCAGAAAGGGGAAGGG - Intergenic
1033982616 7:147184726-147184748 AGGAGAAGAAAGAAGGGGATGGG + Intronic
1034672098 7:152866713-152866735 AAGGGAAACAGGAAGGGGAAGGG - Intergenic
1036845622 8:12168053-12168075 AGAGGAAGCAACAAGGGTAATGG + Intergenic
1036866988 8:12410372-12410394 AGAGGAAGCAACAAGGGTAATGG + Intergenic
1038287111 8:26215198-26215220 AGAAGAAGGAAGAAGGGGAAAGG + Intergenic
1038400935 8:27284080-27284102 AGAGGAAGCAAAAAAGGAAATGG + Intergenic
1038483732 8:27919131-27919153 AGGAGAAGGAAGAAGGGGATGGG + Intronic
1038976325 8:32700839-32700861 AGGGGAGGAAATGAAGGGAAAGG - Intronic
1039689286 8:39846291-39846313 AGGGAATGCAAGAATGGGAAGGG + Intergenic
1040602361 8:48897362-48897384 ATGGGGAGCAAGAAGGGGGATGG + Intergenic
1040901668 8:52423455-52423477 TTGGGAAGCATCAAGGGGAACGG - Intronic
1041324588 8:56651362-56651384 AGAGGAAGCAAGATGGGGGAAGG + Intergenic
1042025309 8:64416490-64416512 AGAGGAAACAATATGTGGAATGG - Intergenic
1043149757 8:76700321-76700343 AGAGGAAAGAATAATGGGAAAGG - Intronic
1043487436 8:80711827-80711849 AGGGGAAGCAGTGAAGGTAATGG + Intronic
1044838407 8:96317216-96317238 AGGGCCAGGAATCAGGGGAAAGG - Intronic
1046396633 8:113648990-113649012 AGTGGGAGCAAGATGGGGAAAGG - Intergenic
1046738149 8:117799669-117799691 AGGGGAAGCAAGAAGGGATGGGG - Exonic
1046825801 8:118690174-118690196 AGGAGAGACAATCAGGGGAAAGG - Intergenic
1047883156 8:129218586-129218608 ATGGGGAGCCAAAAGGGGAATGG - Intergenic
1048122752 8:131600003-131600025 AGGGGACTCAAGAAGGAGAAAGG - Intergenic
1048165914 8:132061342-132061364 AGGGAAAGGAAGGAGGGGAAGGG - Intronic
1048185177 8:132233890-132233912 AGCTGAAGCAATAAAGGAAAAGG + Intronic
1048308912 8:133303276-133303298 AGGGGCAGGAAGAAGGGGAACGG - Intergenic
1050340851 9:4637170-4637192 AGGGACAGCAAGAAGGGTAAGGG - Intronic
1050360145 9:4822476-4822498 AGAGGAAAAAAGAAGGGGAAAGG - Intronic
1050625778 9:7502418-7502440 AGGGGAGGAACTATGGGGAACGG - Intergenic
1051347511 9:16165593-16165615 AGAGGAAGCAAGAAAGGGGAGGG + Intergenic
1051388686 9:16539717-16539739 AGGGGAAGGAAAAGAGGGAAAGG + Intronic
1051652118 9:19338331-19338353 ATCTGAAGGAATAAGGGGAAAGG - Intronic
1052558748 9:30055832-30055854 AGGGAAAGGAATAAAGGGAAAGG - Intergenic
1052722151 9:32184980-32185002 ACGAGAAGCAATAGGGGCAAAGG + Intergenic
1052821583 9:33141625-33141647 AGGGGAATCAACTAGGGGACAGG + Intronic
1053105663 9:35405847-35405869 AGGGGAAGAAATAAGGTAAAAGG + Intergenic
1055141639 9:72883210-72883232 TGGGGGAGAAAGAAGGGGAAAGG - Intergenic
1055523757 9:77109141-77109163 AGGGGAAGCAAGAAAGGGAGAGG - Intergenic
1055794790 9:79964291-79964313 GGGGAAAGAAAAAAGGGGAAAGG - Intergenic
1055950800 9:81728117-81728139 AGAGGAAGCAAGAAGAGCAAGGG - Intergenic
1056482821 9:87023147-87023169 AGGGGAAAGAATAAAGGTAAGGG - Intergenic
1056597839 9:88022210-88022232 AATTGAAGCAATAAGAGGAAAGG - Intergenic
1057173667 9:92978670-92978692 AGGGGAAGGAAGAGGGGGGAGGG - Intronic
1058330014 9:103748924-103748946 AGGGGAAAAAAGAAGTGGAAGGG + Intergenic
1059761248 9:117339761-117339783 AGGTGAAGGAAGAAGGAGAAAGG + Intronic
1060186274 9:121566065-121566087 AGGGGAAGCCACCAGGGGAGAGG - Intergenic
1060290563 9:122298991-122299013 AGAGGAAGCAAGAAGTGCAAAGG + Intronic
1060416387 9:123433816-123433838 GGGGAAAGCAGTCAGGGGAAGGG - Intronic
1060757208 9:126222713-126222735 AGGGGAAGCAGCGAGGGGAGAGG + Intergenic
1061144229 9:128787664-128787686 AGGGGGATCAAAAGGGGGAAAGG - Intronic
1061237506 9:129351416-129351438 AGGGGAAGCAGGAGGAGGAAAGG + Intergenic
1061928510 9:133819855-133819877 AGAGGGAGAAATAAAGGGAACGG + Intronic
1061947172 9:133914799-133914821 AGGGGAAGGGAGAAGGGGAGGGG + Intronic
1062171522 9:135137411-135137433 GGAGGAAGGAACAAGGGGAAGGG + Intergenic
1062251353 9:135596957-135596979 ACAGGAAGAAATAAAGGGAAGGG - Intergenic
1062362613 9:136194769-136194791 AGAGGAGGGAAGAAGGGGAAGGG - Intergenic
1062638426 9:137503643-137503665 AGGGGGAGGAAGAAGGAGAAGGG + Intronic
1062638431 9:137503662-137503684 AGGGGAAGGAAGAAGGAGAAGGG + Intronic
1062638441 9:137503698-137503720 AGGGGAAGGAAGGAGGAGAAAGG + Intronic
1062725942 9:138073640-138073662 AGGGGAAGCAAGACGGAGGAAGG - Intronic
1185714833 X:2333065-2333087 AGGGCAAGAAAACAGGGGAATGG - Intronic
1185867520 X:3636961-3636983 AAGGAAAGGAAAAAGGGGAAAGG + Intronic
1186588098 X:10898138-10898160 AAGGGAAGGAGGAAGGGGAAAGG + Intergenic
1187236321 X:17470666-17470688 AGAGGAAACAATAAGTGCAAAGG - Intronic
1187324234 X:18271954-18271976 ATGGGCAGCAATAAGAGCAAAGG + Intronic
1187506331 X:19881321-19881343 AGGGGAAGGAACAAGAGGCAAGG + Intronic
1187652624 X:21425862-21425884 AGGTGAGGAAATAAGGGTAAGGG + Intronic
1187746648 X:22416367-22416389 AGGGGAAGGAAAAAGGGGGTTGG - Intergenic
1187802478 X:23079724-23079746 AGGGGAAGGATTTAGGGAAATGG + Intergenic
1187940061 X:24372657-24372679 ACTGGAAGTAAGAAGGGGAAGGG + Intergenic
1187946787 X:24433876-24433898 AGGGAAAGCTATAAGGACAAAGG + Intergenic
1189199329 X:39178179-39178201 AGGGGAAACAGCAAGTGGAAAGG - Intergenic
1189286310 X:39854589-39854611 AGGGGAAGCTATATGGGGTGGGG - Intergenic
1189448567 X:41105087-41105109 AGGGGCAGGTATAAGGGGGAGGG + Intronic
1189548888 X:42072589-42072611 TGGGGAAGAGACAAGGGGAAGGG + Intergenic
1190073839 X:47300977-47300999 AGGAGGAGGAAAAAGGGGAAGGG + Intergenic
1190311767 X:49122074-49122096 AGTGGAATGAGTAAGGGGAAGGG - Intronic
1190413223 X:50157154-50157176 AAGGCATGCAATAAGGGGATTGG - Intergenic
1190561938 X:51694951-51694973 AGGGGAAGGAGAAAGGGAAAAGG + Intergenic
1190600822 X:52089973-52089995 ATGGGGAGCCAAAAGGGGAATGG - Intergenic
1192316549 X:70056251-70056273 GGGAGAAGAAATAAGGGTAAAGG + Intergenic
1192448961 X:71230904-71230926 AGGGGAAGGAAGAGGGGGAAGGG + Intergenic
1192925739 X:75753210-75753232 AGGGGAAGCTATAATGTGATGGG - Intergenic
1193207309 X:78764484-78764506 AGAGAAAGCAAGAAGGGGGAGGG - Intergenic
1193322032 X:80134062-80134084 ATGGGGAGCTAAAAGGGGAATGG - Intergenic
1193601168 X:83509574-83509596 AAGGGAAAGAAAAAGGGGAAAGG - Exonic
1193837765 X:86366789-86366811 AGGGGAAGCAAAAAGGGGGGTGG - Intronic
1194777968 X:97989278-97989300 GGGGGCATTAATAAGGGGAAAGG - Intergenic
1194810592 X:98382757-98382779 AGGGGAAGAATAAAGGGAAAAGG + Intergenic
1195372455 X:104191471-104191493 AGGAGAACCAAAGAGGGGAAGGG - Exonic
1195594450 X:106672851-106672873 AAGGGAAGCAAAGAGGGGGAGGG - Intronic
1195753710 X:108180634-108180656 AATGTAAGCAATGAGGGGAAAGG + Intronic
1195961032 X:110387052-110387074 AGGGGAAGCTTTAAGGAGAAGGG + Intronic
1196095546 X:111794729-111794751 TGGTGAAGCAAAAGGGGGAAAGG + Intronic
1198448228 X:136739894-136739916 AGAGGAAGCCAAAAGGGCAACGG + Intronic
1198714081 X:139537794-139537816 AGAGGAGGCAAGAAGGGTAATGG - Intronic
1199432437 X:147776559-147776581 AAGGGAAGCTAGAAGGGGGATGG + Intergenic
1199855551 X:151756259-151756281 AGGGGAAGCAAAAGGGGGAGAGG - Intergenic
1199998578 X:153044082-153044104 AAAGGAAGCGATCAGGGGAAGGG + Intergenic
1201691797 Y:16775129-16775151 AGGGGAAGAAAGAAAGGAAAAGG - Intergenic